%PDF-1.5 % 1 0 obj <>>> endobj 2 0 obj <> endobj 3 0 obj <>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.2 841.92] /Contents 4 0 R/Group<>/Tabs/S/StructParents 0>> endobj 4 0 obj <> stream x]KGrtT>H\Rܱ}!G;<,aO>QցaO/{rD;̈痙ͣru3ˣ㛛tOG'~>z|w~9\~Of_<~t QzvrbVrYtGyO?~ W[eΚRZQً'#ϯ777B&: 4e!Zš(bB˅*BBx-B-ьXnR'f~tjhm0_-Dc`^@&4yLAjX:B>ݣod_NR__}d,uSTz7ж+1״EvQU׽^Gv.A%ש Avv~.~m[<X%HĜQg #).?6Q%PKI* T ՚F1)uʄCi$E~ 9dž9bceܖ$ͼFEjk91a_Ňj!-#\sV܀ sQvѿfvUaF75 \o(g+wk`fulW^ V;+I90WPʆX@]̳z/㈀{ üǂkCfl)`YACxB6 J$|MSR!Q?նX37DO&lܔQ*Z;," CU*]l/cUg&%?Q^"h[WA3R_n_q%S5[&I/@*NK%ȕ>XIeTBu[&zAr:QN'!W}Roma\׆LGskYr%fX6 JMg[DV!&ݦcpS;e2wX \)nڛo1"qf@[x!//w.F~,d#EݍE 1ή)HG τV{Y(݉dTUh09m|9>h ]HN_ V!"Ql-KX$ 4yJ* D*hH҇%Zǯט>T U_`m<D̦0;^p'|-^N(@!KX2p dfҟ|c(#yxLua!? ul##Yon6˨5.aE3>0B =szvf%ʧi>X(¹B9ittv/D :Gw(ufښȆ;zL|O:DD~҈Pvʬwe|up,FςFp&ìb~'Ё Nk-6lt+)%e Ӷ߉h0I:ټmpNr@'o `v_J."%Jd+ܭUdM^#":vqnDh0N):Eg KϭQRE+ N_Zzܰւ 4\xBJm ڲV[br^+ vwF:qGf>Q:'pD9' .oM9g궉? kBn(%2}l$MA uPͤ΂A]BBԅCBaE8K)P$^ܤ2 'ˆ,(-sPab/B>r(l.xEK|Ua]!mߜtI^JBXYܜ[3т[995%2fTlؿ ƴ<>Z v usΠ`Ft7Y.A:Nrv#0A0a$CtۂdG5gĥpJvEl'@PD#prAP<^Qv1^k a,*RMv ѭͭM2Q-Om퐱pѐhJդ>DZ< m0mJ^I;?-~- uW61q8n8'!QX! um3m 9\Op>Y٭]f KO 4ol,Vx4!;Ɋu0Ф>P.a%l}jEWQ"؁ҴGYʔrOnhȝ?JE~W4R)t*pufP2ƻ >IW]іkh Gt!l}It`AϐphX pBc#ʕ6ڱyũ'cGa_*Ćɽv7#%lkui"ȁ-`Q4K^/"G?u!96G ֚0%[퐙ڨ BO-V%Z71~f.CC %RY" Ⱥ`dRMeӚS2T[c&=gW߽"aRvI=Lj)Bn8f1&:."da)a'4mH+dN֪ 6֣J.CugSvV?>:*} 5gVWX$ѧ_\\UgnqgArT  j*`S.!;oI*gQvz̘,$H5"Jv{{i!c]]D}'A N E&S9qL؍s=$z_k1nkϷ'&DZdȕi0?%,i#NM""+SUt!974^Ag*#؞vinv cǫ}t,l|s +0=C#u]b%!a2:Fd%43Nvm~9vQfxxnM!O;Mta:2=~hl[K0IWRiuzW^FiHo"x4頪x3WEթ~?6;pX>7N=de"zM>U4 aO^ה W*d09SUѐ8l'.F#n<|F.SdkLjҲnc;(I?~6%[6o1?Z1>O<#YNz3m7M6kx$AC7ga7FN}D{z&oJsȬf\KeZ 9h2Ur$]wq6_(>la81Ȩ+M:|pN2*vMRu)Ꜧ:z!T1CxD!gվ>up?xQww!Q}8#BjaV:)f%`ؙ4mL'CnemY~!!E #dr,_`_kq15I( [e}D8?vr7OS1LBMU_mM2(As=?0\d endstream endobj 5 0 obj <> endobj 6 0 obj <> endobj 7 0 obj <> endobj 8 0 obj [ 9 0 R] endobj 9 0 obj <> endobj 10 0 obj <> endobj 11 0 obj <> endobj 12 0 obj <> stream JFIF``ZExifMM*JQQQC    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ???2O{T?Ʋh󹙭 O=dG%>!d@s3[{T?ƏJ|CAS$ɢf%>!ڧI5EoJ|CAS$?)O k&ڧI4Sj'M35)O h??2O(fkSj' O=dY4P??2O{T?Ʋh9 O=dG%>!d@s3[{T?ƏJ|CAS$ɢf%>!ڧI5EoJ|CAS$?)O k&ڧI4Sj'M35)O h??2O(fkSj' O=dY4P??2O{T?Ʋh9 O=dG%>!d@s3[{T?ƏJ|CAS$ɢf%>!ڧI5EoJ|CAS$?)O k&ڧI4Sj'M35)O h??2O(fkSj' O=dY4P??2O{T?Ʋh97^UI `=_B}kͼHPø5z?4͡]JIw<&jYRf(((((((((((C־h!Y_La_+߮J?3s.^??2O{T?Ʋhf%>!t^eϧJeQjf]6Haw 3DˎvU8;Wi%TdعͼmEy׎5(+:HT Ɠ=KkFnpx 뺝ʕoef8H=듙< ,1VtIRwJE1 VwwL=Ny,OF $~%=ڍ}APB#=+gyo}HiֶnDo#Xi<7w[Gq#prYCs1D&/ ̎pn (k3qዉyWw?GZ~NC 9{=pp kG8OT-5 o@yR8C=}kI"r9tJ73+38~5[{1H |VVzHQE|EPyEj 'ӧFȊxpc@hחՍ͝Q\?-Jۦ{fӬSCk o9 1{3` TϢfjZI}[ ӧLF{QX#42ǐ #fU|?]_g+]ʎ".Ks/}Euw W]N 틵YHѕTEV";-,z(-icĞr^ib1;2pwWBc@/o^pEx̯3K\n*GulLh$Z|eHF! }?IUȠ?v. G;Z#(́a'M|BE]8 zKmMq$*/ }4}V hLH9'?Ы5ަf?A?v~&?m6}Fq?ij󾗪jQ#oyBo^Pk0hB)?M2wM.Mu^2)h>'.${0^\IbNzoA+c#'Nh>_.=MGQUKJIa:LR~Wſ1иͼO9uyHK9esw4s'+H@*-2{]V6 sw~Q['ɴQETՁSy=- O6&#h?:  4zAfmn=įTsd9-LI4˶3L$}?!\ Չ>ׄ_Җ^m4A*,aYjdE3A::kyd|~Nj 6Kŋ6{A/գ?jun[yц`$#'"IyvydbrXI> RMh2(((((((((((+͊щ#դ1Ng6Kp P 1\=Ou{qx7Q,QT^bE-X445h=.ڠʝzqQI%དྷY&`sBG~1fv!ˬkx؇ 8%x`=y5Pk:xPJB>ç9ܞy_u2z:=LK@ZZǞ$)q\~5v uK}X 9 2{gX W22U jk:..$3Gi rzo֝2y_RNno\[R̠1+jyuUV^_se%UϮ8sZKqmnܶy8F~ku@Yˆz@X}Av++k*lyM63#FԓƱ*{人4,Tȓ (B((( x>F8l9>v}ۏ"PO O`4Xyt:(((((((((((C^ VIc*ֽאgΓt FOЩcY^QEAZ^D gԶqM hH# א0(AWwRI$lFORG3jg?t+i-kE{wq^YjLm1&/P=љ8=O]zGA[i\DSƒ~*-ՋBJz\Mqzp,zg8}^aK7JHe:m<^ѻ-7_:<0ϭy_&"َ: 6~5 i"HF3sMsD9 H[!2}{j[7FjzD|ip#^8AO NXCc\gH TY^W_J([?Mٮ_oBS*m>bmeP::,M\:Lb銟Nڜ/p;63j= $9UeO%܇r rJ@<?TXeUd--m%8׭^k}-#h ;xUYR\D8FX. [XEd+0_VkCk%m.K \wO<%ix)ԃ}rr?MW0\op u!5x4X5]'>m+sj&գDomcVmY/0[yݚ?1wH[9GcYʹ&lftj:Z";F[CDO- ;'TMQf '`8'jAziOɮd\=]XWs=(#1i#=9 Cg>9I1j:G;.?zh匱*1' WIlV24I62tpN>RZ=Ch5M@J:.٭mBC֫ܨ\8ȱ{䫶@R@W/5)K6SMxs5D6߿>*yh_֬*yv3G_K}K Zwb4~ѥτG4:9v3G_K}K Zw`hK Zi/Vur.F4F>gQG"F>h_֬(]?h_֣_K՝EG_K}K Zw`hK Zi/Vur. i/Q/|%j΢E݁/|%j>ѥτYQȻ4~ѥτG4:9v4F>gQG"F>h_֬(]?h_֣_K՝EG_K}K Zw`hK Zi/Vur.f4F>gQG"s% ÏfERVQE((UQ]FĚ=??t.>#Peh4TGWԄz%eԩIUhh_ pkM'4mooJ )Ӝesh)h:Š((((((((((/i|ֳ~S]gpմ;<> F Ht%ucS9J=6 (;>O7Nѯ5ể.b'&&yf&QE@Xk<6"??:Bl Uꎣ!]۹CM)7/K̈g\ nAk6j.~B #8vvRAWޭ}U=Ӫ3%$s^zW5i'Q#He-6gq:Sm?u)l-W*nQv{g׵GcD69߃ש*O*W6n-.,]^UC۪,'ib6}zZO2_If֫vc`ѱ GqӡQ=-L=,Gb8*ŵ#z r>ğ΍=gUeKMm z瀠⦸ra0I=:e|P$+&q-OaugkqaβQ3nR2z'a=5skm#yޘ $$UHQDsvoVT0'|.F [*Q j*UI7{QI7ك`Nr] Tzj*O*@8/6YFZH I_jډQUA2[3[Yݒ%22c9#+necz_]NJ䷷v$xa& ;6:SRO1uwL@y›yKѦaI16t9:&%&U brycVvcku4A%Ut:SoKXu  Kk.b9-W`%ޢb-s G~5Ƣ"iDVlG2HO )I,)gsV\2Y%RfzjH2Heu6)FH?Cy 9#7%nOR0xv "aOtw9ޙϹ";mod~jhnu⍇!DF#q630Xr9FVS.$GܭAAZ\hκgY~+>M(<((((((((((((((((((((((;|sq{W~äƺM~pR",зn޴9#GYn7k SW2H=O^SFЕ~Ē/a[ uli;F{QjZBvIXSQ2zޝ@Q@R&@r2)h((((((((n->pޘW9$3{~xIs_tcӵTOL7וٿ:Z aEPfnxbe쐓r>K]?fX:+FA?N-Q\ZYHHY 2Zqvi;3'#$Zc}cɉz׭e\VCP}=*s brzittuܗ03F[OҟiM^Jɬ9NxgZ2Bd @~?j2[@[&yVr}jiԴŚ` |gq<ϩ)r^G}aFi~Urg=yh蚲7"HHŜ67{}(3@e)QsUO3gs5sPnvrGۑ5^GOP+@1.:Xɕ ÐpRKPS9Tf^N3֗dnSӰ HlGU *9EK U%%@O&-$hIOm$ |]FӟҡOoO7qQBF2;Ooz"IveL`}WN$ cʳFDHۿPf;c,SUm ¯NNЖWYחPGhRA9ja̐+020q*WRA-mmF8{"WC:Ι}QqA]mƉ a_f#'*{Zb䌜{i92K1\QV۞p8 q~T5[xT '-X̷7"ߜ uw"Qe "bȫ̙>)0+5TdʉK "KEm=NG?S|3:1=>YÂGCvTl/Bqndt9x#U5H!V5j''gfQ/h HJw>O%fnn;8et5NBa`ISHihXgC*p\zOxsU1$~b7gV6^+6|݃jSݹ/utoaJ2`'3.JmR [ILl\@Vi_k$Б=~=ñK ?*?:鑯dK1Ƕy"O#\U$9*)Y"Q=Q]'ImQAQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Š(AEPEPEPEPEPEPEPEPEPEPEx-O"H?툖 ,TbwcMv 3nľ=ϯֽ6AOyU*)&#K31Ԛ !څNpI5NK9alԕ o_JM;ĺ6v67#Ovm}B+@?J ׺Ϟt?jZh7NQ^xmzuG\W>MmZp-i~[Ϲ9"LYmnp@9GB:uPsN>ҼE묉1w\~J5kK^5`΅V6i#̝`?>Qo9;,d(9$Jqc]>๧UPs |{WRv0rGtwPH#Ynac*=Wҽ-S23UlM>/.OR'{]V<\Ef]4f՗hfdF 2;4 (\7]h"t+k.ܢ\[$c9U\5?]Țogl"%d%0>Y7ēM"KxxLzgsEGQ\O]hc[IyPQShZuTX-lG $qu{'Y5]hpAt[J'{zw'@=71O?Aψ9(+nEƗ'-qUᛱ ۱8xVS`:(0)RUA>`Faw <+oTa"q.}kjGi >0 pkJgFIH6{@1\r+4ѲO6Q@q[ܴ^"#"Pcj@]Dbg@S:+<8A➥Qj3u.I,[0U?Z .~G,p 5 MM(<(((((ht Swiۖ Kv=q^/_@BO+> Is]gp'9ះ5RV{[xX aYW |v?qiͯ^'qǿ?fAC5>M68Vج𿁼]o$z @[e;rg@N?xL(orYI)rtۍT@[~`5kp>Ki1“ROeośtƂE3Z|OIL}27"cЉ96q`D~?yy)$N[vG׽gxtڂ%>e|9unJ-Ԓr|H, @TFHnη~ZoTYq5ǥ{Huς eX?^;AM5( Š(((o ;WO.G*W׈vj~$Ӭe%@Py`.4X촋)fr~rBOJ!䑂ǠXvcyɉcA2WV>b+9J̇%Xe =;Wu~Nm1"fd4/\5 8P0F~(/«:kW%q{c?;8k^#X\ A9© w)YSԣ]z AolcFX?<=D;\UxFJ5f0uIĐ]&UՎ XP0;֬ͧ[Fk}Nm+MyJe {fiʌrֺ\Y1K>VQpQzuDžėS2 B5 iŦivddb2x.})HͦiEȈÏz=XǠ|MPOk}j)߅yϱ{fWq7m&MNp[-gT@^")Q8ltoYm/u+Ma`pit–gZ ( ( >#pi Vk<̣@ΐ@|ӃEu<6>zZh?2#A<)#E"ȇ hlݜS\cO\os5$וVhaEV`sڑ6r*, ,>^mX4xGӿSJr1Di0bHO } #S3$`OΙ*"1(V'z h:B8‘U-$xG@S%ִ *֪;jz[RbE%?ª` k_R !a'#YsYǘ!8n6 #[@knbǩW7ܭ !КSq̨犖3,܎d?TBB X[zɼƒܿ,~#^ 4rXӧT/( !?(6gq-# ׯ{-D|U)Idc8R.5[7RH?r Tg6dY-)83 v'Jѳ1HܭShζҳ)ݖq?лW,6{>XvFj\28\@xz+, M^u\8㟭>RYq!&2ʡ}*+#]2Z]4"0J=qV.$t&")"|fhG1tHRGAEp\,8)=Vr0?\!+ "Ve;hUnb<;U-C,Ÿ_Tly1&Tz8-v5XK/~IqSM;X;7F$12 ]('׵]Ch(ԮIV $ؓ$溍n?/MHG˺u26gne7:JT(c( ( ( ( ( ( 2Xx7-~gβ'^!^mSފh\}AcAkkq#o+6^5Ρ ܂'RioF[J\uox#`G`0ZM $ОmT!^mĪ2|=#ISJc w `d,UA]X`3c sA> 5|6RChKK+vQ+ k6Z&g=o#QbT'_c\ΟabB4j8%p$`AQKK~ p=~]x[M@#xurK#nwcOa| i/k#.e&xRuE,p(9]eI!^&.X>HZ/>&?Ω|LHfFP4wîP2 !\ՏA־._#k/ȧ ^1Qֽzo}/C ?=5qw⽓#it$;P>Ƿ9?μ_{F9E~R-xj[~ Q'=<5x{_τWlz^)AU6QEQ@Q@Q@‹%?fjּ_ڃj-B} փ-QAe:B}BO#_7[m"m4J9 U_Uw]cš./l"g *FtԦ'-WK"LBq*9:w,ѧ,0z2هc^I⯆,/y׶F=Oʸ+X/hdǣ%RPv<%]ڍD Ѩv{SyQV;xT`i#Vs{A7b]1|9+c*7V*ؙM5݃j{zc5s$e>e>e8(=1׍kZ{Fh@c=뼹馕IdnMiZH5S*Ĭq"`][ 5ǛqdQB>! _ v1b0?}k/yjHʬzJ%=Ʌ+HKFM3\Ȩ2,G}]j7kY۰V΍+ED$z |?DΣ64u%7hK#&t8}YU6RH=kt=*`|f's'?_Ƶ4 \{5&RpxGůxvty4NlOs7eiqjυ4շώJW1]Z%|7k2j="KcږI5crlg=*i~&cPRc*:_)cҏk+;dV1o/n$ dwx/i䰺|54͌š$(IV·%uhK]ۂrp;w&Ӵ+'tMo6vS=aܤ71.XO-/s]H-Gd䎕 7ݾZBeDv#rkӴYR2XrJrGqo6 7zGNJqz&:zHh ( ( (9xfr1TOR>k+ym.e6Mt=A}ZEy?_bQ^C +SGQFhѺ2;տIGz5pU'O_ְRvRAZFF;QErMkz>SH犭 ܻ6Mp<vK{fɳs知pҟ&Xl=3NWZ `V/=%f 'X{~ T:HVD@WzQZ 9ۜ0gY  >|, ZY:+Y#^ _4 +ϼKYiZ͖uXplA<A_)S9` ?CcY-FT2!YuJL 3'h5rS,5mh{½g[m9ɕ;(߫WkcWf_kks-DZ*Y #gnz qgGjboS[^2wdנ7(Y݂S8{?ҳ|5,$so[ǤDdYڬUq cPJW;j> }Um|EKuT,(<S*uui+ e"Aޯ$Z+&Ii#nRBV>ji>2dExjW<G֋cV* e צ]OMm\7ęl|c5Ս1M1x$ی Aiw>!XJ;HR;z+Y$xj׺ݍ5&>f&\ij7#WE~UwL~ w]V=B*V&:ܾ!5)aBY{Ot/[zl}+sI4U.FV6Ip~ZrKG4a`Y(~^~h9ҾI$4rƼdg={ס|Buomho+ ]((((_-Y{BG5탭|7ӛ8Y}(;h?tZ(cƍp䴚Hf/1d!~d _{ײ^Z{e=捣lz^χwV/yK4?J j'xݦj՚X\P}~xR:j)b,5-$v034d_5&mu}O_2t#9:dg$B z_/5 ZM`kW ^G %Č#,L /{uh iz¹\ٍ)'+Ɂ1 hڕk>V[,vxjy2Bӹ|⼞++e%z>x7N~ (0>xKKXԆ%7:ugUY=AVeDC+٧cGS^MZ-Z.Oj޳\jl򒱩"8/^B[FcѳxyE cZ0Һ ByIK319'q/VY_1Z徃פZio GQ)PrtJ]̟ T\ chԇEz!^kⓟ>pO]ET"L75/ X4x |#@xtU,K}f1Fr8huOzux5V' Oq#Wcج?ʻ+Ykz^#%>NvHʎ=k}Ūx}.xbxX 1ކ}&}gEw[| ݇O, 5m+ueO$'!E`Bm3Eiiq7 !myUWRxN 6HCr!$ $ ֫xz՝utκ"91īێ2ݮ2j`$|?)1ȣv(5BT(ջI۟&h,0[=v 4pC?&Ft-2J0`#ٰ<^˚,i٭QIj3LZ)3FjZ)7QLQs#G"+ 2({)<34/KX ;?Nq5Wzi$AAG|o xgV{;&6$/iڃ>W̶1 ڮ[)=+8FdpH`r<4}Q5 `؝?JϚ#4袊@xM"G!Fvc]]2Xx):0Sޮ%tT%y)hlձDwyD'py5^K}6Fͻ>_C?Q%ܑjQ* cJ2][;=s-dc$Z;Q  cdZ %h hٹ݃q*jq;z~u^׳#: Fn(r=*ƘpO?6f>Y6~@N>47#@`2XX+n\Q؂n$C_SCl;\2mUv(l;*w%?;w0O)@:?ϵbESv튿LcX,x8'Yq"@3&!8[S +<*8ꤍdji(Cvn r? jо% n\J"F/5 {dT-d2A^?T|H#PF[Y  bfE9Ա:?v"GUDXl͐x_l^-.x u$c5-Ħk˹ {H%)eUe 0'&PኩBX_ZEm *{PJss"ؘ/bԤܒGx'e +rHdʻM{Դđk*K{MQ ,*yXq9-Lǭ ZVL3o8Nל~52Ci"Z4scEҎ3z(,6((((((r#Hbp&XCaJ3{%d(粌ԓ]ڦԎ(bNsEM “ HRIgǟ Ǟu{ JtqE,ǠH`+RCo5' 3N4FQ̯aRAo56 3M&{32įACk`*`c▟2\Q%ŕ͠9QRI*RF2(&<-~8:{7TM d? Kew fB=ƭ4H8  k!ⱻm#8 HMh6ae{\Dt`zTcD p_ Hyq!w=]*{;\y`$u)=((((KKnb8!"ѵ8&P9=Gr? rgWϛltЕcht*9bIbxEte* CRQ@B;5?`'h?#ǤOg_[V@gƼMMmZSr߹ceZ ^ (brVN=8Q7c;f]0'4P\/sqF$QU@O6#KI?QL:Gs+ŷڼ& &TV8 ٘kFv hhH2{ `"AE +ռ;@q#>𨦽W'T`%j"* TP) ZC\u4]NyFLĿgH0y9>xzX)KT`0Fx'Lȩ~] Վ-Z :qޫɬ&.ڥʽ;AX"W̘Ӂ{_&x!mx/#2nی⳯mm (P!׽$SctI][O!#HwW$Rpa̎ԕ88l֖$041R[أ\ h'Gt(]!9-7PBVM[_dm=lqeLԀ3Z~"OCׇJuWtS :2*ht(|I/JJnGVi=Ϙ5úWѕ  ه+_^xRNb>g{Wzm{Iv@;MldTZ\$:3j*)4'yj1jЀ|W+ϭ.岸Y?0B= v~1My;\+.QAKKBw]?5u{@|ڷWmN̞K}+B0G傎|P}z'D60(b3»:3۲$Ǧ_EPF+s1q(i|rw1OR-6p:ޢڑ4R=>b@TqY&Pm^}0kVi#m82³0Βr2 w<TR.pZXDkYpJȇzFX=*+<1T;nsʨ~SkP4tI?3Yqᵢ9Km10?$9*vKQ4Z.D(v~yI"|B>qNcW/Շj*^&Tܐ8kR%HեBc0I##@Ki 4n+ Ǩ$܌r099!4VVЃg-ianߥT8^x'PH PBz#ap>@ Ht'$Jemێs?*US'_z-j>Q`ġpoΤENpU>K U'ǒs1KsHY\!t?eMwqiD +q?5WI'y06u_!Ru٪-gAWpTD]j| aflҗ1YEoҥu_F3O?x?i@O ־Y`}摑 mWB[<\zgX- 0dՋEvQsp6{OjpMsh]3lV NGٖy"t?ͩ?LRs)Bܐk[>SqAcVвH(@(((*Ņmm {d^/+_BɀE߸?޷+ ڠ;l,.Cƾu-{NKÕ$nCñQIytP:QAz='4ka Ɉ+QMSK0VITV"pFw^u|Ḅ ~W[Zgn&ȣUA\OP\k$yArqagVDUOص1x}]idðZxe Ŗ7Cxe#;1K5O JPxACx ]־/KqW)-#PXkYc+\m=5Oo˺7Xg :)X+K * +֔a@G6,PƱQ*ZҍMXtQE3׵OCF l 9*_ v `P79oֹs )EP u?\f5njbXcaw`nۣ (k:v>ma-I98qEׄ<]wwHMW' 1^L *?+813[c:~OR'dib4sm`6|h7:-p!r?,-KӼG lq$Uœ~W`P ,_;WiDܠF!ƟuBOWû?z V+Yǧqc5ryf(4 ( ( t;-{N-?B8e>5F(WVgΞ-UL؊G1_V\[uo$Ē #1a-ɨhj[]{urԣmbyMms-4-?Z 0 MYƙè 0:Q+B9)HثaWWkrDXI{7@kXQ\V f`'Fʹ9W`Rʬ1WkYږ*9]k7V֌;xA 9i}<k1GǢUpЩhL RzWyFNkSIbkI#kHJQf̗2L.=^lBKeszpMS=i`\Jarѿ^̎7(|l CsS%qPxɬw|󹙘*/Zt3p:JγI%: o=H-bC֨(ĨeW{D͕'L2\~Ywœ|=hjә/n39? ~tذ 2Fϙ?py5m&i *ع ULsza_$d q¬c9 Ayʼl9!W=2T~њ#GbOXEke#sya@+#*V,F!8}jS;D`U P@Xp4ZUka,zխˡud{G`jV懚2cA_dg+oQqXc U9j6E1*9ߏƴIKQiRUi#S9B3y#+H\zLΫ ct(]׆4Kn *AʜPگqቴ=7KfTicU(zԞ[*-:LK~U;lck>/<%+Ha*wSv&[E#Q2qӥW ?i|ҕSUe^k?,{A15.?NA#JҊ(I>M(<(((((zÒ>QjcjwEpcmd\^e#(ğOj d ,l2mN0kӕxVчJU_7Hf\UB;x%o';AZ66[[ʫ2g=J2-5un[IIX?S!m lZR #Q b.X6R??pi-Ok_4):=6[M[)"2*tZcio*J6ܚRZdk7)NJȟRd.z5.|tһ8xa;k4iciDم8GGa(}+ ޕڛv I|>ktF;xdʟQIy6--Y |qD/`-k#%SN?'Ux57ⴾW#8h }2K h dN:FVQP.nb{-C@4VIݹ9幵`Mҟe%uk$l`vG{9"wZpTB?G!{US~۳\V:TfIGTi8>e fZd, gEUMF51m۳P&rFd|ʧ}E>G7]]L~pXk˩Ze-𬚸'QEQ@Q@Q@Q@jh> 样v$23dV] 6>-'a`/p3>c/_j|:u=wC PFb$z+u~>ONn/ƞtŨ=6[~MA^ޤ#5Lkct-e R#((]sKE Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@&)h3tQ(ׯּ[]ީ˯#P*ܕyG־5դos sB  F2>T_Ŀs(k3-^a{aw]=弐̇]qE$(haHG]UWQ apGn5s `r?_sUék= EG)w+h@  8JRO"⹛W%]Q#ʢ˹OUN iqӡZ1mn4F(!o]og/w \Xp00G5/nr|:~5NJQEՒ)pHX@>d Ws ?U߲vR0^:f0;-g֗зoK0UnONf&Dd{VߐЬdY2Lk<D@{/{0V̻,. 835-۬ڼ1zf#XI"PX'VI9Oj"A-h~nZ ۏ>clIŽqV^B,Ua'v=2N( l{9*(Vݐ }x ʣ=B?n\0`܂zsS"on h.D?VIAb@PVgVcgJW>"me[P:E8Q}Ndwևa1N9'z/c&ʹ2P?Uw5տ9%۴v*2֘-΃2M23ن\~5xB* W(s#+?cdp v6 Oh u%+7Ơ“tϳQ|6d}xlk3֯ZY?RRٛb`~q^XG]HN9 _)kc#3S\~]+ g$9jև hyL#K*ڟZEmQAQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@&-gNS-lb%X2q_PXae (PF>i{ϫLK5 w?{ee7 (p(((((((((((((((((P4{ bѭc6rG=Ҵ(V<{^A:;͡ܫ[p@לer*azel\BREAEꏖj厧ubE!1F^|".gn|ןkCiG;:ʓ9NQ-Y脓0O֨9=8 m 8#*宩yg3[~<'Xwx]G@I.-doQZ .bdnd~]kn.t2JLNPw̬3Nθcik"3:+WrEwD.PkAgX2Fr#t:]Kr; ` Ip˟>?VM3n FuvB)ѣ9A߭FIqr"c 䚲6Zn?u{{yd<>Lŷ9$5\n:ҧd dQ:Tv|W85<`s"bDw/ `6G#֭/2$rH#UL7qt=0YCӥ C5;YbE A?zt J9 J8‡ g5OqATyHQ܍u03;~բ[iF|1Z'᭧7ۆ'=97:?V&F7 "^?Lj:oumGG{Xa MOE_6$kI!t2\{VY ˨2ͷY.;\D\OQ=ΟS Xl܏=3 QM⫭rTH kZVHQH`&y ;dNXO'|=IL 'ED DPܐg%+[( +IH(LOh6EP (QE(,QE`( Q@X(EP (QE(,QE`( Q@X(EP (QE(,QE`( Q@X(@ }hII?BOnj]? ߢF: (QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE`zQEcj,ZckCW9ߥKj眣S<En[NB4kq5~Vdx4QCspzPxYTqbOm.h䉺d|EaRhj  }k@kMk]=!%¹{gWg*nzm$7~\kn MaL#m@9=HQ]m7`b65$@p(mHJݖV=T6;Ed90ٙIdpY9'(- ꟗ8ˌV^sE)qDits .S%=KJx5h3y3vLEJՌJ%cH(ISY BgpGQTTJtVG<ץI${ard(QEjd endstream endobj 13 0 obj <> endobj 14 0 obj <> endobj 15 0 obj <> endobj 16 0 obj <> endobj 17 0 obj <>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.2 841.92] /Contents 18 0 R/Group<>/Tabs/S/StructParents 1>> endobj 18 0 obj <> stream x}M%Ǒݞxo]AEQ{E${b74 /7lBBxs"2{٦D@YYY'>7ϿxG?z7O~z<'oz~ӏN?,B8oN[pv9 NxN}1&qױ_~tz|e?yͫ5vr?3C}_n6n7}n~y͇o>헥w BOt:_v1ZqGß;%A~܆bh]vx̯,AR߫|\rLIrp㏶Xҏ/}ǒyOok]t.k|QvWz|HgvG[gdOFW9֛=ېZ觺LZEB]QoOncݔ)GWs]Z>=!?rO4NtdI&knG񇬖1?CR=aSúsoK9j1Nk(}ǿxg}z?}ufN&⧧`atxDFu&v%R?7מa{;>l7Wz:aþ~3Gf]J^b,0n+B>{2Vp_^2b[ϗ^owݟdwajpcėc%jB^שK ҹ5~J e [kvYnA}f\0)^tY?8E^> uo_ߡ})oϧws"sBUlwM9#^<9";YOOnͱB̹=Baڨx66_pn8s!_ϧ?d7I,@oCx98͓\鉪ף宽0#']ᔀE_Oxs܋YW~/5 r[=nL/bͷNlkQµ1};r!v?Yh~Ez ۾びoǧt%v}ۙGeoyA_kʰWʹ2xxy𱜣'\ m~rk& &sD~?Ǣb-Mb+v)Lo=aʵ`=~(7d"sZpL5ݨbÞi,yn&Fm8~FB|%>7CLjX}O*Z~zcgÏy+5I]0kvJˡC#> Y'aE3)e2:Ne$]NJd';S>.r(=ϋ2z^_9ˈI]qo By6nkbOxlf;09q՜v$ n逿pPpX׌cp6Xq8OUƝQrI!9,X ,zxvc-\p_.%tDC=ό~ =\[CF? a|DzY5+5!5k}5~fNǮbq'CN08 ]R\3.akJW<믇2!yl"M+be6(~X~vWRw]}Bv&g檮ɐ7oY[_#"dʳ)XvaQ]}?(L=kgx%Lzv]Pzc]}nЦ1Nڮɛ^ v֜,!ſ,p/krJOc<kol\mGPW uQP~| FgxU? pUGJѣa93(Kwk6~bc篮G?Ga/>@?/qh"!ǫ%I;wd];6!r8NCf9z.iocl?r|-ܗ̨\Kmjކdϯ߆Szsz|޲*\ @6(Rr_=Q$\s^o5#?̫sf>EĐ.8dr)D<$3 ƒ8ә"g8uk2:< |k¨:!uH|:|8[y7zh iglںԷ^F4d}W; Woq= #|8?r-G5܇,q]F~s\!uqqK i}>!qXZO{9 2K>q{YͥT]G|kxӮ7AwN(tnx&0hi\MF I'-Q#)|7I=4.]Xtwg2ϧq4疴z}G}҃ y}z\^ESK6ʚӦ@vMNt'sH=Y#ݤɺyh$I9'/e wacHUJIMz7Н (Qn8 0k #3Gns0H5ӦLF)>k-a*fr9/k se&nry&nyt-}(](6͆9r&V(j(ns0HgaPK:Jްl s0L7eҗ"N z!Xnlm6͆9ݲ@?rVӤ ( l .0L7|1a :|f"rr1Bu 5P)Čыi(抟IMal wa1 \+b5l qHgω6=Ǹ_ T-p7Q.WC.w^MÅj*PIiATIoXLÅtu?mC؆{j6hbWk_؅cl\Z+8{k 0⫡-(r@nЋa8\ѫYBL(-p7Vp߅10ZhXCq ۯD(WEﱻ.z\L0=ڃ vqV6?ذu,=9/.Ckq0/.Wz0cx:;`#=E!23,Gya/{Ěvoix K9? |継̸e, 1*5 Ec&3w<ŎyL"gJc0s%8EWκ vv|9򺫝x^njds>2]@إOG}/h? :snOiZ)e+G5CHB6=9nW܈rw~L< i"qH_(|Ee1?ԦMVS!\-CêJhre~eEe]/?Seh^q{eoIyl-wkpw9\3>LvPL:{vN?dOJt TE׺S zCe-TJ}cc28j4U@;}i\eo@>hYBUi צTKaB~.)F| N ;wQ ܹx7Iv10B$NJV`ފ\۰Aލ-|y71>'|n6pazvU eRcd7(QT!!L*i) T~Uy?]oTڂwM\l> lQ$ve}9oX{V=l)4XDW7UxN0GھyA(U}yf6/\2Q%SeDݪ2]tP(EAdsެ~7!JEy:~1" _=ElbR Sv=P$X= ZS1ېa4!mt.. 9l!5C)-4 u@?Tu_3o;'?vNeȡ>P Rߔ-5Hљ|ĸD$ b .=H6k4vV@QH6CakLmQm/ب9ؑnX1IL;ۙ s 9L:CؐM U8mxPXR5k+̲'qCH U*Z!rMuFY\(6Gg4'n 2ȠT$.k|S%oM6m)E}] YV/)*t< P ׆†"B Ag46Tε*w#C8"/ޣ,I "9Fh݄Py_9L?/|HF^A2*FgEntpKr7S4A|whnD8ll) ]%𑐊1 f4*" M%P*G ko*vUqA}0b:|ʟ18F`*&6+wT)ΚnqZF7dNQ]J.6!>PQ1w UqоQqGXxWj0Rg 7ZРLdHtA6^BF (1q֑QpO^j=R6Ȱ !xeɞKphT#`7]eidP6 !|͉VUʹ dLPI6,ڋV nHCM:V)Y .;Y.qWcUH~$+p4h(>) l 2W48c6h5/ m~(U*f51ʩQRR>(Iμ_Ih\|JM2g{($ue(!l+MRK0T ʘby Ctn±7!2[fƪ8t [3NAj”%S lwVX ,1XBq4TP vTfCv:s΅SfZUi\6u2 ffJ=)sZmPWEgNF7v4#5>cnhQ&Z}#]EأH˰Bz!)ĔjmhW)L`jNle"!򎸞UOA5o. @ b։|" 5G r?asq AaV\-Qo%&ѵ#A"<|<% T;o@oh1oͰZ}vJļF$iC$71os0L#kwn5Ǎ+LyH0wDRH V#zZ@ .HAoֆ<@zDy &j}`ʊy+qmzˀ\H]Xiƙ.D&]8lewC|Bs&U2tޅ@Qbp@ [zkl0Qo0%-OqDY쨷R̾.<w z9-7.p[4A)=rZ@~w4A&O:Y9wZNOHKHր)u |m ՛,ֱ`yXp a{:-w i7|[>hEF'ǽz{\a'}9b7qpR(.ˀyg8E(!dF"!P `Ks0d9ۀgw#Ԟ{W{}Cǽk$wĉ{w*ajw]ޕ_p*g=@$w̆-,oe E~p!i|E .rb0⬬6&]fľ{C1rط^]-< aZp~'Wd߅g ~Q0[-H}\Kp#] bоerL6WC_e)m̐L؛چթœ[ ܘ8RȦP|_LQz,9e@7@&g5ҽFPR'G uҁ6:ThúE͗o Jn&0!#Qy6;$0G jF ZACU0jb n)zH`TC}`&0*3M3Q4ԯ $c ]횿tٸ;5fmbQ]w#g11 e/P͙h,qًVhHo4UjAX ȸQXAZ )j^oiXMдm^۸SI1W9~`Pp¨^kNgqi^ed=PS}K(uwT쨩|c,f*8l5mPQf%@M[Jmp&D^XUpXi¦M,4P6Uλ6mD6fc;ulmwi ش1Nش^P^;gncgi[;UicHشU/!3q& 6qSNTCJFĀ&#e|'bp@9m#iy1 9Uꀜ9mV]䴱Bz"-;ifj0 ȩ㉜pFni>2@cO{Cic>S0 jCrP*TJN/b̄b_vGYn,˺Q r1VnZ{[*`w6L([vfT6Y)6ztB ؐݪe^f%I-bgb?.M|I€Gn@xZ" sVGol+ h G6(asԜQJkaq0`(V(;.0p1K #TIrd6$aM3 yԏʃ ȑ`ErJer G#6ށ4 G]ȑ`/8Zrrtirty9΀XLertl?@ GC|br G& MeZjkѧyrtVE3I  \H8)Ҵ/,X 9`2 ʆm2UKYSfկeR_N0Skŭml*0rVlj *7 ty 3!^o*(Ό!︜5bXWThQvmuUYe!OWr8,CwcVg2Q˜,c>rƵy#@HVUIc&^G)$aě Ab2rчe &SG]"|bi\y2yXqYL*'l 0KH>[`uod SnʼpbaI9/Qʽ 2^8AzlȴcƘ[lb&rԠV658b`4>x#ﺙ]-+f@9胉ߘW#Mscp RNYpioh0n${goVD9nED'LL#i y+QCARFT0 eX *MH<ʠfnU?+GOti”pfii+ A0;:b(Ё+{ 1peb"d[ĕ=. <UFYpiF\n#TD& & 2$l ,{4JdY,{0:emHXF| E}ȧ `eH +lᨲ-:Z0PemUVʪ.a}rfk*G UGT951T94}ZaB"U@)QeB,1TY6/_E$gX!*~PPGId&dA&T,mWixƶտn~TJ s+v֗rh|'w2NUG5@0emb9!a!2 A,ҐB40#B/`^pVQeYez(& ,CP!%Z07`#̧sĥLVJ/$%sTœLؓe;tTI@4tSV `l-r/H4uBmWXM#T _^G)1K|uظ Xr.5wS}c&h \,W\".=SVPm+VuhYm(d}M-w:J[JXIw`o5a5͐l+2!xd_@p,>{e=SOqeCj}ά/Ø'Zȁm7 u5XnToJSXNSGu3(qy֐qtSnQSA*9aa/Fjc%F>ϴQ̬0hzk##pxӋ+4}nTd[pYT64*NH?qcȪ/ JwYX90~nVWj^זO-=5ni.aLsu#%<\\bވi.I\HsI*KKs 4FOsf(4$Ls^4?y.HfK4\=%ϥsI!ſ{YWV.ud8\*#2%G+n4sE3zsE3X#7/텻0{<ԕ״,%+##3e+eO S!%V$nYI.tjLrIdK'-"!#7_I.inљ9zqIqqiJfMq _ l~c_S\旙ubvS\ ^3!d1>nk-<7ȊK5?sDeDs,6JvgU()h)$ɂ"|jbd,ž!1g"lbO>(̰ ɓt%agؙ٧4{f cp#6SfE&#;63mN5*IߧXUZ!nLviS!ط5' ~=XDa-gPToHVp*Ul"jx5l1st>hY=EV:Y'MeۚOR۾F*WYR;cgܘ  o~b߀I6E[(VVM2¼Q 0?cyh&y#jbrQ,.8ꓬ3qY9GXHGLGqw s̄H߆C(Q|fb_PGܷ$nNe!?9w%ߺަ%Q @bi|6z 1%ʥms,{ zbsD\r=GDq-ȺXy=EW~pfX9t:Hy[#%E٧Ly'V{yL5-#K>`6ja٧XӃe[j]L[bxe8&>Ʈ0f??n*]7XKi0{}H uQe3ntPF~/@8'6ҳV *o,r'z">F #cKuLYSLX8aݨ g%Q<&7:Ft&T@fO128}lh@ƍ}!fq JiO, qSSI;zBh-az gFVջd_h.~D~Co(8U1¡,^Gͅwˍ2w`9;'ΖS18=a}>WK/@?ooR MB*ay/촓BG\K}&2 ,r=s`O^TsJR8Zr Q.cY.̌s5n $.-&0u}77<@7Vv3S:{KG o1rLz|?%Fz8:z} #V%*to8tLjRA2GE=,]g{͞3c4{ CO c:vtQu:N@bb` ZWߐ].hzh".Ύpt\<k7r$fȃCyq/YYq#n %as>p]!8ZχQvÖiGA]ѸT^DVuo"Ϥ|.0w8gU4aR5ā|ãlj~koZKZAAM&rr<'97PWfK7ď}쫨Yٚ~pgS+gާy1࿡N7Qd% 䙨uy&y@%?PHʅCutfz\ܵd2<"yfWr2 RCWZhO3g"q<*e]q<5]Q  )w8k? 㙨yxf e$((@sr !L||̉9]/˭xWτaYz>x{>7? ܣ`2#'dHT?@Fz>)qw+mS9@D51b +7)&[5s]n3O/:p#m %BUlPnhb=nf3k8Jnf+e]톩ړl&11n ȏ ,.|[bȞ@Y,RƒpvoV?%ΐm8e9-ݳ8ayIzM]õӌ_P&w7ȍxwyOW VHR 7N >r*/1 AzA8V{î{Wjo<ŏgIm:[Lq P႐lᙯ{^S=Hq4{E}#WH3\g)uR{_*}Iq@wP05EѰdeK&wF*ήгUā~'?'Α4T?'~ž^EAG'%g35gJf_vy_vR57cb'NUD̩l}؉aه(`'X* A;AsS ^q`X(ע`aܖR=u)7Vpׁ%ҿfB-i00|a0~DGU8?َbm=x8=-zjjs+b3Q" 0+ .pڌi;؀D 1wgq@K|T@93A.lG@<ZYjG|$M:ЉcPQ~䟌f>dI(TS=wN o?\Bٔ?/8d?>ƏD\3t A#g:1ɉu*BɀR~j* ty-cԜ9cJ\Zsˋ$=G2 bz.Mo<5)R=|Wg(*|iLH#7IMxD9VHh.(Z]49"%(g#ʶ#ʖ#|sD]e8坊#ʩj∢58sjٚo&Etd0s_b_rO[5^ِh(~5.?tV 'w[bE-~J4D'P=C kmgd!UP,!c,C7QD7E$b$ě 2%C)(7 {DL)9VQn Eˮ-I5~;_Q"E9+~(hܞ2 '~CFXuW-ȡO[ax^r(7 CPٛ$r(:-^F9VP{C9 Ec7]vx2"nZ+=nIM:PPv7dPV7+7dQGqC9 QxCyl=dWP!@?q`;:U,j fRiXH6$D2ྼ@Uu[#T 桮wF q@=O3:Zz}]we_;RRhyO1ѡbLDC-kg?CdM]:*'>_+\z&FDVV^~G LR,ژ:>棊0YQqIAioaֿq9)݊ lC60aErxtGDkoqcɎ n֦b^rZ򚦅| ѥpoP14%U^{oޙZ]gY_h].S[ P{;j(J?`\?B 1DM[ _ގb?biGz2Mڴ|XC3.P;+PwTtS%(N9흩}(@{g@;h['"hS^yA; ڃv b@{7^$hJ@{e;>N{UnE'jCd,Rk4l~e{;^>{ MwD{7^ HhG_=q0;aO'vޣ*EwR]x*iKy i>;B@{gE9wxKU{/ϋCѕs1.}EgETm uéG~tuXIƯ2ԷldqճUj2+B7zvtϼo?E2ܭԥf?Tv^6U; wsIGlQ;DӆXr6Q p w w* p 5 ;?x eJ߀n/ r\'.=}Fg QBwp-( IKTl):[09H8-k@V%R<_io')h=Z]Eff"=s%8"=R\M\ꯋy fQ=j'@"3]z'q̅e"lrՑО-%Zf=c2^ˍ7ڳ;ZrJu>h϶bz=/G5Y=`(渶fQck RIx/{PS?MB=Gc쥶XW%HVXX}kߢ.O`9GBB1F7.}h  `Bz V~H5uTtC$=៛ﵕ I0)L86u`{t=dݱ{6̢u}.]RXDcu) 01JpoX=Χ@؅{ixoz-tđp_hspXa.t;l;*<$9-P> n_訉[-#cx6:.q%HJ!T>U;k(F*U1Bna|TP4b'Ѷy%[4B.)U#&ߝׂEuy\ 3 f۹ERgm,KB_Gߍ8 0}ui3SGiAȇ/U~di#*j%1o+h{?Ro٠t^g}5>8#q ,8ԧ,ړW1:: Fǡrg<,IFǓCOJ=1:>~g!׋Yz1:Z2:>1& OսD|Hx"u|YE MYo"t\?5oNNj Ri:gILx{HLAEV_*UHXLfڃӉS̮ѳq/3G&^t& Q('GNǷp:ʳx h'|9P|D7R@Gi+d:zp:/3᭸q![#OF#g|8_ qDBk{"98_Җ|gdPUq:sJU}ӡ}KNFt&{ 9әȧ/Nft& wNn%3{͑әP$3sC3('4DO>jjwُ>#ʵt* J/ؤ;2=bu@@X*Ui'xN9/FGk:|_7!.UI.͹T[-)m*J Qm-hq$U|⅒_Hn*76$ފU8&gf'u𑕁ݱU鸅.Ԗ< T7~jH@P}q9n3U~H9a nܐݚC*Uqs$p:c\H3:M9 QQSߣk8 m^ouD?!FXX[w,lxus4bDo[PXf s2oYsJsd5\__gu;I (wIx)PCʭָB6Y pr PGO-u`^Nn5fDO--jzv!zܢF@qrQN_NnArr]Nn!Yx(YkK>IߗAY4ruȾCԛj2['nF^kYS.'BT1n\( jh[/ԜH_KzF/-* +VI;9U㿱;0_,j[Pv++-]` /-XQ` V@Wt(j.X@h0!f)`vϳq.XCIM1R\%d\&'qȋ9 VWfJ+<`K&$驰xT~+K&tz ca]par47]{Xdsu)`B>}[!؊]>4v=pv]b.X][Pk/[F`!,dE-XLhE,.P?%]|] `J`"!r!yG$5h˯ `_XXO.an~KL?'[/ 7Z0A>? )=Dz=jQ u/\K=!Õz!eI1xys\9rc \Q+'^(r> v&^Gy W?oOբ#7 -ʿݳȱx(ב M/nPeG ʾ]eIPtCrYfN1Jwe\BVxr3蘊`05`&؟!15 V?:˕f82*){k.id㟒G3]ˈ솩G0C ,ɴ x^ @:tx7#Žo[3H`̚Rgz E~JDgQɫ8$˟}[5|ͤ}7s PB徭lH^B(@P3.$1 1[OSuIJʤ_*jZCVy.Pϱ 8*1R W)('%nX "h/Pa]/ϧ|'$W/^$^p@0bhTjưHR>xQXZr琐{ÛIOL B8K꽨0)V}TӇk/Bf4D7S#w2K^ ˝/tq!N{B;9%LNNWYfQv~/˳*tk;9]'+$ON+vۇ<9.4DDLK#6ºZuɦIN$_ɦ.sp'{W Zc]d/<,ɹȉ5+_x\p-.zN\(2|Nc-V܉6-ÝF;9wr D'TӰK yBw'\_z'A$ON Uo邂 X .܊=9C 6u)o0F əscSɞ*%{rRx䰚$WU?Jg@9/rW- ?[,:T^f\k-|à+lɆ:/aPh>U0jA9 8rK;g0(g{rPp'gw˟@''}B X5ץO!l0'g`Ox'gK<>')zIf>{'g)A 铳fO)O(N׾<'03NpB {P њӲ#$W6yq!KI*A8Oǁ7cR?H) g8SB2p|?NE$,qN-13߁'IoF)&"1S!M0S)Xn;#7nx= >';'2Vhbq EA{ Ycw>?Q9K Ua M`V5y,iKdc L:Kpw0G0 *H]b߆\hk_'r`=LkԜŏbƢA$+Ky |OU#!]v?(]+.pHa9e?0K)8|>7k1g$i|V#($ʙrg)4CLY#F+xK.oE~.< "V#Lqh+M|"M|TE Ԁ\D,ۓy&m}t}aD닖O1 ,on !o-l\V$nuӕ;+ld;X-F7CR5 #g@_o/xoz4hmFj) 2(^}^g^.ǚaD5j߰|ϧv|ގǟz_%ިf9za7w{rg.mH<Y>TΤ؛}1cdLI6qk5jKkf/Ǻ+?i0Ըo Vï9EN7纓4a's٧SOwO ]4C_fȩwuq?jǗ7 (;݂"+~߾ 2^׹^ü{j@x)o62.#mw^X-'|l:#;b<]ӲQ}m5a|g`M6ߟ3ҩ endstream endobj 19 0 obj <> endobj 20 0 obj [ 21 0 R] endobj 21 0 obj <> endobj 22 0 obj <> endobj 23 0 obj <> endobj 24 0 obj <> endobj 25 0 obj <> endobj 26 0 obj <> endobj 27 0 obj <> endobj 28 0 obj <>/ExtGState<>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.2 841.92] /Contents 29 0 R/Group<>/Tabs/S/StructParents 2>> endobj 29 0 obj <> stream x[n ;qfa0 H8b{J@e$[C#؃O{JUM?#i9 95U_U4{*yjZlywlu}:sLrw' Ds X.r;:,W|L쏻; se"WڷydxZ-o9->%hF?#rJwلpی}&Y!82˄IVjzIZd6{IL*𐐣/' r˿P7#C fCwV$ZV]cclNk^6^Uv}fҫlbX+czĥLbUɄ!K?"ι\:21Ɇ\<Wjt?=.1$0J*x?:ͤ+Z1WQd8LNDY-I~4EIʑIMg2rM *pM9Xضa?W0t(>H9:"s|w/$;J輐 O .q{L LOҎ޽IX T DAշhOd/>,hqPA􎚴5KN-}Dk@e~xx :=JtGya{[*ŀ]7 {EGb?GzS=S9<2 %0Sh<[.)Øp=\0 @'ּ F~a"q&Tzc1`bh$!۳5vrh>݇e<=BbC"eP !xjΑ,}ʴo/e7.siՐ$XIo0%Ծ%~ Pyu_`@ |V#nx ;2<̐zqפ<Ȕ I)MnD{Hy1l"xQʒB#zOZ=>RYe64!6zP>7&p?Fy$q`z % a-M k5|4ɍP0!)j6IQ W~1ĥE '.l t 6=!r|OTX1-=?P9X(*mW4ZRAUݡ4V %be"&&hWSlyc,|ęF-4 Z$Dp]M*BCvЖeUkr9o 1Ncu^km\7Iy]k !!D*t(97uu/$֝B.)LЃ LZ¸ `kB7]_ڴ|+O|z )5v]I])cڮ+ 뺾\t<#24{kB/OѤt8u%rUח_q<0aRUϙ++ \t}ՐR9$TysU+ z\tUWszPJB寞C Ҝf7-_OOI:|wdj0Kԩ5+TީcߊKjV׆_t(T,ᆬ۽`2}o%tPx`aH(.wg`#b}ZDdEՋzZq"z'XEH~oCd?m}rJ"V4n1wR` ]Xď0k8`=h;E8R_5fa{"n| Y S33'N(L0՗q¶'XF!߈"vbVGsݠEXX"q$o\Jca7b[kG+Md [f*qboHuѸtFln:1 zQanH+ڄG7:NATJ7@pk>۟8X=3݌TJ-(&1 bճͶ*5x [{bFggV "Qigf9R!BE,j"h%$'AG XELF`͆\Wq:4[{GAP7|^ETdtEn|@Q5<>zY:]X Ku 3) }?>RmU)W.k(> endobj 31 0 obj <>/Font<>/ExtGState<>>>/BBox[ 0 0 363.76 180.01] /Matrix[ 0.19793 0 0 0.39997 0 0] /Filter/FlateDecode/Length 1560>> stream xr5[0vRYY#͑@0IAILqp88GD\8RkG-J늝TGH3k:θz :aG&Mws\{\Ql)Ŭ>r~+xg pfbί'WgJv_^wRs&P4R:5E1Sc m01ubrɴ޳(@J+39et_l˷eo Z"gC:n#_;x?K 7'Jmh?d1 \kD 5 ,,O@%w`HL 4ڃqD(}y>gSMfnojS} |>hM¶Mߞ֬ю~ "fCGL 8ďfB0a)v Vj,@NZ&ZӚ;f~<"٘ƹi9]SnC79هXFBg3ZqM8#~CdAΠ;x7VSE h_e`|Q7 i#M͆Q VAO5_DM:> stream xD\Q#}{N t>5мZ7^;#dvlg'9)DzBN^48WA'zKNĭ+5WVQƴ+-hzt \39yY\nItȷVRVI9MoI endstream endobj 33 0 obj <> stream xc` )+eL&Dٴ_*{A5 endstream endobj 34 0 obj <> stream xdPƆK:;s5Xxڬ5_䴟WinV\>5nl^^윿w3\AB+UjꞖ<:%u]-DMC4/)'Ovb7ٲڐt d endstream endobj 35 0 obj <> stream xc`@Ia@, 90þ7!.$_! endstream endobj 36 0 obj <> endobj 37 0 obj <>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.2 841.92] /Contents 38 0 R/Group<>/Tabs/S/StructParents 10>> endobj 38 0 obj <> stream xZKoN~ P$e(bEbjP;gIi9`At |)]կZb]]]ϯgq|\ٓ'vz.λ?ܮWכ<}=;=ɞ,sVgdzL悵mvȮÃ,>;^4ܪdEdu!*< >um1V[EĩSj~Վ=wW 7E>Ϟ\̾e1{˜q.ٹ~-T^3qRK_沝(:i.+=I9H97r^%0/poGJ몊0<I(PI!ktvY7 s[VSSSKY:WԪZf&(Ԣe*|6/ eDr]0ma#&Vr!2g,犘1SP?6Ib*?zƬ66|l(qBFD͓SkG: 0FzlC60czVDI֭b,ñZVa+M7"6JPo*$\h(xayv_l` {Yʒ:x*VB >~ lcVl-rm$e*RCz W KȜeYi~ \ QjkYX( 8}f٪dUSNPL\<4ngS>WKuMDud`5HڨL3M-;!P,!ʈŦepq2ȉR\WSi"eY8y[sy7 ۼ WD J{j#zdJ6'z|f s"I@護һ`b"B @oKZ h~7 X'X2ˋ ;Zzk ^!̼N&^5YI-sʔl `:voF}>ZhW/`Y)Ɲ:8?as׷^;H;sUHj|'h!lLr".D}TDd9Z[ȁ|ja 7W/~󧐳6&LFFHN} ]IO(*Vx mq!%vijJrS D:2Mك( iĹ. R퐗d^0݃jaq\p}Gb_Ik†tph <9l>MV뒵p׶HmVݡQͬL~"򹊳$ 1V*̨U' em/4UyM;Z,9oX7\S~{p*CawX,ݓichKaUO4htnܞ6xSoA'Z'5 jdH KTθ*>`ɮV@"8Eհ'b4tV 7"LrDR/`n2>k1 o N;]/o@ +CЍD/o!&Qx KRW9uj/ELd|I:9L21: PkP\v)Zd>ih)Y-hzI5s]!:BC&jz ׽G.wԟ}vj 8=_،گ.BB\E>b1zlgq6ߗavD={L[Ɏ􀭳WһǭGw3J$Jҟp=LF69YfB*Ώ0' NA"]a;ъ*\ +4k.v^l&oCjobk85Yo!*eB:EjQ6UAINo!MaQ }L \^b5kCe"q/ۏ>އU\V{U\ b"a~Ln Ua#p endstream endobj 39 0 obj <>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.2 841.92] /Contents 40 0 R/Group<>/Tabs/S/StructParents 3>> endobj 40 0 obj <> stream xYKoG BlN?hI6@bk,FEq!ihi-rr0@N^!{Llќz|uusAd[ Q+8Ő9Mr`O3BQB"THy)2B]"K1<8 *V ϺQP<Wc4-Xu#3";K֦"h'IE -]AnC|k˒B9W VŠ\$>~[pxD&3͆"|4wآR(hKEI+t1%g1ncRu2Aq02YdHVrVr_v;YP.!,M_-rQU_YBUEBHA5pbAp2=c" >ћ=1Y?Dt9ɓl+~Ma@XxB:0R&3Efܕ$ڀ>WS=5Rjѵ,a`,лL}WZqT,a!5XV3IDTF1IW%D{6)^ OmЌr/Nʽܪb~I?R<^Qom~>Hhd? Br49Gͧk\y5j+`.z!6=N=/8.[[5ߕp߲h'N+y~qf{08f-nHamY9мLi;n:QfΤ&bە֠ᦣչ!Uh5pӕ6\(k >bM><٠# wQA,o & S]?=[wU'Kl$p8*q 4=d+fYNgr`Q 9޳6NjpT%U(dot/sUfRU'j |.c܊cБ>c1mhnG"uX9(u)=Kdd"'7j 3m;>\u,\9Cͩ=+vݭA9[iouÞ&܌?x.WӺas\?G⵹sA\CI`t>R- Ĵu^u`.cý:Zx{/oV a~U}F25v*)|_ df endstream endobj 41 0 obj <> stream JFIF``ZExifMM*JQQQC    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222 " }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?( h?t7Um#1yQxnОJԓ=je%Z+NH/<_4c/=ÌU`ky_u}?E|~-x1ۃ?EϨ(ůcoߎ?9} (.}?E|~,}!*h*xݐTu&"jWWZ<)ⷎ6',?E fT}kuQ_j|okϬEPRqb?5+ح-u!6=>w岟\@ A*[W>ſm}Sn򙷋.Gޟ2h&5b?~a<\e΀Z|T<Ӭ?E>?>4ygqnZJ^p!m\y.~(x}?a)DTW̓⧍ xX?+:^eI_72WXXk|U񒌶uI_6/_kѾMo4 J_63ݏ9ApFKXr=:+/UD0?O^1`c487Q!j+)~)x|O9Q'?k8X^_⟌]a|R>4'Z}>??h4W͏W`~V |W_X^f~'k{Xy)⏍YS|B~'I6ghXleuት! +ؾ*x^}`&xF۵l2x=ϡ)x%D]hXH'1&?e!8}+E|)YQA`݈"kYQ1% ee$8oPk^x>E𯈮'1M;sbOZ;z,_kIga,ؗ9j=7B>u%Ŧ!h7)]Þƶ5|i[BTxǩK @n.6FesX,2Nze=64ɥ5Id_G #wgT:n z Ai%gzog qiYT+P*^TziJ"\ʰ0eR1Yxg1:rf~]OAHl oXK.zMm{VkK2̵E2D\1m:KY4% &):B5[둠%n#ېp9֟@, gyhfWXlbz ׸Uq^bKbƸDPsS5xRDȥ[9nH5MҴh͓}|{䳏 r1 ҮW=k7Vwr1o-dfx[W崉@);t낌~?XWM OJ| d=G_tv'°'K3&k9myqIo1B2EuZs'd0~-vhnAEGU-*FC屌N+Uy=w& _t˅?xˮp䍥9jLy4ۏ1HGRgm[r GcJزpn}mki7 9ǽ6jQ˝J&8oݻr$_$a>gv7K'98#k*q`?ZjT^K.K RQ뷶SL\^^Kur8RN}jC\O-B4TaВ[+یN},5mF{/gcry}]NtW3MiH?;wzUP3ƒ#7GARĚqq̷X ")PQӃFHg㻉Efi%n2W>#oSaVB1݈ fD bW"i(&EyT֩ӈt2xEHd8=`I's2{ \߰XJT*䍧bWy{F %#IY'I<(N:( a>TR%_ȉ[襭2[x3Cd),Z}:FخwҶ Uq%-XБGƸ25[1"y۲"GYa7Oojad.IDGUpOZv]mkv=#VTd-kxuًiڲdg'n1i|%N@0EЇ>!l/m`dȻC( 8[KKIO.ъ*X&Y%tmq"夅pkCS?U>RɻUWtzlKuI-ѐf#ixSc-ǂY.u1Q II7[ck Wi|eJޖ[S -v>d9+pˬ7@n ,r%_'H3麱N~c-^ZǻԵ]rV[+TZl'T'n }qUO_=r $a[VBylcM}VxL5:zCq*mA{ޅ֥sD(O2U.W;3U)$ƣ,anʃj.=Ll>*֙yt̅O-yYB"GX'綻in`WeK{v=yVY-OHIgi hV2)e +OlavNCw l UlwWC}cq`.:oi ,[Kl",NC+n1W miKǹݥtcI 7>ޫ>u{Sg'r0^HW5qxR-EMB9cqH.{0};U"MolKc5ׂB5/Wc\<||RlhױJ%1܎+6oB+(d󧈼+0a5g X4<PNHzw@xRW<5IJ:1YT3/ʹ ۜ6Hz xqU[gFZQH's\ h.VXY._j43l \tIo;صv" s]jBݖ\1Z- Q#@YdL`#җV@05IQ~ԖpT.)r˓TV+0 %5=Ake&xU:/ ]J2=+NeqO*UHm.Щ?j g7D|k^^CdcB~ֹFHB(j,PF=7Vhw}L:-Z >#'4n]H7$ \vU[BqQFvK d]:$)ERqT^gYbzΗRPȹf9KUY;jEhʪ>FreBFr|=Yg{pi 2sw u#VKu<)i9e, ++ Fح9=HE dc֦R0U}& VΉakb@/'V3c'+Q|$߼0͇7Gc!]4H72rBbo9ƶ+it ! 1TLrr9ɩ9%xjiB de6T1Nys򾦖s#)ۅe4lSim&֑;3ڦA]6OX$wK"L| hg!OҤXA"Hb)Ȥ0#ۙ8}IH̔Ȩ8[*)m]9ESVQtI mb8IW%[f2,˴ne=96n z۱A4OP!U`:4>]sXԭʰ 9ZP ӂ3plnw>e=V±궾l}vqxrx9k4+"8My#5֭"eL8s{ ;JdloCl$ 戱ՉSHcU%O9P͵dQԑe=9݉]̹CWnȠ'fM$j9z tMYQm!1[Q_J\LIG`ty;}3>Lgŧth#/,k]MimԆ "yGC6tb9gY6IgkiԚ0 ?zOq)1\xɠl-ZSCmYӷp2= k'r&"%9]FHڅHa5Hiyp ӑEY> v@S=j&#r7&3VkrgG̏kPλ7 fE*Ʌeqޭr& #8ee8ṪF2!,vF?^gQy+ 3cNWaK=}8eyz2< ?m +++}=2l[A<;j 77cI]qYbC*xi[Zsq>R;D4l͝.rOvE3q?y<~\ #k夎:nbɦӇLţ ӚAOMoֶ+&k[Kvzxǎd+-G~YOݭ{=x׏L*#$7Y}v?ڪ\(=ELx_8ݞnT(ʧVwe&=S=~cT!:`;'A}^-B3ȦF* VsQʩ,IVMb-l"s#>Ⱦ@LI%.˰GE hB/WFT AJy@,20{VՏUE[[ *2R͓“Wt(oC* &ޡ\je@L\)S{&w5ԛD2AdJDc.6{ 3P8e#'$F79!L| EWڗ A}''`\O0?HMǂCsWr.Fv>b̊I(Oɑ֖;Q@E 8SUn ل (8mH\+ U]\#~*޵4Y[iISLwD0X|kWF1Hܜҩ*AUJM5mO.>)5v40`5,yo4nc  Yc$l|1{5U~CZ\,OEF{*fIހdX%`aGxt Ѝҗ q{SQbBbN޵E>Njzu{q^E6zJvڜH=?:㧊=+G7{k40rOwaɻTZԩeWl8)Zc:f,w!=AUoI"X &s԰iAgoT6j5֋b'מ_O!)7zpݷJ9ާDkTsJx7qY:`dOiK -<Fx"3]4gI+omٱLVׇ:kWӮdx&8"ꊌo #L.GJo"5&_ISS4Ű>fAذcx*4\fl\3<( !P ukm3qU~@X@ĹPօv/u%NAoK{r[nSocUH ,,kq%E,6cT7܋[u^gcWz<KMiqcW,3 g{34'&X3LgM{f n8qT R0:14冀m/Axc ors5W[ݼl#<5;҉Sc~@88lHhI@TOD-kb'"n`^dgWxsx`$?J:_ξ6b3(1W>#)3$4HQ ]Ajyw<  |wa_'-zDC "鎽ib& #X@!֗NGKvCcqƽw$b75r@KN;U9JಂzT'hs6]'5,`}Ol YI\ Up~a¨Z#`wn̑1԰I8@T,ֻh͗Qnﵩ*Qs cOF63Hr6V31feq#ִdB} q*IɄ*AqVܨ,N1';[ZPJr* ̫hx9V@CgHc߾9֮; Yi8ȫIxd.B.8>xC!$_-Vd mm>z Mꫀ-ϕc"?ZG VB 0#J2,ЪHhBh59`A*:NI٭o\6`0{3$sFqfcb>aVtr)]Ğwv[MubrK(f eF&d؝ʴuX5t%5uw&-;) ZHwdz֍&M;;m/dxдlpA2)ߏ[EijZ}Ε6d$*&k JSͱn+/SM)kDEĝ$+Mrcos0Z41%sQŮ[vbSGq*q_OQfC˛.wԯidy{)yJw0ɯɽN9 K֗<# sA&N(Q sO)݌dEfY^u4]MJ`XH"(`[Z tC(ζovkn!q"`z\)gH.s"ހQ]ӗk[4T~U⺰yd<"O41ʗ&(%r* ^){=+7dZT%,Tm>Sӡ=ʍr P7e=jY'c++\ע\WVrr鵹5.2}\]~p:784\ wE V03֙O4WMoֶ+&k[Kvzx=7 =?vk||CxP~p>J?tg3噡ff= " )dgW,j IK$ *@0v?Z oD! M9)pb2rX$Uwv_$9= f#vp* ]Z6m~dS 8oV<q}Er~I+p9E.qQ<)r}.CA>$8qo!F*I *Ѿޱ0šiZ9W`n8=+7s?rT _##8ǜӄ $Ш$Haue &#+$ Nr o.(O}Oj礙>Cֵ/$Am85k2g]5K!ݼQ,r˻~aZ;uLʢO ȪcaRWKtu2]][h֠ObKilGY՟C]Uv/ct>Sיkڦ#}iAH竈pfߌ=1g{(Ja9@Iq0r3ֲvenOuz}{4ʏ}u)F3daqڮY3SYb+ƅ7R[RS;CMʶwUzR`R~}TuSST.zgdh6=2}h'@z JPq4̤qJpx5̧o^m#Ҁ4hG4p1$dSaڧ2iH8E dUW]S $$Ykl2C!#`Tk .mn9|m[ΏzmSm8.eFI5$aW&Rֽ)Ig 9NSTVxOD-kb'"n`?Zyc۸񦦾_ɘsRW׍dڽ1 Q85ψKJ1#G7 )K$Ն}D򕄱ەϽpZ$r3ʌq Ѕ8cU;5Ze}aA\; 3S÷so eiRMQPz%.\yyګKFчv?ZpRYSG>٤Udf dAHc-Ae;rOzl}ScL{KoiP;gѻ*̊[9 S?ІyEnz;Bv#ryI2^91J 9uܭԳfS?J [$#=P$+ҟҴ海̜W 7E Y+ >gag"H0<1Zjj̀5,q"6.>Rrj+HYpŗr튙 蜍#֡ M2A)^VlEb1)r B~ 8B:|޴%D H8\f {=츶vC3(< k6`HTGjp"բx*ӗ=V/#i"p뚕ciW|wTJqFӾOtxUqޫXa0oJX+slzKlc=R" }OXR{ ="Ҹg;~$(瞆ё7$Cu l۰a#b'EY#'c5NF`[zjŽ`+H@]3uXcOIw '1\ Cw96aB;湶btcM#̓bucgNkK4CqBuISV7C|-kb'"n`?ZyݞvA^+.FލZ GImǕfqƏyJ+! uG%OSwIhwCҦvK╌gwjv}H 3:TIIlQ!h/s 8L̑ٔ4#Ь[ 299{AF2ݷ]vM2#wavpIHlFefRHel1L8w)qkQ#Kp2u#΢Guk{+K$p09Z]k' K2wx&V". hK^nf}+/> i2HN9ϧr@g8=4GQU! XJt_&-y{U{ A.Vsb0ͽ:zw<ZԞin) 9iM${(tMp'TlH\Uq1Te9 9BUnڹ: 8 K.4ryS|)2 u2ydG9Ƿ46F1.7(W!~`ZLL;7A y Ri}jhg6H.@;OcVPe# "qhYIU%e$w֒)]YT( xw=I&yF PDawg2# t<< hC^b˄$5r)KG&3ުmVVbJ8R)dRۣM!$>{ovݳq`TGcG«cgkbۣߗ-@ {Y]jRwB?pS1C 'A5 v$QF@ǭ(s@XQ@ Fxf-j>`8@$n+m#iXnCQyX]:@pFMF-/O[_FyMo##N+Yhҗn-vX=m2Hkb~WDu2EA B~z8%ZIh+&08" D`w?4[4=UI*zR$1]K+aZ:d㠮GNVUA=k/^ʗZ#aR֝rsM#J.Y4rˆxYEJygdp_y$5|5>TӖ4>\ \擠lg7`#&ɠXjL_&h_k[O?ֵʖʼ9 13^^'%OE#D2:s>O ,˜tK.W'ht&ڤCA=+GUIv_+e;vۚHwnݎGDJcwPGoziҗź1 n#|q燼Auq\:Aw$("c y +2鉾U GC/ҵRiE&*bjӼr۫2bfX-6Dm&+HW2ma:!h@X|/lnR"HGDkemM:O\mW3PBp8h[lS#z'P $xK%ɐRx;U M F@>YxR?o駤+Y&iE 5ԧ&2688u?iͫ[YihkW8vKbXx3CF.' lcgS߰Qfp޽qP|޷l,DKs1pGf\CFO~ ў('#p)>\er)S dBb=)88p9AEF_rGSڟAO^;~4~siヴqLn4GJCˌ/SZ'^iqӕAKy~n3Ͻ# Rz` !n1Қ2;zRgȭ)Rzι!I-.\F{QxPM8{ S&A̐y,O<\eII{ף_PQE(7ھxgTe SGQZZҥ[H+īѡ}?6ڭ21.;$q*5߇TW'Qe 2x.<#^=p9hoyk{NRw`WRj+No xI<>*#^| sb>In?.cN|bY})%ɍ_qDF ;*ҹ)v>[7LҪJK`c`@ۼwI0U '#= nSG"XñqӥI&I+.w>0^6ph 7RHK4oU=3svb_K $y_z{ XUrX㱯}(lRaVa\nWByOe]fn^4'ɽu#XgxI&#v9c>s1wQW]KeY$VTЯ42~.- lEP ڢi928X{TXEa3PN:돥44J9iQ5_D:]^MrKrfSUcV8JiVC"MEiyМbRUOD赭Zyrݞ~>7;aY\ֽ?Жq;OOݨ氯,3(n[< l.HҩvHE}mFۯ!b>0DqV?/V#BڨS9"qW#4VKh',8 q'\o8T+^zԒov 1ܜth e$ybwH2{VYQmxR6DmFz :cv[i\W'd%_sMr quB:Rc%vEvKks[Q;= lG˛XhOX)rHGKU< 56tW"KouI<ٷi7duJUELэ פxNM7K{ {i++\YB jRBPDnG[ N4&*[pGZ3rd8JfmL8UA!WV2jH-?\ǖ 1sЎ𴯤tPaIzQyݔkA]WP̰7=*F4ky&rn`$]<:i;̘瞕B^qֹ;mn)䲂-jdEP #9!PZNz,q_ 8$%nxZKiKvNbWzǡ ءc@*-1ϙ@[1׌/u[hla; p*&9 TZW8^#JbȊCc\/c{ \ʮLPG$q[^RTkn޵z0]c;U+YU$u\ےF?Z͕ 1^V2N1ފ\eՂn>Vc$~V"%;VRZYy12K1EgT 6qdq[嗌%V{t5H-529=1M{Dqֵb@A<3NK F㱐Ejfakk*X3?ZO*0iy#9c)났?Z}@u=.Q6^h \2k>si ei j8©*LG2jJ-,d8-ʼ&=>!Lpzk{GPe[fUe,#ץrJt֖ƣhOa(8[UjUKH/ؽՀ|8hUC+'.8n| X,/0 vR& EqN=jNHϖ~=kA2װFqRy]\c֐gFfGDZ_ec0aޢ`ՠ84՗77趶=GL"z3;Hv*1uiEo5Tȵprpֳ̧iUpPYM<Ջ5(bsc ) ))4u?:ByPGItsҘ hdQ= yV }O8={v(R6kL"WASA<1΍ ֮%-@55'( %qg[; mm-"Vp(Ј=|j1}5ʯ>T`1HF88q3 @+FI )䓊}RH$CKUpjb)IFW#Iʩ5X,[Ywںj1L 6pNM|1)Jۈ@i$Kӊm#bKY>Vlm\䟗*|@l6E KZizwoknO]PBu:cRaW"[xcKU|#7L[WxoY{g+?` 1$ (VO8 ŗXar6qƓ"[vE3*b1F7Tsv0 rApL]Tާrj]FM_VfcB,98Hw䛱^Fo>2rFxx"$݇f4sү ХaM4Hh(<&;S;QސpH#1 v+py>8\v}iipJd&y.~Q6Psia j ZͶE!!klu6|ciZ|F |nˁ/3& IL$[,HVl24 =ZLEFrW.q*Zww='Nsgf8[_Zq*?y?h|# Dq7{* Uv1:qjzޥ5, 3LU #G$b"qZkhHz.Z)FMR*s zub`Q)AlUL dϨ|%ǃ4!PX9n}t^\gWՑ9ty?pƨDo-7 ?EmE4W'ځ֭NFF1V.a<0"&NL/͌ZוjS((;I+z9QXzM[:Y9¸CZ-)FPcN 2*H8ю#lY2:Vjn?s!ʒ1J2K؉POcI[zh8>(Tև+S7uv@' ;phu4fg#(#Lc)PG!= ZnN@Bnns@ƹ=jQj33zE%03|Wy-֭,$8NU+ b?4rY!G(<\5>z\=\8W!ljh$љ'/%9BRoT"gu RZ I/ڼ;,{qX2N\=XܸSYA3?15Ro`PqVN:a 8NҀ%*WH{I7)R85>pH2D1 ң5(I&eKunCJa[ZQ-mVئ- **'w>U A<_CF:o%i$,.w^mսE>󵢔Y29>})q܊2i6ܶM@9ǡY Ӗc)$zWm¯B d}j|tk00"Tkp}>5\iidI8wz1qyg&{'TTb[wT0==k*&ǓƥEn T0WrՔZbLFmE1jAZ& SGZsgsԕ}~2h'Z:@|%"f`X7C}Zد2[֎+ϯdkNMIsy.rdC#Ƶ,, bq\:DAA ¥W+Qx>qQI֐xϡPnO8z4AzumF'K}]V|c{UJiCռ?-c3E´JV8-syڲPV=|{JiݚYFbIf99T潌>~)s5^4iD8(暼ԋZ#6H)ҜzUi$uFM9IQ@zSPI&_&hk[/[赭=h삼{^2?.+ ! Ӛ`Ґ wڨ['HჅTC^s+!'%C4Ao-ԭ1\33 n)Z OWc8+e$ircyl][Yt"c)3h«{r88=vVVy<95$tį?Qtm-gӂp=; : 6|Y?0ҹIo Yp~v\5L2#n[cls૫Xh+Aqҡ+Ci$l{v0*͖&޸sZ(wď j) i,{?ѓ~ >kx "p[|e6a@XZYEyKm ҦOX5 ^?5gMnk=@Ybb[u?x@GyqoO$k|:3ڷG&xcSNgms$qe^ӂ:p8J5;}Vk%V%!F}Mkzq{s4YVIKb"q^V2`SRTꕪF-sɦTch p*EfԘFmdJUq֖P+;#1J @ M4uP^3B}Z٬ ș>ElW-Gd>5/Xk^^=cU;p=k/RmxOs:* wgW`LU*Cf߸e^{V9<6_Э&Wx!ڭq[hzirvo]1eL0cnwHj ẒBI'vY`NxaYvx#hZEfI=rp*g#lǜ3i_vS#63aڣ{r8Zjz# + }z\ f[q ֈm$ ['6XT[GhuOˈ"m(8om ޶<_m5& v~_u޽Pj}5y6)=:V;NsMyb^ Q6^m5etSF ?Zm략 vë`%Y'pq6Tss ތaY[h{Ӳ1Kۥx@ךOH@ 1 K@>nzv@m͚ \d7`_UV-R%P@ۭLC,IGIp#ۘP@_Nzs^a5^R澆F ?Ι[ܥ,"wH$̌'>³G}f}(ǒ>\EpD"{G?kxzM׏2_3Ђm6 'ʅQ898T2iKHF0;tċ[ycDM '8R0j0وYi%!|g#c4(ז:tda;.0?_+B8@*qXWijw<Ʋ)Itڣms}+IUM+ȫ*$WGghmt+ZG 2T/5 Fyp|n=qؓ+ħo>..TZ(D־+~Ү5Z3IjMǜJ`y^-+7 i6%ӤULỂO&ORwD:u<@c6#~w9zG>)Mqy*xM-.b;?}=5H+jhՃiZT>+U9/ukPduPSvRq%&JpA+&H14 FÐT+TïwCupD8.U-;wx{L5Zi=I+egN1֫6+VQ}8׉8$*Y p򦬨C#b4`fZHd.ItH8I6 089Mn wЊY ޼~S)'db&!Y]sE4' zPAmc 7/'-O+ڬ3%Ĉbp*Ќ]H _j hey9h"0fEcՙ\ I>񪸙]ܟqv?JsP3 3^[z0)ڦ@= {9˘ԬlpOZ&e*~Hc@tlǥzgùihw+S"V8K SVJv/PJT@P+R;}EcPdq5D⎵V( & ifEх8q9yʔe5N=(?Jwj|]VNSv *8 W#Ff>Q'Wnx[R)iΩ~H(u'~FKFv1#J"ekrկiFIv&X흍媞s$1'M"y| ZۿZxTuJwV~W)ZcKD -kbnV; =@k||\_G>X~k{{q0e!9Z~(ɭo[UXcR{QR'K >d6OT;VkxǜW- :2ԃ#*..|YV?,u< ,X3Ȩ`]ARxlr BogFqS%sG㊖-b_!\y~[!z*&8ynUۻ;И4nix/W A 3i\wT@QMn w069Z7ɱ:s֤lƵcD1ڭ#J*)Px>c_N #t`P3UF.{k ^WxC}4VP .3z^ƟV-t}+u/TbgPq* '֟H|!Z}%2zdQ3c)毙~lzWky;v~C4[^!ō3 Cg8޶ [At KrщFG'$W&(ϙ_foJ'Cy>~?޾g|xWk$hRXE "Uށ\ QC|*8e*I{WLпoֶk_&h_k[4DvA^!F#"9Iig+ڣ𖩨E #*]KSMui HǷ\Ϋ NܙdJ*+r]&g`~bqj쫣+(`״>P\ϑ t.W1qȸQqar4vLBXu[UPFNillC`Q7[c]|1Vf8iP;U =8{hW+JGoZ`Wܩlw}_(\TCZy`?',hVf^_ #  VwA\7fSCVdh \[D7'-ÓD~\Hܮ}=+&b} ȼ~\Γ~K#wCLI.q478 {dRX$OzSMίC=<=ɎG[(|+LOXeJTʔJ-hcKT7)H3Ib:Qc&M&Pb;jCKڊ( J(0iqFMɠbf( @(@84x>-2_uMA`NDH%2:WCmúEм3j!;u!.q/sяCZcNWر[ǖ p ^*+Lz%hڎW1^F_ T]"="m?N[咃@z׍ u@܂]Kn ɍV|R3Ni5cZX,/bH~~P9V=.)n"پ5Fqpc0x;P 4&!nc{sk %zd>/-"֤񃭊l212e[ (ođO(ð~4oNz?">xu ֦sO"={^autE /ZȟEwQ,q ? #K{0_E*%?½ܰqvQ$|-[ʸ?-\M桻=榻Z(q B>ըO"~N%iD(?w4QT|=R6Ht rſ4EVR||j -b.ou1#"9# 16U;'_oLSOcEcn6=cFgo4?V(/eǛ^/)O cuS8+nU(7)n G_zU{Ycǚj?7@%/ڷץQGpPy)? ct“j?7^E}C7? OzE{YcǛ“?7G)? cuQg=;m O7?פGpPy)? ct“j?7^E}C5?ڷ“?7^E}ñ<7?“j?7^E}ñ7?ڷ K_zM{Ycǚj?7K C]uakJOVQCCڱǬ?Hku_JycHkn?nR>>ݫtzUsgǚ‘j?7G) uTQ qy) t‘sWҨ%=;(2v X8YY endstream endobj 42 0 obj <>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.2 841.92] /Contents 43 0 R/Group<>/Tabs/S/StructParents 4>> endobj 43 0 obj <> stream x]͎Ǒw݆?s!Q#A%K"BR4mYb {0_͈/"+gagtTfe|5߿\]ϞzgW_>y/޼G?\}'fe0\XkVdP9ŷǿ~pqS9q̫4;~jλjAΏ޼1Q`LR]Uy5`~4Ӭ?ƍ7eƸ&ǜ̴G?߸a*?po\L^xxOܘ$7_2]P8Wa[ݫO쮝' `t[/:!YXҖ.˸~T;O]m.VSK2Wc5˫Ƿ߮s9nX%GB,! ߅U@k)$(J ~6έ{ G4bqlg].Ǟ+H7M]±I;K:Н奥K5܆!/k]E\?):NnuX.nك oÀY7'Ȇvu[gՓϪxY}%mu%~j-ڟbDO˰ƍK N$nHnɛj/zoU~AzI?_z6n)f9 nKaF$F3Knkb=Hб'Z!z;TvFjL,)ij ^2qf-E]w766PASUx5:s@lت MZl\V $nI\$$f'WpqF }ۖkKQ!zӻ6vBV+L;2u9zXp:ookN>m=4S^f~P涖!6;6(Gj {b{ dr96k>)_*d]Zy9`&.-䬩x3{x)9hO93-س6/yvi\XN\9yɱ(^_ Lm^#؏o$87xugjqk՚;njm))tdZ1u?s%|pbRֺ29oX⭵A;΋et8|i>)&|aĞ5}3lǞSytnbZ̟],목r@?'5ǩ6_\;,KC sޓL}yR9[[-ޛmPzfcfP-m7dmaS-DSm[xGoS9nb?/Һ UdVv`)~r(ئvv(٨07d*zs>xN^Bya>0m{pz9cʐN/f8xon"s3# ʀBL+G韛pEX7kt%mthzz6nفZ+?jW7_RHCEvԥ<nl ؤBh7?X3Pvr ,1KF; ݞeO]gε} i~b];kiϬ P V0E[]՗2Fx@9XHCG??kGNHq.::O;J=hVv\*-~.:0%]M kXU뻰5bGj]_Ѽ|=A]՝/A `Cǩ~_'DQi`qu\Y:cבqzLSYB:6b`@.LpŢ5Y=< h|cOfH#@/+.!B& =o΁fq@ eǬVrT3!`hvL:[eώjֲ#Y,h o0{B`֍D&%#Z@-]#db@vE2A!ۚ5_Ԣd d]54oW*Xn~:]I&ғW+!s,N Q?%DO FI\;YHb*)'̜ ¹~hB!U o5KAPSE%Ɲsωwnu`nfef;p*)rÛ ~Vnvdݞ$$f$Q ˑ/\+;;%H@ul@[kxBh">LTv"PDxOeR`D5hA2}O'ُ3ה[%GZJ׮ Ib\1*"TaXȂcpd 45)8P̈O9'#fFk{U @nMLi(Oݪu6l#0ɕBY-qrRe\bYb `B"pX6k2u#2L=. c\?ȳAlJM-dt Q5qF |T sTcJ #!Qg5{GKK^Ck;*l}6 ]RD@)L!, 6[TZ!L` qIUMkUsQCDluou8x3?%PqF7n~8 !,mpmS8N_h(D2@ޓHf49k_Nk揾XR P5E ̗8T:b$;hzmxg6-CNh>2 mC'ƜUMia>愆(LM!H0͟* 2&hl3e -kfMfNLt^&hO1J`@y&Bd@ai ڭ؂L(@k $RX6A :L0qk'i'ZnR~>(4rl2Bf>h/YSqo* DC&pSUV"iz7oNw[I.ȴ Bsd:BLxFLЖЍ@D`jƢPdѡKZf;ubL쀘Pd!9`L„)Ҵ #M5c $xZ:8>tSH*8k-=r6g1gr16Id4-/!#l@vH3 mcVL`Ơ-9 fD?ҳsL-JlИh49SH:/[#Tc݄ 2d8Tc ƅC3?+]8Tb2g2h6O,^mX*؊.ȧfG-&0PrHrHBQKEPE]Nt ''F!hJ#)Eh[%D9ُAТEzZ44i ﺱR2CdprN"J)=;q_Ypzl㯁Nuu"p%BUlQ+c[{:B*DQ,ZVKGQ,%D]N8=%BFT8mR)K ע9 ~¶й)\\؆)kߤsPg^CѺO wF5e[ 툃|rԢ/3\rn|#=Q Gdz4"$p,vPV|,vLVV!T$w2c1ۯo}EsgK `frA%O$A"64ؖ *-TdjZFYrKm0b@GlmJ֏@:襍dg pֱlf5- [>AZF0 d970ficm{I:'Iڊ>o۶ViqzDx^Hz#ݻSA6]n(EJ D"uz%~z^x9?+tKl_Ėn L"8zpDŽ2[h-;N+Pf";NIkiJ92*`]0;ӔQf!k.5Pg2 |=`'hN'B]Z<{oguca{>EPsq=O#E/Z8ww7&f;IN=.SIm'Nl{=;Hmʵ|® 7?^cnK9&#f f>)ҋ'971BK-#kA \n;@$ "I)'=1̖DTA$kf^͘}[ ȻE+ty"ٔ(ъkz=r;_U@^s ȡ́:+i0~Vd\g=ad.m_f0 `TV8ŀ=;͍+IZy\V@Gn z /` ~Rgz!#s"<-;n=nOE-r7: ٫>Nv>b?7^EեY)t~Aٹvܸ_1FDUB>=ta4 9UZ.2q'Yt$_5p U%)0s k58{iΪAM.p"T Uk`'{iPΪ{lkϪ-gdaY}0nGQgd:-~[I2>kpVDeؾ۝4/"{ ү_ʡ柀_}7GU8+&;_N0'UgdzUk;Uˆ^qYPX"n_UᬨL/@-;nL/)-nE($Sd#p0gez h ;=gezqg;(/v9F^atNiYv^[aରLo,l ˆ9ƾ6Fgm5e'P`@=Ya^H$Xᾰ|b{ K*[;5=Ya68#͡ $ΊF ̶ vӓ48kLW+f;I ɚo2DGm\0FTҎ_oүn+~KB{/h endstream endobj 44 0 obj <> stream xWSKy[|\{{UplB@dP DF3iF9(XI=ԷN陞Pp, @ a0U: ɀobE5{!UV^|X{J0v ؋HU-V^@ obR``x+m+`/>[XT%h;X{b *@ ؋+`/V U yNfP6bJj ~3jEƪSh3ҍP`GEo( mX{J0d_lc%GN0}+`/V U 3쎙WSmq|+`/V U j]k*+ȶW[[XT%~aWY_%^obR`n;n.6*tP@b *vzkQt۫9-V^@ m03Sg1-ݗ5B&ac[ Ԃ7^hΫWJOl)5[{mJh 6xC7 zk;'K\%aq՗i|ɛI4dFRuQUzbET wtIZڊ!{(Cr,=Q^ yC7zk;Mw3^;6+n.bZ쓃+}B)U}pt"jK`/Vtp$JU[k11O_wh[ۙJ~%(ӳ(qZd=b\F ұ\y"}kR@-Vu Ŋ֩Z|TEԚslE?1QoY+ vazz3zs6mюHZZoX2f8f$`R{͔'"zCՆb^nH^w_,U,Y^7Vu ŊjVF[qQk8*}5~j\HNF7bGjI_gN싱M]S(r.yX*UO=\L͊gZb,])Ow)\A-w}Th凪،<TpT}vٻtiĊTQ J֤؋ƪ M &]6Q/*["}ͰbϨr uekE7,_HJrU%+:NU-j;ś\y}rp:o0)m=Ka4,YDcw@e5r-7$K`/V U F?m'sS\[ӖTL@H=?.gnS(m*RRo9䡟K$`/V U F?mgړ] _ΠSg^oMl_kj}Eo2I ؋HUOsv*Q5Gur'*DUSit#a&ĠK$`/V U F?m楛rO/N[co4T"uL+Ff~.XT%@rxÞ7w (WiCSNZעT]R{J0:i;ӞdOڊd\qY~pc,:TTEOd` ؋HUI}S\'f:&* VS-rZ{oTtRuI *4{7UlnU?UQxF2:bR`vݗVЭ*'YǵޯO-BU`^@Ό7:QTEo]^.XT%=.;gktSՠj2 HAU`^@-5jD5LэدC%+y .oKJF(pֶ Ul^@mMuzSUH"=F#uм ؋HUѼ|*nBMUmcږѼ ؋HUѼ|T[Ѽ ؋HUѶpDTHa)bR`m;ś THFPzOÂ0"c *hv>9ro O՟!;Ұ tX{J0ڶo OU7e4,#>V^@mK}SUxMW0(c *hvT7U*q?ժ,tX{J0~>JMUQH[{='n+`/V U F 7UE*қIhRF}XT%g'7UŦy9<פ8tX{J0Z;%T]:&YMÈ@+jjζ+e\^Ue"hv&*6Uny Gꗈn+`/VLU{럠,vbX- ٖ`WZhvT<7U%f(~bET wvƪR#+ UB,hv>;i7U%+2UDtX{+%4=[^HU!ѡ *ijwU6T:>h]DTm0,]P FMaG"5@U.#~m*^fT];az]-gyb*Nfp%{ibP ؋=*˲YI~u>w`av]QR Tu YQP tX{q*,41l;æJKU7~beT+>V^8UI8v]fJKU_j@+ZfwLfXOI~~vrKlFr1.c *VJNձ:b\ ؋HUQps*9U7Ù bh ؋HUQp8PHOt4BbR`T(a[jqJsƫ43c *PŁb3T太K5@DM ؋HU]hڬU9ʟnz䥢;X ȸ@+p=:PH*qR{XȠ@+pjISir+~An+`/V U kTbwr|ʟ ll*n+`/V U _S=M}V2<}XT%L~&ؽмS1*'׷ n+`/V U G3c~6<4⩊~:`])^j}XT% ۹O扦HU65ήn+`/V U FM lTB8Ӊp*|be,8#>V^@v*0jeTOw6$,;>V^@۳1kdT]enyyibR`*)O T5O1 _"<}XT%E w=vcRM v}bR`n(ϻOia:TEYv9Ejn+`/V U Ff6b>;U^R@@+#p?;%XCITuc~ꃁn+`/V U FNcɥgHTJZa ؋HU\Ӟd(,KTuq;nHٺs ؋HUCFaYB!R'UBWs- >V^@.s!t:[s0 >XTKU:C9쾼*/N'S~B+jjgo{ߴ/vw~p&І C:7J[8:~9Z" _gyuG G'z|Ty:D2O ؋-SS5NRzEpY_6&|t(S A&Sb YIBf"=a}bQVl gvbh|#QcŊv첕UHZ~G'V?ֲm nphf_;&iOE=ՐM7Qkqź`ү_O U(l(F_M3z՟n+`/Vtsbz1Uk.ò@Щinộؼ1bTRZ3?YOgOG評V[4zŬlڱj4e:&=atc N6zHՑb"-wS±B< tڹ(OD,eZ[?M`bE5{Jk)J+6}>L6ܟR-35K'5)ITE>ǏmT鏶j0>7Dž>'HXťWۢ}XMEj'|y"BYdS/ǫܟjXh>o8U&ɶzҵI}o9P"Kmqro&t~`K7MV|,tX{q*,41Z{=ato;ǣ . 3-ä_$U+%[Nn%^q~e:zò5. ؋* :mzBҺsj w`5iMƕVLQ^?||I>j<"׋y-A|]cYN?O{ A֡ν /褓[FN`2JUtNa[a`bS5:{&,2-z lgj.V^|0C>o4;㍣zm3y:&X\zbTE(nSOvcnʓb̿jj"pru>o9&I-H*Lp)\8eE:L(4RӞ~U<7Q3p5L2mکċF[,V# ?MoElΧ h3{qMb~fZgf?r\*X.Et6UYU^kJG٨__E|=Fb(㤓{VRAVL)pΏm&%s4{*pSu9BBuMEAW )pϢ\('6Cv*UZ~0Ps1Q@Ve#?PkBqmgUvXKTO~VJ >' ȵc2py=jFUP Wq w){t2j\!Uҷr+v1vl#cY嶳W(>g!|} P!UQQ ( ث,?/Lo3(W2eT#!woѿ3K?9puM(*_?B̝./QY j{fwWM n+`0G {ЌWiA=%k#o9{<a\kN'U^ zugLynoUPWA7/Lo3mĺ/JR6Ǐ c~& mg5Up1YJ_$4&eمhvv?E-$_9z cU9 {E614`H Rԗy%<.nYvN \JUwӁ* Kִ'JW 1\2n+`R<a.oNݰg@gϑIRAWTjrL?= l_UJzKՕ@XLRv(TM ثeT3ܷ2QH 2r6'V:?o;mIO/KoI*Loy3ۂ*݃ۿ}3 PQ[ZTZNru}fvĮjR*ͩ|JRfHұUTϐ;Bz !ǥZ9Y d?؂ P?sCܔG?HU98|}՚O TSGQ@s{I׷9nƓ0-EW`7,Tŧ/Πӗfa&XF(fߺ(RU;GBoB3P:K} Uϡc;/=⤸DΩ6 U=e]ZAÊ>jK:gLvG_WY Z}o+}= `/[}נHپ풱bx@.M_OzO'E.?J砱$!bbzcuh v\<{zO~ B*5CkFwIgjuM W'-Ve̒=:>7^ } *%kWOlŞX148je9Oȍ:/h7u;9,?d$*Vѳ ^i-ed9{¢eo,F!wDXb7AEn,smh{'gWzK *"0:tA,SfXd8¡`Ac*XoLnDZݽL4b{?1lju\s1_:t@5->_HZdگQǪ£*=S#j.ḞD5aS ٯ$]*|駼kD [^TfvG<te~j qpT]R5"f={Q﫢sMun5xtY ow/+HynE>S[ɞ;bב×@a6!|.[|F~-K+'#L=+7Hղb 9gao\o |z)\ثvI4{}! 3]W}%6uMnk0E)A Whd+{*4Pꮇ22& 60N (ҼtLE|3q{kQ~qr~ӀmBSOP S\T +?['j.Տdz;{57Uӷhn)/-g]\\ ȢCa}˵EeQ܂?99*,v,aX| ~w$ U ЉF C`?CGuvv@`*~ʟ4ʛJ*ԇO﵏Z+h u*@enJ0htsx3GN0ʜ/V\yPj e×h8 Xo-G_|Lib3.s m5Tv@`ExS/Q?'Eg݊fK7 ӿè۩zq[;o3yoC%6;uڹGCMJXܷR!Bwكhpʱw3AHYQjWv*J_OnL%;.Տ!F(_Ur= f<#ד\Q߾ȦPᨺˁM7śh!r "h8&f썤tcM$,}I׷{R-hGhPj*pA`NsLBu64,x̟ e7D^Tu E 3A;eVuM*{z%SI#!9^Z"QV W'RۑiaZYB@'⾘)7n _8y3M'~vp+2\zٛ}ުgɟ>`.s Dzk!}qRi |qrƲWMW?xƀJ/)ށȰ[\,å*ڎω[ďy,w(\ث)K(xJyxt`Ż.DbD9k+/瓃QO)p1U0[a sVmG{ V${Y7~?|6ʔ7jK<2F?%ڻN An6KgOGE˸NFT4wfyÇC4IԊ| gYqSťo}q lƵ<_V Wm(+> WWѧid=;ݶ^wABvك|@l1n"u/؎JΘ Azvzbey1_ 1 C ۩&Sx0䓿&W4tA_0%A].UiȈ { {Ι;GW5^Z]E<>9y3t 3'/:U ]vz(_2ڎn6akb3?{Eglͫs! aoH_oTEz=1(#{x[# .Ճ-э{ .< F7(R?h|{wa9Su-KT*\ث%6H}? dpM{F12EchV4`R?>]o1pt|rҒvt(ɽ W GMu)3ƕ4{;m5^4`2RЃ!YN_K'.\ WJ_lcR aq%^rxl#!ڐ:-h޿XeL {5QE߅E^54{<HyD ^oT{}gsg?{TJՁ n =xa\S ?D1 { g9b wgseaKnrݪj)LE@{W#DcG40ߒD ',$0t  bǍ>lN>TRX$n伇=#q(QcQ%rhɣORN2ymvzsOo*iex>ndUo޼7:Rը 9TM@U;O)fb3WMdw/mv?@ox}U{6cQ^5~]NUI~ڙU~ Kiߧ?xdd<|/t$VZ"]PbI+ݸuu|]SǺt-.M诸H?EIT*Cn35Л)QUEj/,s?6{IU%Y!tD"q sQ%d.IɣO΄$FU45YTB9eEUKGXpu߃ǻ:栾)bM̜(<Ը󈪾~.EUǍ zT$kCn35Л)z&TqXuH_G0_NSUyWmT]A HKTU ա} R/qJFcDJGPu' _*CJ pjy~,唫g0p zÇ?WU#|ơ&+JfDDRFcC#RU~+f)yLZtP!C65,.JI7Gpe-.Ϟ=o̓˫/GI=<ˢ_§Y /!TWU.'~ϬB5_Ԝ_YXWMRs:Kig2JG$zB]|nAovUXDUw^SFG(N7j\6LU5𠪚<}u#6ȴsZ3$,A!̈́* ܂| jlBU5%Sԁr#вBWѫU,^?_pW,CiZuUUS B4[ЛAUMfv-}i"gDz"mtA2Sra.fW:OX?BJT[ЛAUMO8%~rP?Ak,ȢX"o<8 TUTw𪠪%v@Us1p z5iUu$H18"TK ;1UĵRTՏ7w\lW嗪'PL ܂| jlZUC|Ŵ.-FC}^yM~}| T$BTU.Y0kʟ ];.?T07_VUwI`eK\W8Qq$̟|5%G 2;DyeZ[ЛAUMA4N.ۋ6sAa% ƍ3L"5Y +ֱ< *rnjpU--נƸ^>̾,Y,l9'Șı/kHkxSݸX! V{3gyUS;W-JgJ\H+ T:d*>nlyA ]@oBUK>;2Ni77_l~vnf"5tM6S U].7N35tM6S U]yvqV^zbqNrT`[*?Cn35Л)P -נЛ[ЛAU 6<;7S7_[JUՃ.x; $.ظ0 n5Л)]]ihUoNPՅzmz37MU7}}ӻڋ,6P+h\͔UUtA'촺z$0]O(!U={}UiWH/O{t;ҶV*NI$XN 㠴iy /\*;000000^Emm'7U1hxk3ѵ#is6k7hiI<5;(4klOԯ}Ělᤕ2ASe#x'3 "sUuʶANFz*:Zͯ#A8XjYu:iz!^_;ΣW e0QAz׺Cx\5ά~Kf]~-"x{:ށ~RBUOR~F7WTk&uh~P* ݾrIwdveWOڃ1TUdH7HgP7WCuFQj74hwnڡ)n?)=o1/iRBUOtͰqjj,JUVɝ^6&oT|n_QU㫪,|],cBa5JyxZ6Rv\;*{e 29^ )M)%T5(]ԸoRU=%\_KUdoAۧy4cQJCɪjFuCeqݾLqHt}"zGKp؎GjPwujD.U=^.;4.Wt!i? JcU@oA_5i37}~|ʘ`;E{_1BSi# qM]#7l_TӐӠlmIWa Ojc8^tdu!U<} O稶jH-%Y9C p-ӭf^Tpǫ%MTR=+~]ُ\ @جKsۯ z z_z vtz'*L*L*L*LOچbB1 0N4 #mwj˛նj~qim*K5׸ǪP"/7ڨ{,KѾtJvVYq1z_ޱUtĭvKvo+^M<;p;+@XLUcUk>luۭN UMYzwV,ٍVJ]׽SU6T5 xvfvVY UvVYQ?w endstream endobj 45 0 obj <>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.2 841.92] /Contents 46 0 R/Group<>/Tabs/S/StructParents 11>> endobj 46 0 obj <> stream xZ͎F0Krad c{l8XɁplibi<95p{i)5G YU]]_55?]^mvd|}0ٿ]rz {Qhg/xVyV 5\ί-|<=>zgGd8fefM)X%+N? =]vHSV{ܣY1e~?y"Q2U̺ye~RB:R"Q 姸\&?y\H*KB*Y|YƲ_ M/ A͋D}#;"v$*PxM`̻ƢjX]Moh;Ĥ')Һb,o>*_3Oq)5/fm.)Sӱ*|6+!e/^"׶LFe#j6DL"aE1!$ J 2RHBBqʊ"n$m)%9(FzbC5 -%M@i&6up7U-k|ٲ}QiwћtLp|?eJHO M5BK?Z/ePҞ?z8+%EK誹U;mںۛbV}1_s CT oxxg|l #=$m!J+v] 9?ՍS8TSƊAEP (.>^2=ҤGM:_>3m7wCk[ >.?@܆osV;g =Yv\9~툔Hj5f N-?*>q:ůiAɁ(fؕkl~_+$& -]W{1rlJHQ="uFW6메qT@:Z[<ڄ\ 3_o];HO[oyn^3 dZGFlX{# q;vHrK m5G>ˮApEoT\#jIU i}G6* v%;/ fxS1vP7mN4h\vkvUWw-şj"4i|g/Ӣ$3C PIuA ֦[b{_Ϡ*拱^x'f(>! 19JQDrIm J\@Д'+ '[^@%\\7;^rDM&.ltchy')e:B|ZE= K|X{K_8,#v|`/ǻd!PN#_bK^%;م=Eqrk}a,)Z`az;w2r;9:f޵Ch*M_#]Yl︧EHjn1U'18Npf_ibG]7Y"U[| #D!LD5ҩ2" vbPX' >䐦aM39UQ{0  !u(T>1)Z|21 c1,Z%Qut$NJ֌ĴW+| ȑ"%c5 P*-?&g{^5L]4N:]+z+ !l"宐 L~ŨOP\6JT R.$[$agk%D@OեKD۬L.iLG܄/\ͼ+DתGzC.c<ЉpRMGʛ5uL(LF E9#rWNZ;S2gH]wh3Fw6Y2革g8ğċy{WW,&ec%&߱p^ G]oVlGN{biP<>!7 QRW NLA 1f ܒ+-xgBѼ%Z >j{=#6آa;V{U&^X/8:δvKmFד?@ih!Ԩ['ښwV V56mX S|+%wiWO!k9-214u_(X=$+y]xCs Q|=_*:CXW`Gm| pIjޡY'j+tTh c~Ւ ~J8.7z5#:j"L7nEڽz%ohNėTp;F5;{M+51C UG();[y\6~˖H7 +`&bMT*ВԸ8 O_tQǶ?\jwP~}ER?HἆLoL6e..Z&FtD{Slq3Qht7~+jUAds~] Af~aU hIY( ~!KpME 3{j.NqgIԤhq=mB黃tB*ɺrBMݴw^&ELHi_s9!`aR&^ p1SJE&(% endstream endobj 47 0 obj <>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.2 841.92] /Contents 48 0 R/Group<>/Tabs/S/StructParents 5>> endobj 48 0 obj <> stream x\K/a.f q8I+i%؈lEZ;jEv?- > {=pS욮꯫{\.fǫj5;8=NW?Mzu:}5;\VW_eO=͞M*2Ū0^6Mva<+~ʎ;~jUVURW7;|4|\Ơ6% R?r͘ki^*>Y`<U4˂:?2@=SF/ D%BC' f f ..$n` \Zt N󾞸D %+aW]5:ҔJn۔&z0Ute1|K״9UVCL)e٤E:;:~A.E2c#8k<YE 6Z uLY57-kGөdYdu{" i` `d-ohILtH&g=4tJLu7u^)_:+kN-ȹ(0lQ^l'*TxIސg y){[6}.ӯeUdii.稞sRm*.|VLĠ1YT+xDڷTʄ.u:zz^7EF} !:%e~ ?&Y~_]{ KyzY:?FVBAQ {ZI ѷS z0#N+B :i_f^ N [H;1܀ t&MvE< .)C[3H&"nE9fJa년C`CkS.-e]z(yE~خ9/)`2xQ( E3}@Q'XH^"phbu~3pY#)9v>8|YpC%n"gR菒ӢԬ7ݷh`F)LEB< e*23U)2)3bn|[&+ʞeEsPH;DpWΩ,i_U-#g+xmK9^ZZ#e 'ܑG p5t$ǭ[ӎq:N(}^k)f S@S͝s $l,n(N!~pd%f-5iڼL]w 8* X_ D Nϧ]BI\oJSul[T̯PF]Ѣ8+S ceC"+fiy]nJ~N5w>_͢]a|hMvbஂ>.ǔ7T? >U5}^C_?;U= >tZrI$2dv\7vpiw]iH:qm.cc#%0>"mXߓ.Al^u8uZϽDi9;M4XPT杰(̐o?h2 lXh;jV~Y4p&iB\4*tg(PSu#fpS2{|@lֿ%k#H &0LcHHCq:(A{% zZnd o#Î+m #thVC(#Hƈp2xI6_ Qc.=n5+U/_Z|JG騹tNLh!|vs n ˆΝé,960`n]P$8Oz8RdNfYlnCn.h ސ-{B/蓏OKGfAnC]n?s_AA1s.ǝUįV!^8o.U'^1yjwa$aH1AXtObϔ`3xQ/12ÉӦEz)[QHA62X5,/ſaXRә !9(ٗ{-wlAxDW6M)az(cD=,!QG=,lch7ZJUi4e#K:-{:dñb9 ktR$;<")%HZTh(F|5@XT s5+i(0;',!cYR1cLꛁ) @XTL2X#!cY1"U*ΰ<8Tjt:CЌ,aHCXCB$ז=HeH(`!sߎXTUp`qSߔݐeZ{NQ %!b:4Xno`I#!cY12,tH`N@hK*\(zEkRyI!TpД,aS_} JQ5ۮ)^lR@@hћ1E4Rs0<#!Xf,Fܶ" MEVgY*@hK*9Jpi8KB$5H<(10HeIHkྔ HqR0H4IiȧNmPc.8B$Cwqklj =HQ4B>BCoGB,C"laǑ޶m '"|i͸n!bFk4Z*VƲ R[^:^*z vsؒ `aVm WFcrm3٥hεl`_WN|kJ뤂pVXWe";7 Iu5hʸoA6ڣuY@&Uvk5߆j9P&!Κ9q{+cJ𭍫[Zr^$WXA `q;uY}ց5lIAe񀀸Lz4cwhzB~@T>7Tm1 aqK-KȢbAk,S;rw?4c`ƏilȒqȮP>4 Xq_~:[&sW GV+H'Q[80: endstream endobj 49 0 obj <>/ExtGState<>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.2 841.92] /Contents 50 0 R/Group<>/Tabs/S/StructParents 6>> endobj 50 0 obj <> stream x[_oW``[8c_R>$yPlCl9VCp.$jquppf"{lXL^dg㳿Mo'W׷/g;K1VV2;,S*9j˦nTT|gq3zgŇǝ!HBiQeUx)yl@|Xn@7%f7r͘ki^2x_{O,O&?. 3hTg$J:Q L!!G'ķ.s,@@üILK8{XE|5VAF}fJleo&XA`4'bDٚxiS%;'Lyy8(y>IFzʞs5d%󭄷&1&lWT`ˁ0_B ˀ97JM45+Sak~ ݮon)wׅVMJV4.DbaDчo(4Gwj/iA\ u;[ :-T>> %]ڥxNG4uV'U'VVQ`v-G⻸riq*O1 X+D*U) ֠fKZհVPڮΚڝĨꌳLcW[U=T&|iףQeb IJ ԯRmM <PlӇZ~;j>K5-DeX!m E|/L y#؁Q{ %=#Џ{U4mAݐO_s;lYݜqR<f۠m/B@Q[Tۆ-}."WtjYYqc!o`#FU@ք=CzpOH` ?VvY/'aю7&h/s΅V07YsMmBU&)yhы Ypb!ʆ=E8̛T̤D́' kӅ ֏{iPj;UrXm_w{ܽӠey)TN#+^Oȅ<[VCAš 'Y$zpыxo؊s /%8zn;\ao4`EjKzoR  o`tk }^xza+רQ)4푞t#vշf5|X@G)ܽpoיh{{#tc3sSp 鍾O:kߧ^ջ0 +HU׮PtZӣoMJJ>Ӵ{fc@ߤI 53T'oZ2ͤ=έ353ql$kL󠶤Sg]ri}ѴvX tmPfAPf4tmtg+:TPW'`"oaUNecF endstream endobj 51 0 obj <>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.2 841.92] /Contents 52 0 R/Group<>/Tabs/S/StructParents 7>> endobj 52 0 obj <> stream x\r@JϤTZQʎe$,f"qe(?ZnqR!t` )o\!AOO==?|qswu<?/g?γowOn5^]?<{ {r72Jf{,?)Vgҹ^]{Y]v!GUeUTzŴዃlnvd<4)@^92|/'˟Gb:?HLDQp!R䋧@$kb`eL_@/$!4QB.V:V%"u|\ #?KS*9=hKJ.RJ7ίߤzi=5/f6ed\)#g 6;=6~֖" S0$Lvܪ@OٿKIUB߭kއޏTK>\e !ƀ-E/6LY_A1:Ϳ/,{/K9'D/_\9p@bIR9NVVJt/  ʷ 7^Jga:(rx{C|s*GN*{ ȜcyvNu R5*r磓" nLg3.r`ƙo=0GO_A5QNPmc钞o\n6TES?3x= ̍=8Ok_],(] 6By % ~z~SG+jBJRXd)BC|E{i> ^]uM*TO#>{pΗG=o0g0M7"h7} fTl+IuwTOln[e[GD!9jv%Hv x4 rFmbV-j'jmOR K?f=X :5#% 5(v,(}=(d(|REEok+?X 8%@I= "Yp[֍x;z,wuS#ٲMlH|$LuNY&9qjv0J\{&nI7m3An'nCJ +}z'^KaTQ?|$<*l1Ԗ G >_D w2~yYBʓ xx٪u,Z5m\Kq-{Ϧ''du V4̍ Wn[6`k +/򥬓¯lRM5gώ[0GRɕFJ >ؘd1/,$#Z7"&Oˡ,F=a"hWM{ k!@.p92e*d[=JV2))<@472+XS31T2E]&6\pIZeFD{݋SZ/Vˉb8'@r;KCJw1.=,*zpY&*GnoV ]G~g`}sHگ[(ha\ $i|?T+7Mn}-ZcݤVբ*6,|GM2s]u+DSbɑ)6j SW~[0NgיBm;^pA@#xP)`Zh7xTWTJ-^|<)vUڧ8ehրW!H.Ǹf9VuSŠMPQD`;g~HԦBz8'6ɢL* \ NA[2'YIQRb\Tr)=X>]J{҉giIBgx:M1Xw9"&@ϷENpd8y,z Mh0=!VQކĦÓrx(ޟi:xX q*\[[Hρ%1XdAW':q3xDU7;H}2Pi{F_"#+m0bdJv%pa O a]7$Sƻ2 W¿RAMPF:oƞ'|oF4==ϘR_), t`J*\'Jh]JB.m A0;貏Z4>a)!L38#&msBUw⤬ 0IQrjjK5G5X &8)N H 2h}0{A[isd3A,' mAjP% B dǪ 3aY%  3"$o`3($"o VLpS3UK#$ vT4ZzJ&_%;SDKu [.tB1o0E"a!pP)ԘϭѰaV 2$޲e E$}q P"qɌS05 N36vg5.x;-)+I0[xKb.I2BXdUAr 9r^W!IN;B9OPԬAPոT7hf:4jH55OY_ 67 Zax n8j;ɢE$x5ACnac{N݅8Ty,N&!cbmu@!Ix5p2egN:3vrսkx)Wzp[/<> dX~؀dScgpCD R)șbA~gDNb{#"b7`?f8p ɝěI&nŃDyZHf >{ ѳNrCNmoGqJp/NQr =&~L:54*3b#|"5Lt,,n2;X4֛!]9BmE/2BP+扣v)%dW %z[L*J)avX%RJӕV;3*a۱ާt}zRnZ(S?.R_7jvm X;'Xo7ߵ =,&]%؃VB+Z]%uƽUNUjI6vF%vqR2v1'*@R'ʱQ]lm,cEܨĮSvPBgPSŸ9LѤ7*MrJhU4ZnTR3؊ -Tgfۇl뜍?*d)܃L 9{;S!N㬋>us0;D|zPv[5YbS Q]/,O*M% J:gつL(ր[) 9{˙w=&v +3B:iѬ[O]mLGB8~7mT+EC_ѿD13?)?܁D?Q)(: endstream endobj 53 0 obj <> endobj 54 0 obj [ 55 0 R] endobj 55 0 obj <> endobj 56 0 obj <> endobj 57 0 obj <> endobj 58 0 obj <>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.2 841.92] /Contents 59 0 R/Group<>/Tabs/S/StructParents 8>> endobj 59 0 obj <> stream x[n9;a݃ipǘd=Y=%Œ}- = l[mX]X,Vn{s5m'tv=~\ֿM.ON?,ۛ/OW$#xvqux@ &UIi& -&=AK B7wQ.ˏ * xL5ftkSMսN ,&nyw1ķ rR?E j$@9̕ۉrPy$w)e͇M)ckKˇB7ő^BzM#S0e$G3U`Hٯ9MSd2 c=.VmC 8iAxV׏M]D;`,WZScGTT4Bwd0!v rpF֒!JO&I~TJuFmw]Qr~:<9`:P˅0wÃ|-8K#-6ѐf3eVEaeI*PH$I^x_o>)/`&G,X,I2&xTwV"^^ pZfXa[cڊxO>c^]`/hR_נN9)U"h9!+>o z*`{y&0HDj;ְxD8c-5u{.i]a@AKss?lϡI!Ot,`u F 7K΃m%xkZRC_97ˤ2%˪#`pY0a0a+(#Lp&KƈȮ*03X#a~LBo`7)e&Z&%$=]0#*P(!u47u|~NO0orp ,lDF2s kqA?cBha8z dž9aCTIY&=(U*I4]c)^X4)0M3l@Ec8t=ӄ; ܞ1*Jm+D_M0./+TIEOއPK݄ AypZE2IӯA<-ff2vRkzxVew`ka2j(sFJI"e6|QhDKHLaQlZ뷰>6B JpvDJ[+l^> 4l" -X&Y`rf?8} *qo c6a(]1Տ KxMk$C A?*B@/QiC@m횦^"22eF2ՑuyZk$w$~PvWIa\V6%Xiqtk?fl O,[SkZ:Knkz}.hR jȈ T*&?tbc*G3Հ tg e!BWzREk՚02|4 A߭"|tCi8:loBMQ4=o.~})Tj>9Fd)Zo"ޤZ8 ܻn Z ^ů}g^V6XtGҔ˺fͬ $<2~\OG& (hj9 ~.s'SptiUP2 6< *}*J6(CyUJiWQ(-{kZ|APH`:5j e Lh̪M:Ҧs\ H};uP^7[oY*n=ꙚEXIoD\)XKi(~^$u#j*ska4mDY߄ ϻc T˶N(ꂏ&: ;yB\pͰ 2ҜIQwNXkunmP{V*]L 5,:thO(ڪ(A=Yſsz? _=t-h9 +; `sc .9&q079C8 ْ%EBǡ\$tqBajw'6qlm7UKL=&s%^xS*W _b#vQQLgQE4.`KY!* *`n(ҿ*X ٤r:vBO`>7IA¢ (SI볋=e(EɪGBI:Q-LOQ[~<Í}e{'`W:x=铢vP>Qj((DrA)d=̓Q֏ |:W#8"\&pal^/>0R}Aq؇y4 dQz|;N2|.Xt/d؅cAV=h܏^Ӈ {1+j߷ހ endstream endobj 60 0 obj <>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.2 841.92] /Contents 61 0 R/Group<>/Tabs/S/StructParents 9>> endobj 61 0 obj <> stream x[Kocfz %Q ˒E:9H>,Kj.D?- GtK.9==QHZNwWWW]^.ǓUvpO.g٫_7r1كc1VV2;9cYfUy2^v]vvϓWyV|w겪TVzŴѳ(!jxMԮd<Ԏ)@^a 5d>-X,\0?/D,YD~X&?fHDQg#^6?|T!&O^LW(Xk O I <1.ax uD+o}7`e[rxPOەmLz"erz]4eqTY5*T*թJ|vPBe'W9OS`P=XCN+QdV=f]F@-!@U? !{:.ҽj=JLtI1$E2BZ8#Pڊ:X6gOu B96zuBKCk y6Σoo ޣEqlg>ʪmlj@ڈ|Cu@$uUr`~R4K4xjڨңu_nާc[s"k3fRg|ŴG/. ` ?Ttk + %V)d3)'+~yαڱnlilKOgZ@C5G-Qme-Xp rn[+/9?I +6F\.Q29l ~Xd?M5:ށsпl0H)ىXhU VWZNL $h@q!yqpf  p(аOC~x4!鉑)Dx#-@H#'QJK!1(%PN r.J,5!RIN~M Xm0n kʊNQ,@_=NzQJK:m)vh2>oE>o(w$`*>V*6x!Oq&5"y= =ӱ@ 3B*'A^G&aB~b-_(0)*s_89;,"ĘVt̸ZdfXenڱƓg4lp >?>C -kO_ 5G/FP4hU)1~􅞋U#䴂LY>c͖,ЎC_ԫkL3~.7L:iuV+VeATMRܛLfs>ZJ\Z3jfK6m3z_=j}KdC͸:[a;}G֣xZTH&qh\DM(>tU|Ƹ*PC1=cgP0ƭȅzzvƿΝ #@`~-)X!Ÿ?NX0C+ow|}D4-rHc nDgK:f3hSj*Vv&] WmYw>Ŷm0 va >(0 UCg/1 :kWZɛdiEsE^2Ώ`<Ϝ'DE3x<.A :цA.3 ~2z;{Sn-V6қkb=%gK@D| 7[%sz }OVǸt;Ujhu."+#gv`1 (MFƨƇv~Y)>u~ 3^i)J$H9{8bh+#j#M=@ڠfr1kAm-8… pa6{9].OJU+&.U: [6k 叡b֭Gefasg7zː.toDJޘ,PMpg OZi7Uߡ kf%6KN AlІS LC'uy^ ;9-=mׯDݕG&j1@'4rv6ܥ : .ReF`=!g.go<Ф7.xmIdÎOLOcןUhhC@y-]~g+F|㺆?ҳ;޽O&=q'ʁsVDG<X#Рv"vzdar@, PY=WNlEhXzaYmzp0Uѥyqpj6HIī> w <|!oi($S?x3zſ,yo&3'sa8pxm1v0Bi{DoX6)Tҍ=>vidڜ{6 35ucv qd_h2dv\jU ҂54`<رUt/ &:CS*.8ZlxSᓩ v 6xc銙plc)!N+f³Q=񀍔XFb^ 5+sĽTZO`7pUz(*|ك_ )l04VO3_T^CŖg __%,Ԓزg.2뙩J4-L8rnPq`J;UJ[MPĹ6SU $^MS1>}hMl*#Y݄л 5ȟo 'XK{;5 xow:)9PNE짠12YPѷr@Od@A!};}sk#L9 И%1 4$C 7 5~<ODžFCF]/d5v+['@%l*T.ݢ 3sPݡ."<"yus^W~~Uj]-r;W35ncȸaf{[ +iJ[KLS6_ Ci[VV}mHz$ lgv -r?(/^c{xߖ (uS5jƌ,1p-"w'2x~HdE"[AAZn2nnq8$MU-vYY \nݒDӀf]o={M ~;IVObU>^Нq}w忘KaMb@iO,;`Y\& w,j=dP$&z#H)ݧ{̲ί%K9\ ?Kxlϱj%QVi/b  ho 7))~ |$ra>oYN_難oɿa(ej?J9%/105X endstream endobj 62 0 obj <>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.2 841.92] /Contents 63 0 R/Group<>/Tabs/S/StructParents 12>> endobj 63 0 obj <> stream x[KoLN?(J2DȌs}.).D?- >2SKN~ULn$h;S]]]]գ['wחr}n7,_W٫']ooϲG'YXYe˲U%Yx*o^YcvGj<𰣺.k+^JBӳ$!nyOԾd<)rb ^>)ʟO?.ϟ_>Z0kHYHЧGGm~"|`ዂfPP$d>o#RsUod\k4Rq>yvZ+n?`N^=={04h5ʺjfD-"_{0,xޠT~qF| F^Kq?~ܴ_cC>z x, 0y"Ft+6-%ۆH:p`˜Gڐok_dheYfCpҏZda귞|r_)bM]ϔ%BRPRb-/E1xyMb$3eg||\)bZcgu w?wXX 0*7/fx 9 p9`(nXboH[d}γMH$(%hT,nBuUBZ ;LLaz$kQk01Ze2b-kI֕(`!z3 >JہhI-hY3x`T?7vm  T!Jji5G5kP(am8dYhмҖ(_)CPTM5 FbX_&rIUMﳵu>qb+QЫ61.GZ&n7n%sĹΆM"ϕs,7I0TPDΤT ыQJypFxptЉ5I{FҩqO?ؤ&L>8GNw.^x!.T O:4GւY{KuG=Um 23:2$@cJDÄs~ڮ=R^Pi%M&MX8,0i` xfI]qRX|DNrzmݿ:uEEPÙEA=$]5(b r ~;=@ôhK&ntrM'xdW}X08.Õ?dU T˚p9&W%psnIՕQa6Q4C%muWG.`j ܳ 8H ࢲgeJaEa)t!mØ(6Mg#OS0]΅. ]o:,o|xtiP P0<5v@) gLBV,|?dnUӖt]~= kL34LWayX x 瘒Q"৉G?Q{{TzJD[{*Jo($mB@l)좵مE6]{"Oż(w \v؝rH< DO>Zھ5Md$WIZIƶ8^Y{lEJ)m`lC; 0)Y$'bJ[9i1tx2NLS xxD3 rnÍZ0˿ =l?zf[qFӯeDJ J̠7͡+doHw#GDe7>dL#E]Ysg14{֕(– k<9kh4">Z<4g#KC1G͟r@MPNQmUNͲqe BU (]L@^ [d] i2sgiJEv 3g?+Mtxbx!wV> qLEk1^ЇlC.3}#5&=2iT%6tNnzvK%$N6&{Zک_Bz]5iOcCoCLo \nɯ]M$F[^}n _IkdRkP_w]< HlPYU)s*YD@ꍋ4tHJ}\LMXeI=@LvU_bͰ)ѧS(x3(wOE ,_5>]Vâޅ-/*uj=m?Gx%$gcA9v;D4Q F^^gj"꤆E''ae t %E Ҷ/ ;H 0OYXt3GQ1#Ϫ,u42P $kzeОLBđOX͸$˕BNigKeS^z &#'[ Sֵ2ʝPa(^&ൃ{r eJ#0͞b{l\q#5fw 4nLۙNG|l@ Y8 .ĥ4.8fQϞWO>2SwT %]㬷q+^xWu=g(aMVJ!X@ZػLPpMaD\FX8ECy(m+Ÿ#D_0EK_vha=Nhy6,5@`j0> Q 3ǐ_ ,ȍ@C,+(Wh"0㓔3(u8\7ҧ8;F&\Wxk#}/̕ /$LrE3RU45SKnq P >{w=JTOSӵ2*Uq<ABЄ~l]]e(_~u@ʡS>Bмn3+RdWj>rV2jIF47׹h,ъ>LXp"eu1m:uQI$xxK/S~v'>787M(|4ӿgC;L߆U]ZY  Y(e-d׿Ǘ}M>o *6qx2=gTjN^Pw (j1@8[>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.2 841.92] /Contents 65 0 R/Group<>/Tabs/S/StructParents 13>> endobj 65 0 obj <> stream xnG.@AX0 hl+Z͖f"%8܂9w>A.szj0ݬ~7ɓ'ͦby~0?nnWO&ǧ'M(%y\\$iRҜ0ԔM. |Rny=%gbe nO9|b&%#TǜrxzJ5P+@Al x5ƪw}VF-92^Z' @Xky~ LHg08D-_vz6v {nMNM U**=g!vbiQ 6Ѽ\ (T\ɚpJz U|cL^vր|+p!_!|o9q 8-ӏ yy hut}1H[kek(ͣOSX hiGT2Swn]NU(* `/m!W࠷ra\_`VИ;{kE2_2<֟CVtϡQ)=Z C-"/Iaa]y@V.\4: 9SXQ),V¨]̗(&0JhTJ7f *Nʙ]ٵ|^||u85Ѯ_[3^mm_$NZZ#]i Qr̃jvqce;(h ݽkf@:z-JZ,U<… b~3WflY%gFbB/ ][s1s {rGsve46c*G ,뵍5}wBȓOpM)_.bGKB+)@X/5 endstream endobj 66 0 obj <> endobj 73 0 obj <> stream x]M,7rـCIf X,0.7y! Bxv8v*_Ajμ*&YLvqz>ȩQ}c81ŏQӁVKvvڎ11:*=ViDŽY`&&~L?r.41bGʛ=F?.lkb$9dȝ?%(?u1zsƤyqNhT{d^(sArA8-cL,J-gOB(pjgptFG5m-5^3 pJ5V3{|s)i%kOaf,'|tdйp,y;@Kb,O˼}w#X3~&F*:0rG-k'~B#`g+ ^.zrM,'Qi=O` G쫅u)N|N&셐NdyrԕwL'-.sr"_Kq\{PF =a ׮ǝ k'Fm}hHdňI..3Ix5zt!/)tB*\Bagx`$Y2cI%Gϝ6q/#V Н Pr" րm%n$,Q ](2hN"1rSFiqo 8ߣR>Iȟ^(?Vٖ2tآ!O!Ĉ,/Q\L@jJ-T!#MV+qf^멌"bR$)5gmnڀ):N,KO*GR:)#D'C>*_qj˖4J9=;)0B6![41stI6/I>B=S}ȝFOD;j)?V!uJْ0Z+2b@' hC>!z2kx\Ƀ񖵥j=y^'È!zpb?j^q [+F ѓG'C1@C1!z=y23zdhgI6z$S"W1DO p?+1DON ѓg'sCK1D3=%bhR4' y'1D@lF!fPEL|sq9:1Rw l#3bD:܍WDRi Ǘc"hQTlh^1b8&W<1fSVd3ӗ3Ǎpao=)ьVC9PyXȇ4 y-Z(>gn*@eXKO6:ŀ҃^2gbD k W@虱1xvg 1%wםQ/3N)W`z+Al1QppDHuX-h1 W,ΩNwjihseځp˼ ^g"~5F x-;mxXYGLHkª8h1YSN2F37eDB^xF3|k *-܈Xƛv;h2b;W^&{D,U%dm5FL\qTրJBFL rRˉ\C㹉D9D5SkHSB]+݅ʞ-nZ=.ݟWoTvPv6݅=[>/jeAeBM&}:ӅW-5(U|>AjnI@zמ C*Y{:O/]®I:׫>ROg,UγxY1;Xg]izveCvb vG4lg1; 1Aw?ls뛁볝v~i`ˈ7igs~=P1IC[?y_u"f0s!¬/kHfV1[Y 1+ 54FĬАRCBjW_2;ԮfV@jJHKM)!U",5TR*R%iHXkH!`!UTJTIR*R%IHYJR`Xd) b*Y@*KHYJR*Rz_",UTTѐT[a" U${ Fy`Kȗ<؇"ꪆG̺05b "f0!fTӐRzb^3+ t #YS1+ tU#R]@F.Ku)]/R_",t9DXjHr~a! a! a! a) a) a) a) a) `)|et9,eR`)Kא2]KYrX5L=Rt9,eY@J=Rt9,eY@J=Rt9#,Ut9#,Ut9#,Ut9FXHr~Ta)a)/KiHEXʮ!j]ίܝ].]P]r5]U]uL{;v`;&Awc[Xnr}fMI#n/ڰ8 uEwud ou~aKAȗ)RC@JdR%ҧ/Y>",5La) aKM)}EXj HØWNyɬ>魜Y)/oOS^2+ gz+dV@ʞ+dV@J#KG(r)P",Rz",Rz",Rz",U>EX H}Ta* ,RU@J#XGK5)`jRVTzpRGKu)Rz#,>GX H}Ta! ]zF8b uX.\_$ԈkP=.y>Xawgug[vc$v`;I2wڷLe;vwi0;"Uw֥-7nnd}Y;wbx _.< 7o1{wӵ~`K@m_tPT"f0_,Yf1ۄYIۻ!jH, _ص H魔]yͬ~ecb^3+ 1+ K'0EXH=8)RE@ L*RN`TүlXL@Ja2)ʆEX+a)zpSL@JI H~,R. ŲK+ a)r K>#,UGa* <KU)}GX Hj>FX Hj>FX Hj>FX Hj>FX Hj>FX HZ>EXj| endstream endobj 581 0 obj <> stream x\]$Ǎ|7P`*dA+椅a=Ց;v-پ{*'If%#HVo6uQ:}i[F՗Q|3y[|%ւkYw\۲luzuàco;ҡvXe+NRj-0:lm)t *cGm@: ++W 4͛A! ,6(,mT LvfXطV7pMluB3 }l4(4hvn4{B_p(4(LmؒaԵCa]ZQ BlM5wɾTĀS-lzuڪP ՠFNik@!@JK3h4@:mi=#:b΀Z&zt``*Z!hۀl&@Dcցuw a[;N8z d'NqߙN8ŹN J=D}.>kܨ}CDGTuR:% ߹N(o'[|s1_xoōha qxࠞw8w9 ;}wP)096ʩkÖxa5e.Q*'w [`j81 q+K4Mn >\v6:`\$@%(ؗ Ekdtp06Z[JDI6oec['ֹP ۈn^7h.p@f P^YWPIY 13[c3F(]){B VAA >APB`àx6s9Ha.Iz0r 6 1 J%LuA `"c"hAAmA[lغ#l]bހl#pIƈwhtJ۞[ h~=_2#3c1bf4)3)ҢQ6bml\⎂F eV6> t?1/-LQP my"6h-6H01F[l4sl4 cRiez,å5F ##*m `D+moƾFmoƾz us)u` oAvw?ΌdwGgT}ݽ3ʑݽQ3+ ;P{$K1 QQF 6J|G&>ndXHɨ8*mԷo QPqٍ"<֧Av8 qdNvbȕ56nd9) ?9C-;i &hF*>rwX$iWON#2ro-:˾+ԒkŚ l+#M*i#Pz,XtEպG Dԯ{|b'~^"27wrݫǻx7}_0朂_;6tv]]W+W4h^ѼyyyyyyUUͫW5i^ӼyMu5k^׼yC ^>j9o ,Onx?bLKs*[q?h<"?l.Z}\cb 3J%Í!GɰjR2)- 2IKԄLKHxB&ʼ^8c:}׋p;WiSSSӐ&#MS3<;]u@ZvtA)wّtջ~z'qıIQ]űIYZлc>FpvG`qzWmmU۩wHu"=zы\}"}zҋ]H7;nҧw#ݤOHIޕt+j"zgLƫ2.ܻ͸{ȓ>u߅'ׁ|\]Mi\]i\]Mj\Mj\]j\]Mk\]k\]Ml\}LHJWiO頿ٍOMν'Mډ.>⃋.>d.>⃋.>⃋ͰRH|!ćbv]UR!^xE!^xE!^xE!^xE!^xE!^xE!^xE!^xE!^xE!^xE!^xE!^^d #ċ/B"ċ/B" {ײUeO8<C8<C8;C;c 7ʙr?{xx?n9QEOFLd?et><}O Px_޿;)3z͛~%{ ~y;*GfTV_ *IWD=mi H\pY羹8[L]q(NŢ8XZQ+qQ*KEqL7)ŝxSoLQ)ʻel\ uE) fE)C P"E,Z_ѺcZɾ ᦤiJ$iJ&癒) hJzdgr)ɩdfr)YOfr N+F=vc?s8;<W1_S4[SZ46 M2!˄,L2!˄,L2!˄,LȪBVU*dU! YUȪBVU*dU! YUȪCjϜ UBPX\3@QUU#UHU1*FUBU*6U= TO}TjU$U1*WE_\Ux kU)5\Д ʳtziB^SAT7%½`oJPMa)46PiG8&p4 MhG8&p4 MhG8}o}nmߦ}mצ}mݝ/T7[v~.{]vwVW []a+lyY]+Gu妮4g]4ҕFHWJ#]i+t4ҕFHW슔]+2vE=*??!Avi}Sg#Yt7g3ٝrgCp=gS%o{vLcϪZ|:kf3]i;fC١g̙=lfSA cN<d> stream x]Mj0 >dM),C,rnB6}Y=uw'Ǹ-€'UWM{Wn;$;j".78<0o=Mpk8#%TۂQjf]cDi; "©o.XdCjyj0ګaq}sq߻+);(ArOx[S 1So& endstream endobj 897 0 obj <> stream x}|TU$2ɤ2 3ɐ: @@JHRhB RQ,ko:@X@wk ]u]wBoϜ}=(D* Gcd5Y 'Jޚ?2d~ q9 YyF]:H4Bd3*/`so}Hh kJɴo+{&*:ĆijP=ۈhjAe}cSW-[Q@ۧ!pm-3gW..wmvYwMCtoѲTV0,/گC9pXO:Hw`rAWin_ӰrQh) oʮ[TUygp܄T.&?5K+oXqF j6{YRh6;E6 51S; 렡ω0_=3rwBv}o9CBX!B^!7t㏇m 9`:o{j"MijY(z!W7e1bMva_YH4kf5'Իm7u]a6$7Q ܇ ZDӷ#H)q7eDV<'9D>ާ1}2pz2kX[ok>~M[cJ4Du(=S~͔k{w>=Mt<-Y[jc"jZCu*#-G,Oup+NgjOuMX;0 OX:s=0+4e+]2&]#eզ=T)[ǗUޑbƉ7S\q4o݃,`cn'ͫ~Hhg}XBOmKs*ſuЬAw;| <4t(A<\4}9};-4x5j:G-~ ~(1Sk;;ퟨL;MaE)ʵ^ XfljLۆDXT.\]ti{.@^#F*y ` X,` X,` X,` X{Ʀ؉%G)L PVJ^ԏQ6QTHi2͢jKu@~NCOӢor&M<9cyz2rZi/vZv,˹hyMY;ڵhyZ~\MG[mamO`f~zHlҞ g" b]g}\'5>`?u; +OB_'Q:ePXf "sh7* ٿ?_CZ{aıC {bNǛ 8_“dS=c}?IG"n\˿F gpr+KmvҚAcm`MWIr`钆.?oٵ5ճfΘ>mjyYxR ǝ1vLQy#Gs>촡CջWni]]([5,4d6隠 7kJwK]pTsTxpt,uVŜKQn.>ZR؜hX|b*ʋJʜރghS"9yNp{ iίC{-aܚ^=%4 2 U" кmbiމEy2GF[ޠ\oіs3]l鹻Vͪ vUWN+ꕨԬ77Fez$Ct{3]hl줣7^sly=~OP;Rh4o!Ɨ"rqf!m**崓f},j2gʉȜ&sz+E> ϲ9 ަY^=}' ?wzYUs$W48n%^w?>Y(_YA̕a(*f꽱\|sK*j\/UTkydyAٖtoeӾ? 2o|.Jz~siuQauS2UZS&!nbѨWZ#N8K5^&\\#!Æe$9Y*줊.Ruh =-weSt9kiז }k\Zv3&];4jwډXo8G,= +> .^,uո\Crl2[[T^j᝚٫xp77['XҪ[,'1ߜUӢ4X<ƅ7&.^vB]!6oRŸ19h@|P^2TEq6;m.y1*C:,01irdGZUNޅĺWJ|ħJ|J|~%>T%W=%ĻJx[xS7x]הاīJJċJJ<ijJ{!i>4g 12\͔34K4af4i 76?ҏ/Sn,7ԓ)SwnLt:SٕŔM09 S2S)ї8ԙ)8ԉ)qLaf<S$;#Ly` _ sĤS`"D8̩~d:yLc;_B [_B1诜 7L_sW Ld|ʩO81>b!}>;cӻLpsm|u zuvƴUWL/Egz< ;fzILOp9i7c(#|iNL\r;bƴi/>O0ydz~Lcr+0yw1tL1ʴnlr3Mw# L3]5LW3]yWr+c.gRLpɋ9tӅL*Afg:W Zt/ja3V3+ }qՠr3152-eZM7pL*"nl!\T4i\7i60Us*YLLL3fsϦ1MAse|R)|#RT4M;L={h/ .2i/QȩLY] Ůbb@#}Lnh*4%l_(`_T)h/40E}}Qr`}|Qrmf1=2LݹnLLLi(L.n3LƜ܊ KfJb3%2u٦|N>LP x:񖵯M:tk>WW"|/X8~YgO[:qx la+V96v  qv6Թ1l 77A߈n@[ף ].,tَw:. q8_v'keȄ4wB^A:bܝ.x[3^cWR`pNs߁X8kIN!H@e8G`LB\N%c[-4i2qW\M+WwQ7B/yʧqig ֯cť>}ecMR݆nP,sƒ%)èl/۴H#G&/m;HêKUw[XR<9a4wXNn;Ws'9s \f,Yi U&e2SzϒHOS\[KO]o݁}?3M;5@pXVggˁ3e@#X,EB`Ps9l*`P T3t`0(ʀR` 0%@10 (&8 `,0(F r ÁӁaiP` @d^@O t@:t\@*8H;tN@<1@4؀H @  ̀iD: #a'Gwow____?>>>>>~  ^^^^^^O{c#.`'hۀ^A~`3   lnnnn~\\\\ .. uZ$ֿX_` /ֿX_` /ֿh{ { { { { { { { ֿXk_` }/־Xkއǭђ%ff DG%i-&|zwiu=m^zrJ;ry)bjE %ƾXIPGK[۾ק~ngZ"aaJBJɫոWw7&{q]]i߆'&B"NpAc]+<)cPNNN!YYӧGuv_T}Dt?3&ӾkfvTCGD+xxiASݕ>h)إ-–pńlJJN3Y;gtqH0OGqڑgC!&s= %2lmm٠Uw:V~̈́wmʶM.XߒDe lq௷D|`/9Q|E).zbMDH}DXYP܋eВ*ԥĤ[bZE-uCRX{3%dc#8>.& )\3[b3W~q׼zNŬ,a~Oz˧[R4 284HnKa/㛛oiqؤ{VxYAQ]x҈W m"J(^Kq!M@8 hܚصdr]U?,znZ2r`p^2doFR0MAɈVPl_w#|Fut-Cc!8s|?V& .aR$ G'5-XFHڻumac1xSgaCB-ё8ݚ_:S< x'~<:D˰cG#ػsRDLfj 4&s4&4&3f31mu&&Zû7& lأBl 6q1= qOmҴzGRRd\ r}$0p097Xpf3*2H"Q}?H[Y,ЭC8S!űؖZ&(t*>}/+eRe?ξwUW[}Ϲ? BE:cc`>x1lL­z5gbjϠ)VmXsx'w\huk@>Yc #5{ˆ?ZcrD֟:ۍ_PydrQ;/sOwcbro,zۏl$hS4)v)v)ƞh|Qi:.#+2ٜƗ~;fHE,ɭd`4co {׵n%t-$D1'Tjiiii kD[ĉ6]RI0"2Y_S,:r-La@/ q!T!4 ~Ȑ꘸&5QʐmxQ>ʹŗ ,oް}iNkx{TI'}S iQ!QOcMn X (_ QA=D" ՞ LZxa4,$  =THE?(TVe8 qzH[&H;""Bmרr,vGnotץkD k.38w:B&v_x 4w⧵ 'Ъ>3m M (1#>,ѠGQGy==g`vy ge py: 4, òلaF >F}};| sϝcȪoo]5Qއ.[;t?Z?~|糷/+oɝo>%0]X {y(2f(2Јl* :pY/&T@f-;aY.e#XdcETa u *E$w&[Tm;44\;C\JL @`2*[~5Cj]ePKVEBVeGC롵k9X^ g@AQ(PP(Eө.I I"{uϕM']F?@Ž'$XdTÚJU8,r3.B&/hj}4Y82/s9juI޲^O5մ9zGsy^](,3w O ڡ|pWS&u vkyOؕY>2x/M#X= 3a|xi^z^6CcV0< a<T_ӠP;E|"z. <v\y4hPeА3A K;8o#ml Bj}fy;,4mkI|Pp*.Yn[XHn۹m0o_uƴ+VQ= 3M5%{]`8A4A ݩtepdD?Y;(A6*@A ap1FH ޤE3R q,qmD]F4! 2".(޸̠GP4xLY2 y/9jYZ$}* h& b̪ªªªª4CxDh,x&_윶I{-A!O‚06L4trS rbRW ^Eq5߹LJ[9 5uW޼jCmo a7 Ap<xԆuxqBXO$#db»X2w6Ƈqb"*QE 򛺺1m2*4GV(hUdi7F.8T(tr8E95ue@{9*<Qa {?)"ڰn%\X3N4pWF>jQzL '`9xPC8]GS&a$5+9f'')$T|0ɡҘB.wPOVxAȩɯ?77[@HF˞", ^E$ 0PIHbU"Fɏ*l#u 7.>^G0O &[™3qXqhsDFU>?DˀNwɻi9_"(W_GTOt9o)ǹY 8iaAEt,VPȌG\Ve },͏̵E-MO2nD>HgѶ/IM%$qqkc+ZՎj][wPtJ(P K`Lk69L%ˊ# r#OniⅢ~v^(қg7CK n?^DF_.z񮣛n^QExo6yty77^f[`}Ur>4L>:3F"18'L/EaF23@\)L@UUufge}cQQr,wvw;*#&?'>H2Z]\N بۖȲXPe|"*5+bZJ|d0w3Z()U37A\0Jcjn2:@ۗean?l{qCC*Inx "E D?/C7:ڪySg~RDabsZ+ѿ,!u0G Py*2]v,J܇Z ,] uXZo֐]nݜZp>إ*V&Uނ8#c~r 9zi=š}gVʭ%?f3R|j&KD4,(|?>SFR(4T(AЍR"% Fe^mo(y!@P]wM/t5@n!TGq|Rb:P,r;<+\g*c6Zyd[T_Z-}FQ F-.#K#TF5b[Yxh\~wYuUhjMAm|_fŒ ͠˄'4223Vg: Z*>-"+6r[;G)AXuq8jIZ5vo\,5K6?=@ӥLA O 2VDžZ?܄oj>&2~7 u D&"(}ZT^>ILjiՖ oѐ T[59ݴ*8+ ꏖT;Zv Cs]YH:JSy8SR9;渽= u%`=Y/d6\wo9`$6z=o%R&MLK4D(,ꊹx"n :iaa>gg7U3>ĥMw ffyMOs՝뛫{Ε+*kW_x^gUleq&"UU]+׬#N6k Zmo8AMP:KEoMDp.`_|X#-@ph(~k('1VDw5̗kZ һowxһeE| zZ)T<ÈXd#L&<ʏ:A(_LLWMΆj+:&ucm.W|kRֆ7'văG %.'vM9y;zP<ـd,vI 0ׁrNOݟ $@J0! OQ* I%_:uhҥG &ϓ{J;@ߪS]uJ Gq3iéHI8̮yPH,fe }*{s݇:-75%Ks0#vZ%(Wa]}rW$fwŎWw=JZxt836:-f<&:3~tmC'-$_)׺ގ3G:pclZjL'+?ueǍ#-tAd_t  c9WpΙ@`v<j̝/ON> J2ޓJ$5&'8)}%T];S'}t/H9gdMKrE+zXw*Á=ea䃀îVm}(pځÒfB"uFe[w؆}gtu#\DRQy5@7N.g]AҪ՚7srr sa-J-rR| Sj/' 8WW^dNR@//Pb0LRx(OpT0 zGTTce,$袕|fF\Fi/|OTs,OaM؅VU\~EY{8jQgEӫ(:g͚rȟcxؠ4ezɌV2㌤?3h@ƻo9=g˹{4~QAMq( /eA V!=m Um9rk)'7X=˲js~/vB@5VH @{cY N|Ss4NG^6X !kyW9W4и EP@.%_'TO\r P 8TYnX}hݣM?PDܗX\+~]=q/X Lr}s׶6_82 ٙvEC^֓$dYے5Ɂ͝{0IRj4HjCY< z8A_Dx/1!zq4x°T.[@:+ЌM_36~8 .JΛ&S݄Ȩ/+=Xo/E!z;P8Cne[1-[ S6 L$:Q/ IZldO`Ʈ?tXP ^Q/ JE9E0|Ak`&V&ߪpUA! Csb]ƴ_7jSSjFoFWrJd5',0tCE_O<)bxI< cSi:5NAMuF׬NE2{'}=2bЇ<[a78Ε[x/OIxK̿8%-,o5m94{٫T5i@xDsBNq|%h/~?[S^w/k7U8yS T,k ]a.wY/Ĥ4g^#"lj;jhQxw h eJxKDL&Alrl^=3-vbaJgXG? jJ3tDfld-qzx$/>8 |@O@ Zz';1"A`̇X0SwFq2mD(?j 70cr J(;OAIa9~;Fqؗ}EL&D+k`i. +X{!aE`K+gZ3wk?F{hҳsj!3h McDK_u-&o.;oRk<}y*Kefg;QFeԭ uXѰfԭNjWΨg;sW W^=طw ?طo Jv핋~"<~뇾[j{n zb(U.m88 ZЇ'\мd0Z-כT FhZ_!`4plzd8h9vV '!WQ:(-A8ж7`y o1~ dLrđ196VIsx1f(; $й2 @Ub+/Z P86=-w*t=L9W-NtVb :ҵ2ckz2#)I+ڗYt.Q6hFU ⳛ7[H /cxUou|( FzwunzUs yMڇNl3X á͌1mbqӊqRqjmHLAa,=V4aiӜ..P)K؞aѝ޶- 3kn^'S۾*ذ+Kku>thw|;mnIp;^}~ ֵml^'U,k6-Jb*ga 3ԝ! `JDAj2Mt|¾bĔregAAIP(W&f(+7g(Om^F4C¦A,YGrţ6>%ַyX׌޷iÝ ۚ=7n۾יjvlȯ{~7K-zeӲcyWfv֭]2^Xdy-9O#ki_P~6g}4:u Tɨf,ʨfP|Ã7<>KCƞ[.C xO.֮|㶻+GГS1,!g~d<0d 㸹o;gPw6%Pe!p_yTUZaXB?h}FfW(F@0hDc/X?A+؆2n? ?, &܉|v *;AJXdeO1 ߌhi'zAEj Z\^Yïز'9X+Wܴ^ط (k{yf u+<>/PϏ$^ŷe,ޘYkީjayCc׎O~.imd*Ee,|<ïG8TdTe8-|8e >[[|tϢ[*xcb`;+z*"prẾKcoY֣+Ovw@ͯKkZ>|l@59G*{=@-׶ ԢQA?<¿/D̴ pqJ|||%ӲޗQ vН TLÝy70m7GV((pLt%DwܡeF/P#Yx_\&ak'AL~e'J1n_hO^ntvhF-t5p2̌Us71 3=}-m;.r^\Q는2=nhΎmD ;vDa0[Qh2б_ȡx+SѢuˁ7ڙϬYBQs[{p⻉`o\TQ=Gzy݊Vu+k V'v^1۸dkCcat^ ҵ  W7rgt{=.ڸkv/[T)m:G,K#x~i $aǵd_|Kc6Eo$Q_L6Q *Q(6ݠ!tn`*{R}WSiU*e]{*ce C;ʦZ-5 WVy4_$\[A#:?-:ug̶y̒|e@OPj}vmV=e:e Nc~Yصhԙq[zFr#{on-@'ieVLafɄiO$L+b$}L"%/:J޷}VRK[ٖɶMfmX !l? @plc ` ?I`I!X=n-^ |?3=[ow'zdLtAg>?k(8eU5Z0z`*K,-5,MU?bNKq|u+{z5ۗEE2lҙB\ZտYn`kF$A9pz1UwFKh $vr(EY55cV~҃6RzT4(dB/[_ن Z6^Κ֗ \1%לF4j%HVHH`?i^>͹I !/d áj#hV Ȩy0[y>h߂ XߚO0Зelؾ4]R6k˅ I1ȕj-]>7*KaןUX=+]둒UwwwZ̡=>s篮^tӓ^!cYL"2wOb~T.c}37[r`]2Z0j!Ф@(wuĕKt%7 )24 r>w S+qL,`Na"slr:Q crՆPB [3VaCu[ORd@g|EjA0t. -rjFVy-5W^h`}BJH?;bp#` !R߀E?r/&}"&) wZ9óyv@JgBǩ24q߳\M.C(\..nF"E!2}Ip.)EŚ7eO:LeVN|3gZX[6@y}~ f藀qdwP4ݫwP͢͵GP[zEm$n>xp{|}+VTo}"{ WUy^I9AzFzBzͤDd1K (I '<ˋOy,Z#J =d!,c.\W3,@$(Zh Mܒ\[Oe! !cZ.4!7WJ752.>a ڣ˙+7yͿ>I7y̥vv"o:PJAhάIF,5-VSHm"ivʩi97>pʊ`>qjH%W{ܖu~4ƼUf!Ngp}s.EmFʩ+c3/kL㯐jJۂ뜊b!ڠeewGgMA'TƬWҋ<-+659Rha.|dF2F$$|q?y#^X{ٜCI,橂d<);Xǯx;m2V#ٵ)qŨfoԞJHWo5JW_ȡV)*\5X1P# zV`baeLgfV׺SI[n4C{='QJ9m!ԄNFj-jqaP p&i£P򐞇{TU**WEV=D#n _m<<{gn+9 tiz0k@tWUuzk]WS}fm6K[cցb8.*L9,~oq?.<.:=9qk.oE sQCӖ'L;kCʪ3CYHԐ{M΢-][2[E>OHSA.ڷ:^++ts_J^z}H^K},O:oye|d\=d| ~`u":R(>.(jYŰB]!yvX H$)N 0,'K"S̎ Pp Jy 6;c1ϡ,CY)b, Ԁ\S(];aw*` (pW'JEfU5*djtjFn77-*' SmEz _`A c"(/d0վ*M(2As-P0z_U(H<  i܍k7WB~ EzG%T%j&Dj 6fY/-']dZ D"#蜩XRwDWPqڡh";K^v'h|(U0ylos.bmsY~ܩÜ1YN]͍ޟ8nz]SC_VӲkᚪXF糪Y;66 mP-U@M*OrݹxJ=2ToN=uX,J԰234u95a&bb䵌b|L u#e4>& O ヘ8ucR>o%1-L~̏8F8O]Of;AٺΦ3XeQzUNxeBZ`&z}ńPFD VXI'Fmnb?Ogƺ7egӗ>Q:0-/$2͂fu4KfN .lN&N͊l֘l;v-xž,4K{ =TUNZVw۷K$ -O aMex SD<__9ssE9ˣ_&ѻ:%b^wXZ9 -О{8ǽd,?FSk>B!n@QD"ܐ_@J@H\FIM zh2 uz%^{gG? Ί!L+>ZƬIqꆣœ OFNa/C*}#F+8jMdOfNG}ȟ[*E7P墒W%kY0Q(e̲&]U}^zLN/w"M ~qƯf+[kr Z$КvX+8{D~?ys;y}(3r1 +4?̎p0>y"W0Y1 &y>Z;ANS+#IR[v"{UVN8uvs/' ߆ טwۉ !~B[wO|g1OT1$Z1ζ֐ycޘr1 *a<\caQ$ >ƑWcQ_;O`w  ecqkMUU׬)5(e@^f'޶jܚ {eRAnS@G+W:?ĊDj:i 8,r֟,Ov*Tj5+=fH+ wK1~a7?@Oa|8%#:ZOsG@}g&r]ЅZm~"}F,]:JB?w,F]ƈkhJ=3i:)EǺ&4&|D3>ؑ9Q8>s~6}p=QFhEd O,IjօaYcݤ IF[OsNM0[g%4rX7~> ƃBΝ)1˝8Ĺc ݪvH[ŪH[fR,0ϺruiQ̥^Q*~h~P`6ihRN5^:c@_d4k/Fs'~nߐw 5iA@ΡbDŽvd>a\ 5$ZuZ+ m8 |hܧ2Dv} ~*֤f т %\ !XF]?jU>b瓎1ւa¯.uz*Y|YkCvaPmkj kl0?mۻmm`&(i &Z0 [1Z:f2@l;WꅣYyz ҭ^jlIXӹಥZWKJ ~>%urWզ_m5-_۲f'ֳkAnog7kYNY0GF+-*B# T@ Tp L.@RR j\d[ :٢6lFh?/zJSΣjڭ\pe3 Gڸ!-թPNYROlG6EJI5ذީK.̚zãfZ٩7a)*wP`qW=W!bPc@a,S9883|iڹ|,c;:j"Lhڻe}yW*x eA UY9t`EbЪFF$f6V,Gl6|Uuؕm9hUG5*+$DIFbtUt< /[~B!JfwtpppuOQȂÃw,ZkKo3ڰr5SmFF:7K;N{|Ai$63u8]QԈ48X\I R\m*W̸c^!c)`^WeTmn\[ex}%N[ ;e5qtf͍`@QtrxCMrq_ШFՃF>FD2ԝ\r=H-Qg^׳^CG14MX|q$ea"2iRWHRJ >b S[*{Si[Y[HbV(E):Q5]XlZkbH-gYDah[i_U$‡}eX|>FeՃY=xjQWY1}u &T$0ZGȑIG_E~Cu[d]+RE* ehϮ [[`ubaͫc=Qf40H2ăZd&Dd$ |"rPhyj5U^<)+v]NkŊ%)ӝ+մԵw5v/ GlYQߐՇ-* ULWS{ DX݂r=,ʩ :TQ\m< ~H+7 %oG3kU.+Ko1 0:+ eПBKW6y?+b1mvc, O>&:@EEsćA4pCP,`FЧ8 \w>PÁk>)3HOg.'~ _%%@yx@U9Y4ONk\@4h)6\~iABwo ߧCUuMb`&/ / Y}yޝ ֶO[Um?qx37f{MMo|+yx _x烷*`Jxh|f[e9'o'op z cضn<;Rk-Eo<<<7)]&~\p)IfS/(CEuaaaa0000U6bjpj" 5<x 9`!bs/`!bQ+q+ơwBǡ?'$8Oߊ0r7B 1#Lz\#9< (U 12*P@4:l}RN>g\}¿|:wG?g d8-? !Hgs?QD` YS!sEDDDP@J % dP@J (g@r 9 >lʹA T\`7(7cPcKBckw4|&a 0 "bC>,&J}|XBDa)uo^FˉY>P z*RbC!2]Ňid f0 >,/"Ma17DPR@/#B|XNE|X!|XID?aa\3̅3h8>sax\3̅9>sa\3V(MJ>oi-"Fb z1LL@\v1QaHi .b)č\zATm1Cn܆ r !=N\bB#&.4{|BDB]Q rP6A,J /g9ď6d/Za!c.n#6.\NHsw7<A5oqv(~n ??)Pi]8~(%{@PQxrЄ[3[2ZhG?o'reQ@w!4aڷ@w). &1ܢ\1\8v+q'8wQ&X*!~^^Qml|?ZAV\*8t Pq[8{K MZm~(ߍ53vmü݈)kW.,0-g縼.$Xηs\?zu5.4{09Lz;O FZ^yR1No|!lQFq mgy1Å6~"K 'Wni-ņOnXӲX8?nd }, p\>-og7yqrn GŹ!%\[BV(<;HE[^,6s;picmAYl/.{f:ΘUlO>{3ɼ2yLHBp!@Ĉm!Ix ̌3)#4"*яkkRK#)HR/RRJE?J) wu$sHkY{τ@-̳zKCd:s3zJ3a&/(O/Ͻ{BD$W5s#bd7aiV\ LMU6h^?EFٝx*2WZ"Qɫ\ FE+Q})+Cc'PE#qĕ_w|v8#‑U^ )jk{kxbSpdz:ޞe#g !z>\u{0r|vd=t*pk55#+Qć99SXDwEE_VaJ6\pxfgCd^c+^i1=bedkcd5hӥbW'!s.KDSB>V2FY񦫲/Yegur9E]+HB"1˯Oh`xAR/̢KOi 6W:Sd̢ud.jx܌%ShrshSڨCF}rIڝXu`>QS:j{6ޭBY&%xgrk´#T#fVWEv%}0rl[m *9(k\=_DcVV22b{cUqO8*|lPAlFW B`Ri=YL،Q)*pra*\ZSn=)H` Y4%5:yeTF\?! Ht*}D1Q㾍j sDi%|vV/"p^=R87_M.g9$~_rr#׹r+ ,u9s*\ermXwU徶-v7M>!㸸5Gsx-rkx6gʞv}ؽnrxd#arhrɜ2G%yjqɳ+*wt.].պtG+;]χG}8]!-qx܋nއCna؏Vf,C-rmQ>]hՊ5N4@ sʐrp(!)#[h&*mۏMzZ],t--h\w4dWq[#3cb_fy{15tr^W,ysPnuxMmR77pX *y7btw`!Zx48Hȭs-n8q5=tEqL˝2UePt:qK#s1Zo7p^+[4^|P>im Be$"3^Kzښf F: 7+/ŖmB!67D6ʑXq?ƧMXąҁntZݡ6h9*h*_ s1mMKnlv6y0G)iU[[ea߃I Hn' wc/8'x* -z|zTY8tcp0yǯ(%]8wI{;S\Rn) SȋAgƋXpysu]N#X\ 6P&,6O )G8 t󻕌T ]*FXH,k^a|HE 8}CWS(`#qtě8 )$sJG,rf#j}0F 1w]myu_KAOs4 2q$z3Ip?r5:)Lb[]߃aj?i[3,.tfe_ackT6*u6W`ͺb)֡=ΰtgvGG!֏yK͕} \\_B?Du~\?f,B7!<:V"k;r}D@;ur rE^Wj|Z5\u-r݄\!םOop'-&ȵC5\F#g6r݃\!׷oﺳInkDqw ڂ\;*~\\C62qF1xU%cPwPgYq(8~D4dUvvPdf&k^>W^ke22{bժGy 0 !֍H7X0^HT2ȯ͇o t&wCkP]R3$g">{up$sp `18*H>f z=3:1&03jP0PH ^ =Xbi3n1TF Z`8"rc lQriM3͌SF}/`>I~|<|$Ja jL衢c-׈ y5Ex(c61e `h7JcbuG <̱`6R񐸊gA/ %#Yx0Et'1KAIH<]1ceU39F2OPq͌B}.oՁU/q]bnWa06R.fVboDXb(:4:F/bZX!81c#y&fp!nT1<1K|_Z_Z*UcZ k]CJx戎"3qE@֕$]'/QA@M/xp#O2#7bդ$O;醄r~|2ӆm0-".blQFIVp9lIR$8ElDŦ5& ]Y)9WN]HRSѕ)*7, j6<pc߃Fx&I@Eq+fBL9 &f5^xg,_!sj{qu8 #7.(ذP'zcol*[ژ5a0s09GY}bԑWc}}cjaػw“rO{51hlϴ ۭFܸ\LIe.GK@~U/ /Cřyɣ'Qtgq 7+D]n/x8I2* Xj"<[ӳifb8⌼d{x #l3v O9% xOpK&`f(jCk,>8 p c!W -Ϳ^Y 9w) `S^ފ5p@*KB!Ӡ% '_;^ |̬<_nA[nXu^&7f%S)˹p/C^}6YF!n(Lǿo*o,g6!~NzLVx^h,4%{4G# ӚQ&O&JxIOh# s69.,Z¹w."l!Z5{ F&g9  pz܋ͫ {7n%|5=vz}w  O"is9$B#00P&GC8%  O93&8 Ä+ >C|mJp.>M#Of`0orl‰ygV%qJ0DA&\Ip—w85Mƒ%9&Jf$t‰ g.$\B'\Jp--=[wFx  ď9&JDF80;&M$#F8!,ؒp ajgBI_&|5=&|p)3Cy. b#No' Sog"oD,G,"y'۫#ADf_xݏX`_x}bލXb_XjA,?Xn+ȳ8+S;o#Nx bG'K""?F,O S&!'A%9qZD[ !ޖ<(8$4,y!byrcG^Q^r3diN.d:!ƽ=jiiq^Sq/SX/)^F|?\'[G{;{O,<5TܹK~3?lFk '\G$@FBemVYʜ&foZQKai+,IAt :Y+u~]XN׫{Yק;ԝ֛fRJ Ww'b 1)1bŔ̍2dxͰppp>;#*XO ci\oj4uV.m1\Ls׼g~EoId[-tY6[[v[XNZFkk=b=gˌW$nmqmf[y+=S _5!%azBC7@{ &&6$:C]=w'HJOK 'Lڗt$dҐhOoJJ;yiӣ̣GM5}T`ԶQ:>l>%9%;%?4!řJJIْ#?p񔳩ԆTgj(+'uKéSϦӒӲJҜi-i;O;;Z?:ytѥF;GFwe>>l>=9=;=?4!ݙJJIߒ#?pҌ gF(+'cKƎ3f3333K32̮̞-;23gkZCjF?֫86¯X"]cj! /1*g }F"\ѧi1t\}J:LCB2ܹJg*U]-lnu~ڍ.yL%c]cvk~VcǏit!VR\0$חhښ]Q5{5zXm=ԲQ`d.*OE9'E\m0()2MHߡ^̐7DӡfA,1_kɳdz/(rS"Pf6-1?{En{E^=}򜈱:6y~ֺϋqoY.Bq;v"θV1O_{q8K.7^!Ei1\w+r{e!\X_v"f+"XoXszN!,?yVdwjtvDľGu}|}^w;(Bc视/w-Vb|bVmz]!Sv*}"<޷_Wߘol%_9 #/Rb'7"W><5sOC|S=B>?{|"U~7 w )[b}k.=~`F&~BhR̯\zPDӊ|{"+^/%ެ/khG(?1DwYrX.By&vFW"GEZL3q؃V!E {?ϝtKz9)V?}/v4e3iiZD~v={>b{աn$.N-t@'LpA.q(2ŻTv3ERv4KHen2]!\%C'2 R![B*9$! ,XH%2!XH42AI4Ofz iʩ d[fiR$!Y\MXÖm F6Ctm2K>!/(2~&7` B:UY}I/V t%>#F?)H~&DF ν,%]ht+,ŦѳU 7l2vdu̐ZQ6fG. ٯy~L*ݨllc7ioԺ^i Qxny>QcF_ֳ'Fu{7R'Kh{MX'J7WןFWd'4iFWz^ڟy5ϧQS-gzN~ 3 z^S|F߬+zA7j~&z5;j}vZg}Fߠѷ_Uy=J]3vDtG}?ڣwW?zhbOB3D.b=1 1$ JۀoɌ}N3쯶"[ Sy;R}Ze8؊|JEJFY˭wP:|^ƑφWW?~sblmv wd!VZgNNJ@$9`{(DrHA6:o-1{Pq sġ8t7 9Dw;XØS4C mщj<Y:˂0C[GB71fe?{+I ,yJ|l W+_*_dG β3]d($_CaK"M&o˷/Cq9@r%}(%ʡPZà!Gr r1r I2 r<xXNL"@E9UNGt9*/'_+TlxB~-* <)dT B&P]~'r\5 AO5r Ԗ?\/C]Qnzr6h w]>Ao $x!o͛M^ xS)0̛M^# Л̈́,o|z0ʛ́\o.y`Ay+0IQEa0M`t%TH E9ʁUXa_Lu TT6ʡr@ʩrlD-9jZ _j9U+JFR`ZV|V4Not fj+,VvXvڭvRWejAuV0TGQ^Wa:N: #^&d^Wrc^1{al֯|NCdNFsh2%I)foI&)J3B>'3d&"_T2!_2'i[,$b|Ged9YAV*YM֐G'FN6d JdIvdK9H9Jr!gO9O.LN2 tauY=V=gx5bϳƬ /`uь5g/%V/aцe/v1^ʣ#6-l+ƶX]bc5;ʎ`$8;ΰ'vZ".+*Ʈ vu BPB=]4 ^X >ºd|_be2հX al-Xlv. {ü_ |#Ofovn~~a~q~i~?s-W-wD  1X/1L #ćbH1V$qbXLb.>)s1C|!f/,H+|& BH,KwbX&b^?bX+~zAlb,b.vb-b/8,8.N8-ΈⒸ,⚸.2 XTLb">SO8/.vWua{ٽ7>[v_mtz97>[N_y t9!(g3$9g3Iv&;SO43'ܙ|ttf9_9: "gYtw~pV;kΏ:g;=>s9sN9gsysѹ\v8WkNs%.u .w tA{=uI{=urϹ E{ٽ^u Fi!F v {a g g G91\ù ??<:<&<682懶vtOoQzKDo[r-1ϩlݿI??>^MwaB.*>zXS+UTZʗ{-u_JjmuS9۔DmS¯+2 U堦sXM$zbVW6/o"{*7fqr(7pcܜn.n7{ǽsw܂nTҷ[KeH]:ך*=dWʺY7vjguSke̮U\-sȘ??]jOSF( YimZܧ%)L_/Ҵ mCЗ+A*Ft8LGѱ$~EאK =X"Az^Mҟ!w 2φnGl|ϒXIqdBd2dd Z7Y:אFĈhq0.hqŸBs0|D67?yH9K ̩9ݜE6Sͥ\K1ton1.:mi@#btxDm_sgitcq^+\#\- bKH#=ބ ޱşO0I^+Ѵ0-F'i :&QNѿ~Cmf9\Fn#q׸go70 BFaQ(f7J%RFini:D7-t+Ft'Ew=t/G =D#(=Fs.E \kp2ƿNdK4ɥ߲Q'16AoJMzuQQnZF6^-i"Aߥсt^1_t!]JUzw*?vkhH0SW,Ufձ>y{=loT{=N7[6{m,~;9f3|#zmì-&*֞5B:CRLK{3_ه#1}>ig*ʝzr'|G,BLjbߑ@$㯨 7'jTG_1d[G;,Pd]YU +Sxƺ.gQi& 1>-5j# #؞QPah *$=h/WPynIѯp-d,2[ppm|y6=Dc!iضȷ'TSd!*:YhX/Dt%;.(Db,r:BΠ^`5}_G_8O ?rdo4Voy}C eF^V{=.}ݑhw\/j,7/qˋ, `\1$9Rl%{Q6|Fm.,V =NRXg6S,sb +**&,`mYEtg}X6dYڏBkF9Չu}llKcKJl/;Ns 0qDgim;-9zF&xZ^ aMi#ӊ_jlA+ilI؊V؆V؎*}:3FvyqGyr|4\͉VX|KjL<-1ÊhaeG wi|lö {Cahh1]GO!ǒhRhh2h_mAcѶmE:q/'жO}VEہVCۑVGۉD;>v v0 lßij1)^ȓoh,uKͰ,7a .֣t*2lilBki|hlJ?؜"Bc3:Sc ƖtV>?}D8ʣ1ͺWu+ >7|>wk|&XQOt|'NOQK inJ( z>F0S^e9qdO쉘ڋ;{^./J&AriHS iٗ+U}ΰo8ġߜ0g3|:9\g3Is:۝ng9v:ǝi+\ 븮v빅"nQ[-tK2n[-wv+GJcn[}B2,"Y%yY^9e.y7F4q!zE T*|K@Uz^ .܉gD/ ܜA2gI6yD$?O@;?[@J:Q;?lAls:ZhuZ:@Z:Ϲ UVZ{lo!Ϲi?ւvB& 8fq̩O3/ju4y6sŰ~:Y6侳wk{JuV#ѹ>Y3Qc[>|ބc끽mXkxwMBשo p~_Ğx.A޻ jM  Js5Toj!aonpKfVV?1]SU1U*Q UE=jjzy>kLC[r\x>ώ̓q,U~^E#L4ܦ"D5#T[bvbWUG5Tg:Q ɦz^$JKr~?ɥ5JM$U2ƳV逸jֺ)Qϐ"jB0Z%@5o Okj6 {L3B_Ͱdip5G}>ώYj=sVs6s9FS#oy|)>Cj+7+?5u H;<̯[5>O;ofcOK|yg[y數?7"MI?ş_~mwo핿֟7\O};B;ߋS?AOWӯg ԟ{Z[RptۯE҇ &[moʧc]>W*T^w~ƿFKi!{ ObN_d\A*Ez c*mz T?h83퓪*ڪj̟ؒA[S50Aung>mGj1)`bسx̙*_əyϳxef0*)u[B#hM)4ѥt5M;Az^dE,?+bYEVb BEC+h`I ) iVC:섃p.@7Q<7ϋX^Wx[<`>'dSy_Wt'a4F~kT4Fho$=~`cd?TǷoaߢ:0MI)wSV :Ty1wtyR睪:y)wja uti֜<yC bEx)^1Wq=yu^7@?[𶈭1& xW;#P!1x8O3S,>qo "F\͈|;ߋz(?/ W ap&`X묈Yh#7b.#Q1Q(X[byQQ -Rhۥbs芘ht7PZxm!a(c@ȭ@nH 6 i!@i&@i)@i9@i @i v@i=@:#N@:$ H$ ]tHW ]t H7 ݀H =H/ Ho H }H 2  2@ 2 C 2P C 2 0 Á 2=@r@Fd$@FdQ@F d4< c2ȃ@ @ ! y@0ǀ<1 y@d@d @&d"@&d@& d )@y@2T SL2 4 ӁL2 32L 32 , 2 s2\ s2< @$d>@Yd!E@Yd1@Yd %@Y d)e@Yd9@y3@ +J yȳ@VYd@VY d 5@Y d-@Yd@Y$H  lF l & lf [lV [l 6 ۀlv ;N ;ҜZrQ9HToPקԘQ+jGL{3Ȳ9%Boch&œz;^Qtv.oc)SwXz!.3|ZLi5MNvӍў17ʾD Q1cvxe@F;L;OG9QB}6sP<ԓQ_r(\\U(W\r-u(7܈rʭӒe?1s3M%;f2ۊ6SOm(|i <}{oԜS>ށmĬimq' J1M~>-Z*t^Js3NcLBX'6k4p1;f;Coak1P R[o@&ME4O3Byq~i5`~у9Ɗs1.J5ւцU۩=k<X%ϒ@jI_|amN/z_Z:)VpU˽.k"+J)Z XshxLz5fs^~Iv}~kAqDgÕ74H_g)leDk ؜ݟWҟe$|b l~Ps.s"5h53fvL2Qc6ƌ.4J,l$fi2C|7y1 e3}>|ֿ>LgT=Z}&LJU>_%|zosUgϿt|j¿Y 1*|=.K ( lDȼolz=Pdo0!ߨc7MW@ͪ ޶UCbr︍O6E!jUk;YqC㚥??$,87lz_^:7mQn'kO4;lո]\c}[n`68\CF1"xOjJQ bN|RK9Lĉ 1eM+%"eEEQU 4c#wGD|_fwpGiNhN9}Ӆm1ሎ\ƊwF]#Zx;.+p Wj\cv\ų" v5t•т6m<]^쉊V%J;;D ]|5  ` =:P^I/o2ĺ+*Y_Oy7{x) ?*f4\ykiYs택Q4NCk/^]c:J[T״VZk/U9Ytwg>jZTHkis7[ E`N5i{}:dBgv7777www >|!b^WɫU^5j8"p)ACCÂy78C#G|,8S+{e^9g*L^?Cf]mU(ڥ>1P b*b(6b*b)vnxA(^{bxEFL2ZfYdVMf9dNK^'sBJdaYDdqYBdi/Ȳ,/ͲE֗6P.;dcyl"fl!{rOhy|@OȩI|ZNbD.y|Q$ȗoN~/?ʟ*T&2T]unQխM5TFXݩjZ6jn5D 5A?j|@-TbD-lsSw:U!:>T'S\}cuW.t!]XEu1]\%ui]VUt{{˚^tx%GptԲd]%[DK>Lt9er5{;_"=*QjIT[ՙ&|/MS4K-S+hڬ2C){V>zV}N]Jt.Co:y[mt{{^^׼}ahHP,T,3bX)jFz"~?_į78"cC')qZd@d9@`y"ar 'Ir"|@.UnSʏL~._ʯIyJV,UVSU*JUUUMݠQRUZR]j_=ƨ45]P3,5[QsVSu6]9u.}έctP -ZѮt%]=^w44NиA r"\Z -7B=rhy0|y?48 M6Z~Sk|=1QL*O41]3,1[s J|-ߊL]dWMv=dOKw>_|\9WΓkZN)r(7}r< w{}yH~ ˣ<.'TWS*T!UXQEU1U\P%U)UZū2JR]TWMuW=TO5BݧFQj&jzBMUOJOVG1u\N:I[:t&3,:+z۽NowcS^+М_Q7un6蜠3Sx+' ?ԥ,39EnfVP6s5`;5r| E!QlD%/D*(nթ)n"QDC*!;h6rw;A5Sф=x1(W&7b7CI/'6T\*jLUOo(Vؔa 95u&a |W}.M,/F6O)|}moG} [Q߁NS|m/u5ki RP ^7RK^ wR+^ݿ%^ң׍tkzZVd9i-^z 2?6mj-\2qw~@̽k`<n;=hq9o'osDE/jQGWe7mDP}-"X_BL@_qcѤ-_COLL &唵duFl'ŖgcrlFylAyW/ګަ8S)cQi>2l*lQ)=h{tߍ"&6)5Qr4#kUclؚ1cjVc>֪U׉T6BB8c,p-c lưg,?c`l?}P҇L_owGEӿc>]0dGYlvv;}lm۶cvA].jKڥvY;`W+UD> Yoy;>{zy{xz!.ax`?zKļ+0qB=YadzOƖyY 8ɷ3L6v\J ls]f+{[s*p"nYUҭV*nU֭`wk7Z:MV%fUŽmmUj3V#v,9i'2Sឲ)r)h'pO<=7SA=2S=3S =2SjߴZ~"FHa<"ED,j%n St]=lEWEevwU\Dcdw̎.fLCylUHs*ɖ@i]j[%.-/tu /ec]J? :ϹH>{Wcwf!Gm5.zA~;Tп"VҸ^g73h-ڈ`N9,0,9iNBV~oS9m׎7;v{o3UV-3Y<8;7>][++y=l$OV)VV5(/vc章lc7` +#M{c2\YE_L,զ ls뤑u #@fm@Vo@6#@v@N? s<Ќm݁ռh`@'x-:zY})ը&kV欝t&[4QT%Rc` =%rt!zwE:P drBQ컻R4V̲,FYd YreC|7;⻱XK. 먺nQCJ:aU|v'( *êwoF>ee<ێAO"ڞkA{ervy*{3Yl{~Z{N7؛-o;kѿm!???Gcq$ Q Q<2*xcvbI^%W̿a԰k7uv %bW&^{ooG)fvGX x?4: wD֩n&v??){hLYsdȗ~;xNNϛو03}xxuF|sBW =kk6k௕V UV^[-xm܉{4ɏ{ʲ%AAPPc ^/( _Qo 2Tu}̓bYf',kΡ`Nš{dXsWDcqϯ}7EL >(zDksDw Ҿ˞Nx\ǽoiwo].]rKwqydȝF[MU{E=_kіRg4w@<歏rgTw(skΘny%?zL)9bvCoCoL* G#ҽ{㺋Ļk&}ׁlssnppDb;_hv<Lkr,aZP;"xף(E%AtƦ d6+2*SP^?3J2wsq"oJr4/ĥm%Kk'|2s@} ״(6{fo%JDhFٓrXYmYjiQ}v;uΒ2Qa=?bWghM)e˒ͧIow269O.?W)18Y%yb)6fM] 6z\e6uLkN Odz\z V-ϯi76nl~v^~f*qf>!)j33w (3xY1'`Y '.gE hek/ 8.aF*{r|\NNyG6yPȯ e3ax4x5Uq 뜓_g=SB^vSg\2y`)x;3?d/6?dw9<*7kG:Co͈=f:θ,4 KZ_xU*9mWKaۤo7[~dG"*Y>dh^4ϯ}cDl1zv{^F{q9S'twt{.!qbx26XN>r ~S Ts~0q%?/2硥?¶ Հ7. ۵rvEY.jhg'3v}O|aXȡ{2Y1)ZYk>]\oJZxV*m%p`%rhg岮ՀVc.[-la㲝eՓ˞V?.Ywsyu/Zsy5˱c\>fMBebMe)k}{.ߺ/r}ks%_<𗁿7/ |߁GP?Aԏ.Q?PB$Q?w@{s꟠gG9Q,zVS,'~ߢWpקgJu(2%Ɨb ctͻ\˵$N&\x{ŽT v{QpcYpcE͈1ԇrACrS'ݧi,w;ǝ.sqWܵnp"W8>rzk= 5gg[NOeJ(9?-ײ"s9KsdNGv\wdN#Rqq&|5͇ݜ,`ͫ{=y4>]-שi ^PQ:5 29/O!_wug!_woE&cz Ș͋Ș-ٸ4R9|?r9wQ_*tnNE1O/o{=Y^xY^i[ ϣF<ȹN QxkCw;t]pxyëD~y,4TΥgB^ӭ(]?v5]۾nj7[Nvjw۽{vr`%n ?9g2sem{hsN9!N kcɮ< ?VTjךs5V:&|}z~*wqz#瞚w|SթΫg3Iv; "gY,s;8+γ*gYs;)glq:ۜ'wOjA^eC$p/ tJ5g>.ӯw(?RtS.&>urx66T1-9bv lwTʣʐ6zO*(* xEއ{z&\}ld#FD@DD$@/@B$p1rH Zó#㎭xh7~U n@5釯)?؂j'fqY68om-jO(<1<5PxK'W_dZ9ogy| qzG##_͍m%ǧ~F{ϻpycl&Nb78P"f9Xq8Y&MqH|T\!__7[GȞ'I4tt dzr= ɞiY= <ܳܳʳγ-NAaO[IjH)"ER]Pj*ZKRw4H&H$i4K#͓liLZ!6HWitPDB+yMzyz[zz;zx{z{x9ޱ 9^qJ:+׽;{GǽK|__oe/7W+M[[{oo˾;};||NN%H 5HB4vB݄ Z$M= Y ]@ G`fR0.GJWQDDIHHOrFr#d嘄gb\R|SPy\yisZV, FiB5h9o^|Fg3AzOltFП k/ 'b1|2qfiȕc@֊4ފ4" HC+Њ4"" VVihEZ[]Ϡ5wGΤ{>=tBp.`|K@-݃/K=t,KK.=t*>O{!O{SM"3A|= t} @NSҹbXZ5OMAQ-H/>16h)$xgYL'sd#"G  uTJ tz aB. `c6ę#t-ZkåuGT)Oqqrx:Sx: F] vJ^HcS\>eD\dF7M\֣[ztCE#|t>z~Vglar%p/2x$= 2pU@$= 5>@2x$= ]3=LL"+ǀhE&ZVdhE&oEL2"D+2ъLފ Gp\3m8QpޓYȱYX: Kga,,#\z:#x?h$>\>AtJ6dlll,+H 9qN$_Ar$_Ar$DF%FQ}jG\Ԟs @sy\^{.=^8=g[;mC&4W 1_!h71Ɍ=1R§E[z,_:|RKV\pX ڠ e ^J>P PCj(@.6$\.K2Pk(5a_a_!7ǁ8d".ƣ({5O|*AT^*~PyU?y?y? -U~RZAKy? 5~P9~PyU?X[.ϟOW͟?7{*7X'(u DcqQlcL65J)Tc1ݘao40fR̘c0ƃƟyC|acxְPgF]r&)faا>'nz =֯[1zKTf &Zgaq??{ׅz-zZ]3~:~}5Ѹ猵 埾^_xYB™G;}Cz'34zY`Xgqu DϹ3tz}gW[XPokr^ /~MP5A y&h5AM\_`k+^kBW3.pޭNO߭2Ì"z'NA;{`UF`kb>ś",&|kEdަZ?2w항FH 3ן__%&MHDF[gUɍ'Xiɴ* t ۺ/MHRF/x\p O^o2ImL&h[yZR^O/&+H y4$h2L",{(5'o`v\ cF=ީVNd ],׌v={K?mq[]&9ĥ[{K<2fL/<[*6OMڇtf+MhR)h#; h2~)37k%ԟ0hU?GCCΡhQcQzxb9VMq6|mH%`yzЗDzV)1X%_)P)]y\0rW(ro$r_dҜzߵbMv,Z)IΧO<_Oӂ3HH1XeBTP!,N˪}~.e٫acε/=3^l\\ZjK\J"زۘuʱms-Ym|8mk9-}I5ѣxLW2ٌ_WJ.]HرpbVu׆o>OlR(]Jnدx=2"p0 ˉV)OP^zm1!lJLeFְy".l>UX^M2j9YOG)|܌ c7c5OX, iv,s-7VV)Rc}{.* r zO2"J"T p,_ z!;üޱ,ב*76r{y|*$,JW q#]+0@*ѲjMEa]{^{rΞysqn_bc) &v{}b;q"?URJ\SEk=ivm_igTuZ]>g{[k ^߿W}e+l/ꯤi/Wr_X{Q55֥؄Ԇb ۊm$v;EB|b7I{H ؗH8TJqIDN8\85q $ZKW:k_$M9ix4J?8_Xd/yֿ߿<y#cEOKd$$ْLɶhȞ˒R!'ArT(ⱱ3z3^x w ]bIS`#s&hO',Z~=Nh@ڿ̢Nvg@@@u7u. 0l 6׃t%p'ߙ G>z!hfY[&ghIȽ, P.<. // ׅm.HD$D]D#н؄bg;= đhP$3RAqf[.׉MUϳo=VSӴꉶx+3S)L؞Şe՞<=x}Cži;%IRT,ՓRFR3N$uzK;,)W*&Hi,ɔط&н@M tл@@:2#Ѓ\@R!Q #EFI@iCn "IݤCdrk$PBn L L#3Ť<  /W)`}*0l^6&u`Szlo[76`[fvo;n`: ANp(f,p$ s

o5 :FQ=Inw`hRc|s;t$:wd"!^MƢFKkpxcO~ӏxz~x9O(O+xz_Kvx ^=@0zLc9Lo/!!J!=fZ QWBB=rfs豳HX& Vap@8,T߈H;tLdh+DD5 Vc0~խl7hhoh;'4+f<-#<]%4?<ӯyzL y=U,Ux*6isiOtOtOG4ԋKKd2Gz9W8?&,֏qx8UFZz2"TheЪК#R" b _b$ܣLVUJ)Te2]ܯTPf)RLcdgH-BOy !4C!y4Ij>-Ah~-ZD0bj隡EZyV;>¦7ewD|]yC٪"uo#QiRO٬F"ck "m6AM֊{ڽZvVOBKѮkWiZvHk5ѮӚjkhyT^UlQ^WKCnZ]zi?>(ҍwNf6n ZL]~R?It3F1r蝈HCk͵ ZKFvZkni-ZGVvYOMզiӵLm6[+ʴ9H:L2Z6Bؤ^Qc9bI3{"cY='c uȮ,ZmUoV۩-jGVzuZޥ Duz7=wQt{jz՛8߮REP3=~uj:'. a+/][ ם;~Jwl{RN˚eNo̡&S~^u,F> ]DyQK{yT+`N {ΠP${RAa;xTX.M«aG8HDžo]B Q#>XWO-ŶbGS_=H,39<j9q|}ߌ`M0L/eB0///k/uTjx x-l ^6-`{x+ t; {}`??8C 7oSwQ z@ Rٜ6 M8miNpڄ&6 M8miNpڄ&6 M8miNpڄ&6 M8miNpڄ&6 M8miNpڄ&6 M8miNpڄ&6 M8miNpڄ&6 M8miNpڄ&6 M8miNpڄ&6 ߝ>-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂguځv8iN;pځv8iN;pځv8iN;pځv8iN;pځv8iN;pځv8iN;pځv8iN;pځv8iN;pځv8iN;pځv~wNpڅ.v ]8iNpڅ.v ]8iNpڅ.v ]8iNpڅ.v ]8iNpڅ.v ]8iNpڅ.v ]8iNpڅ.v ]8iNpڅ.v ]8iNpڅ.v ]8iNpڅo1s6aO0J5`"/e00P 0 ^//k` x%X l^^ 6`KF5lvo;4 `OD(m4b GI p[8z!v@wlN[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂӿyrچ6 m8miNpچ6 m8miNpچ6 m8miNpچ6 m8miNpچ6 m8miNpچ6 m8miNpچ6 m8miNpچ6 m8miNpچ6 m8miNpچ6eήg꫑fT 1YLd5"?R헪ɷTp]Pmtj -sML!~Liۄi't.{TX!K{z$ְ'L" IHhP9Ic@3xW`!\yY_b.>ᓉ| >gXH\k6Dsys1J8#V$L/柗򴌧sYRcQ=bݢ*ŢyiId$9Qb=+1{^HB9q̐ìލJcSsp82%dd6/!QB6JF ٴ5& iAף#BzNvFxmmi$^n:&L9dNNQl|>>~~YRz -bOtEHRgITE3&=ζq2ge8p8+qV{W`!\yY_&"5MD>j㬌ge8puXfz5aXm0^2Z8X ge8+qVvZadOe۳ Q6ۻ 7<-a+cSNǀsA]]6? :J|":w36 T*PSj@M5U"}?a70(8$LχaGj%G0G#mHҳ\cr?Ī:zx.$wOYqi4sr w=]]ycw=ۑ8ܙd~woq9(ӗ)j:qZ%$&|("1ػ{'5i{w w?i~7u8 p8jr\~r\aaXŒDZ%,AqD%0B-Z!:j!BŒ! 2$?`5/r۟/U6)x_W݃#aO[߃_2xvUi-Z>m~&_Fv6~y|>G7'\&IYk~M&|2ǀ?#`iOˉOK]`O';=Xo=X?iO{~ڃW3QO?H{-9JHOP+_gwǤwF:HW\[=\~}#Uı Xq8VA̴8V'X=į~3 ogN}]͟ s wwpmgp.Ok-?loG`@}k\UWp@:%ҿHN:+O9g\ժ@p6-tk?k?K5,?+f4o~7_]ULBЂpC!AFC*Ƥ <C@9Q/$0ۄe_| k73J<[{Yf6@m#ܑ-o5]k(_P`W + STReί?nI'z43|?@w0/*Cjyt"O>2Ŀb Dfyd YE֑MdC#9C.+<?P%Q#jC=(h@:mF[v 3[#8:΢ 2n[)z^&"L }3t1tA%t]G7mt=@ @[ B(pČ ` bFkڱ.alǦYl[ְ l C;αKId"T%eOʰyl [ֱMl#;.+Vd2Xp)3l2BV-5ʚevYG/ Fd)٬lA,[mȶd;}١Xv*;]ʮewr<_^$19!!T^)˛-P@v$;.dW[9$ϓa9"(=rF3 yN(o]y|P>,˧|M!ߒc\~))$|EBR §+REFQhR(nEb@\*S@O1~5~(EJSJJI+J2L(KeI٢lSv(s rB9S.*W/7ʷwPZYlT6+[.e_9V(ǕSYrYPn)wCTyT^+ OR#"hA0 JJ' ^bxN F b#%xMo;=H\U*#z~b&Fqb%eb b8$S✸$;D*RIUPQ*ZPTaUBUTըUMUCխU ^FUi՜jQzzzUQUSW}P}TݨչuD-WzER2լjAZSmT;}աXu:W]Uwj:_]15ԴڡꄺT]Q׫-6u[ݫP?WP'9zERJZ~~~~Qkr5bMFQkƥ h\S4hAe}X}>W_w&_Sj0 4ơišTSk4-6M[ӫ<׼Ќj&4Ӛ9͢fERJZyyyyܓdYLrRMI "dLdYK6|J!LsGJ|IIGYJV5d=DmdMs9JNH/Wkr|C%ߑGj \KF)mJ[m>>>vjjϴCZN;hKULKiiCӆ mR[6i[mmW;}}NhsEvWFVN^AQ{r*䔚SE(ʩ*jQ'T'꣞QCGQ 5O-Q:ImS{uD@eT%UCSMT FuPT/5@=^P5MQ zEv7[@}n{]@W+uj^gѹt]Tҕt#c]OL7tcI݌n^[խ6uۺ=݁Hw;]tzH/tݺ^݀nT7u+W׺][;{Gݍ^/KrZ[.}@է*}AHXDߩ?9~R?/WM~O?ҟ+2 1`4 L?/W/7w!P`(6Ao\!jH UZCቡgxf2p1äa0oX2 mÞpd81. W[#d3a#bčh=F3 cv o o   7{cXl,1ʍjh1cԘ2#cc8dcIq޸d\57=xb<3^&Ȕg*4&ĄHd3yL5eLjSlj5L=~ Tf1ޛrMbSInR&e Te55:MOM}g!g3MfL%Ӫiݴi6LGәte!:.aq Fn.azYz^h5-Q:EUt-@?ON)G?h'z^Wuzަ> 5CbOg e}þe߱S~msH"ԁ9v$JGhq9:ݎ^Tf: G; Fq0֑qT8uFGr8aLjc1u,8k ǖcDZ8t;NKǵ)q;R'$v:>gؙp:+5zgpv;{Qs9\ʜt68YgYv9Vgw:#qsֹ\v97[yw_w'Sz0 R_Wk|n_o7M|K+k߮w%~_-~?Sr?AeKߵ/R?';>؟+5zw{Q?____woo7@n P( >` @4 @gi/,0cL`* `"@# @i2P4Zm@w70xx LsJeUu`7&6.>!1p <ꃖ+F`y*Xl> >> vςCA.8 Kzp3 @eD4X -`G;>'bp%2*:|||| 3LS̔0rF bLI1LS40y1Ϙ!cƘIfgUfd=9bN3悹bnCTƴ1L7 0ϙ(3L3s"¼d^1] yǼg>0>*JB:YBP  B塪Pm!(8$z = Xh24-VCvh/t: Bm p a2lBth.Z ބކޅއ>>nBpA8\a}vh8.Wk G'p_Yx(̅“|x)^o{Q$|_o#P$/R#HcDD*"PYUux7&6.>!1|F "ő<#+D#Hy*Ri<<D>Fn"hA8ZGQ}uEh4-VEk G'h_Yt(EǢљ|t)]nF{уQ$z^EocP,/VcH 1cĘ*bձXc9kuzbpl$6BeF|+ߏƏe:~ǟ;O}g8Ogj|=ߎGY"~M@DaN O_wI&?Sf 2tƑe™D4Sg2-LG;ӛ<ϼȌf&2pP{%|?jpP{ #P{#P{j0B~(o#Gj|&0+#,̺JBV GX#aR= lj0 GX aP{HNj¼+*}pP= ,=-Ta%pN G8#2 GB=jpP{+jO=5BP{k#,̛N=*zP{ltj¼.p#,pP{Do#s GBjP{D)1H=b9BG3 Gs( EAѠhP4( EAѠhP4( EAѠhP4( EAѠhP4( EAѠhP4( EAѠhP4( EAѠhP4( EAѠhP4( E? b_@k 5} ľb_@k 5} ľb_@k 5} ľ4 HHx~E>93癏<)Y|緑/x~,By#_ ׈y!R³AyCdBGgBG|_~  (| b @P H5$ hZmv@' 0`0 ,,`wX}Z)`=63F?lwA9s?)fe@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@91ӿ7Y,td: 2΂LgA Y,td: 2΂LgA Y,td: 2΂LgA Y,td: 2΂LgA Y,td: 2΂LgA Y,td: 2΂LgA Y,td: 2΂LgA Yec~.Ƙv:sә33g<*jZkZVUZkZkn笵jEDDDDDDDDDT䊈\U5_u"s]W_/p 8N_/p 8N${fifififififififififififififififififififififififififififififififififififififNN4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 N4 NN!$RK1V>sTi2CzO[ی`13yö?:n1S|''u?ynnU!$;g!~*?}|ohw%YhRTQ+J4Eb Dkz mE;nDG>S :qS_E7mt=DOs E'+gܐ5)0  ( %rAV h :}ܲyp>*^`PZ eJA^$ht}A`\0%  `Op(8 {;2l,1#1#f,/k&G)~__xފwx>>K*o{!~W-~?/#erE".򈂢PT"*UjE fQS# FE"V4+Z-DѾHt*]DDbDg?*X@ D#qєhF4/Z6Dۢ=ѡDt.݊EOѻ#gsŸb.⸸P\".Wk fqS#GbV<+^/ěH|*_įD•dJ>KXh%fSⓄ%y"@!'sV|/~%I$[+%%vG%IJR+i4K$IdH2*YɂdY&ٔH%GSɅZU &y"R4SqdKRT+5KR4,͓IKjiQ"mG ${ɓE.H3\).%(K=Ҡ4.-H˥UZiY&HCQ鄔J5tG/=J/ү7 qe XiefS擅ey"YBV-5Zd.Yl@6,MʦY,W)32,( e%rYV k:e=~ِlT6!ceٲlM)ۑˎd ٵAMJ $J %̄a"("J #"zb#&ibX$Vub%C8QHDQK4DI1JL,1K,IqJ\WF9W)x Vn;>yX'/+:yE.1|Z>'_[]X~&g@^+o7y|H>*Y|Y&ߔGSZU &U "SF+ ¬p*|"OQ(UT(uFE]ѥU (cIŴbNXQ+űLqQ)ϊ7eR(1)P )F V1XP,+žHqP\+*JDUf*JT)V*ZYTaeHYPV+딍eK٫P+ǔirQ\Wn)wcRyS>*oOQa*Jҫ*JE|@T(GSZU|U!**󣮡*JҪ*ʧ TERUZUjTU]^ՀjX5TMTպjK:PT՝QzSy,uSK*^mUSjZU立eJu^ݤnE Tת7իQsՙjU VmV;>uX.R+:uEݮR1zZ=^T[]X}TߨԏgB,2H)"Hd1YFV5d=Dd7G#89$DI1 t>2LEd)YAVud#B]d/9@c$9MΑ NnyL yG>&Edir4FQiК&_S)Tjj4&MCӭ jF4)͌f^Ylh5{HƩišCHn@7MusE݊n]ugKݍN{ֽS<}>Gz^)=2}F_oҷ;>~D?KU~[?ԟW[I7p lC7`4 CG +u~W?֟/7;YfH1 YfTj !j7 Cj0t øa0c7,V mÞpb87\n 'Ë1fFHIh7zAcXh,1c3R`4 gÛ13fsQjTF2ƨ1Xl,3Vk&cm3G)q޸d\5n{Cxe5/wǔa6pa"MF1MqSTn2՚Lͦ6So2&ϔe1a&Ieқ&D|STi1՛LS4h1L3yӒiմa6M'sӕtoz2s9ۜk̈́4v4ͅs\kn07̝sygؙ,r:+:gr:1qf8NI8IiwzAgY,q;gq; 'u.8kMsyuDR5zQnugn-v+Ztaw]pW܍wpܓi{ѽ^wowc}s?oϓA =~{=fݳ{ͽqﻏܧ A<\OA=b£=Ny< Oi{<ϰg3y=+uϖgs9y.=7;ϣMY/zU^ꥼ4RY,{<Ͼs\{z<<^fz^+*Zao[V{뼍o{Ǽiwѻ]nywc{>zoϗa>O>G|_W#S}!>/>O> |ER_Wk}]^߀o7M|ߺo˷;|ߝ{y,K*oS~eJow}ARG\Gb¯N o?+u?/7;F<:Ρ1ZJh=m)t>]Lѕt ]O7ѭtMу=NO3_!N(#pp,8+Vp7x</7c9J BYT!}Bt(BP})uBxh*4-VC^0t:]nCK= gùaB|9ߌGEM,=%wXzJ,=%KXz9}bN,=|4%(ʼn/I,=|ibK_XzW%!oJ,=|sb[KߖXzw$+&/$/%~^b$~ab%/'~IbJb&&~YbZb''~Eb4+K7K*3KK&^K$kb#xK,=#҃!Xz҃&XzғL0`2d &L&L0`2d &L&L0`2d &L&L0`2d &L&L0`2d &L&L0`2d &L&L0`2d &L&L0`2d &L&L0`2dH#RT H҈ Hҋ 2L#s"#[.r#g%r!3)S֧OI!#ǟW~K0v#? }?AxO?$wx 1 >8%|}^~J||rrrrrIHNMST2՘jOS㩅%U ͩm=CllBrZfN~QiEuԇodr#(8Z8aNSʩTs8N; s8igYlqv9csù^?8c OC? 8QρN8 9O 8 k o{N$:v)NtKgЙtMйtOЅt]LХt]NWЕt]Mеt]O7ЍtLЭtNwНtMнtOЃ=LKڷmPK4H=Bc8=AOS4=Cs<@/Ka#dFIl$FIl$FIl$FIl$FIl$FIl$FIl$[Il$Q6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6Rب6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6:Ni7B{T:NtIgtKt]Ht ]Jt]IWt ]KtH7t JtIwtK=HômaM QO4#(=F$=EO3,=G "D6RH5mF )lF )lF )lF )lF )lF )lF  F ~}`#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#+nHc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc=>N$:v)NtKgЙtMйtOЅt]LХt]NWЕt]Mеt]O7ЍtLЭtNwНtMнtOЃ=LK*}PK4H=Bc8=AOS4=Cs<@/Ka#tFilFilFilFilFilFilFil[ilQ62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62بv 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 6:Ni7B{T:NtIgtKt]Ht ]Jt]IWt ]KtH7t JtIwtK=Hô*iֶQO4#(=F$=EO3,=G "D624mdFldFldFldFldFldFldFݰF;Y;e ]Jq^[_+W1kZy=yLЭth2uv鞮QyOpA(ߎvmG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbGmbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbǾ=>N$:v)NtKgЙtMйtOЅt]LХt]NWЕt]Mеt]O7ЍtLЭtNwНtMнtOЃ=LK*ڷ4H=Bc8=AOS4=Cs<@/KaGmӎ/WF-vbG-vbG-vbG-vbG-vbGvbG߫}`#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#ka#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra=>N$:v)NtKgЙtMйtOЅt]LХt]NWЕt]Mеt]O7ЍtLЭtNwНtMнtOЃ=LK*jiߖ4H=Bc8=AOS4=Cs<@/Ka#\F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l 9l䰑Q6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6بR<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6:Ni7B{T:NtIgtKt]Ht ]Jt]IWt ]KtH7t JtIwtK=Hô*:ڷ4#(=F$=EO3,=G "D67m䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑FF~}`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`kth(`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`=>N$:v)NtKgЙtMйtOЅt]LХt]NWЕt]Mеt]O7ЍtLЭtNwНtMнtOЃ=LK*jH=Bc8=AOS4=Cs<@/KaBFlQFlQFlQFlQFlQFlQFllQQ6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6ب:Ǧ"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6:Ni7B{T:NtIgtKt]Ht ]Jt]IWt ]KtH7t JtIwtK=Hô*:i}"#(=F$=EO3,=G "D6(6mQFElQFElQFElQFElQFElQFElQFeQF~}`6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(arj(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a=>N$:v)NtKgЙtMйtOЅt]LХt]NWЕt]Mеt]O7ЍtLЭtNwНtMнtOЃ=LK*ji9Bc8=AOS4=Cs<@/KFi6J(a6J(a6J(a6J(a6J(a6J(a6J؈m6J(?kMqES4vGWm3[G]<%1'K]cc_:|cl˟1+w@1s6lJ b~愎mˎ%o cF/I=|Yag;&׻(Z:6cb~}]I {kO~]=9sl竝u|c;靳c8-+p^CgJVFTnMgleWwWY[9Õ|WW>Phsy]|U:_Lի)*WsS?%ZsC-?S[otݐW#Y[nZF埴H||u]jot< ݶʈ#Js5751XG/L]I+GHF'GQ Xmy2^Zk5؃3k3sgf7bd:E^ro,k7*n)qU.FVܖ{GW{{r+d O}x0Nj|_*jj"b|nwѝSN+,-fsŹK+|4k5늼&͹ۊm;|{=}|.eQB"E(Bn*-GssOrgrr/r/r(Jܯ)^|=7r,rY|3[ŷr]|;nܷsW|/sP GŏrOǹXcϊq7;f}W>,}W>gyl*}}<]y W}5Lt=c?=yh}T^Uyn <zk<_W.ϣo̯yS|:ϟ?#y~X?'/ż kȢ-\_7;+Vߟ}W7W7jVo~4kV?U_̫P%bW+~3O=?wG|׋O4pQq{jqykP1qxi3U.?ߠߤoѷӿ<7VG~~~%k#W Ch۔Wz' r*WwwCwH5e~HBi6tNѧ3nb}gme]w׶S۝{o`}5`->T;p\#7r}5ڛoڷr?QNQAU_s9:y|W'_U'^)'IbSD*W)ë?<_1V~C/o>} UxL<.O'sb kA߳YݣgWU3`>kow߇) ֖Wtex^;yuWsC^Kn+͍xRxIo4oƧ+ EFWkt}D:Nt SgEE埪OU_NίQf՟ hh7š=f_|mځ y|b  !CF yl!9׷H󭯵l]ٺC\(\f وu\LѼ )!L &tC'VKׄ ]jB PhQ~0@Bzbκ U\6b8KB,!+l!.r\AtbI6q4&dJDbJzZX,]*FZ:]論гG-9e~$te,]m飢Yz-},Nh1/}^o_/K$oz{ ۣ/ĚfzfzΪ%Fsᆥ/η%1K];nB W<]mk+Hu^v)Ѥ# Yu&~ KK*K_Iz.]3{M^#Rvg2",#d# {H 9JN*rܠh M]h CCGt2ͧEt!]FWF9AzU*$@bY+&8܈_I)f[;pLM-cY&5cekeҪ:') ]fi_?VhiWR,_,߬=YAQV`y3 ք.tk%KX::,Z7XNcCX疎+tE1&VdM:4㌵|Ah+fbk.ʛߴt +R8dY^疵:8oy@v}rB:'>^@{[mP,ٽf7'mB[u!YI\hB' ={:.sǝlv_{{7 "qxrYGղv8o;9NԚMWE[k _])ʭt?Әfe6H -^7%yXu#{$^Q+!`2{NC\N?(t ['ufz{DC#'mމwOhK/ZY_e*oVacޣdk}~<ɶuy=ޏ|,]OY"bEOX2vRS"V\qZļ3BxVs"UǷ:^daD(ES/ /,rŖMĔDLX~B@|Z`'1 7q$*GD&xdKw=-AK)zC_Å.vϻ)2YfkySnZaOh8g -⯾Zڊ(N'MTmcJNzn;Nz<(Q߽ss KDB[b^v/Ucs\˖##Mh8̕}>1fI@dz[ct)X ТoBz{עN7sM&P,u.]S]m7(EtX[{_i"/;kݱ`GV6mu6w 1E1E TNTйB(+FhuNzJ=uD _\NНήN}:¯ =n&#q5YO uMsfr;$=~=b~m?=fGGBo>s?6zwlLȱ٧9's nUnXߩNݱxE&vA=[79mk>3gy#{{ͮamv^`Ժ .td=fϵmv2lv=f/u?2m6w"f6{~E?ZbتvՖDo{(6{h7m`6w 6;f~w6{wWcmv+`lZ;>"m/%]ڵ7v?=fٹ6{^l-6{.gmvTف6;f'nslxoU6{a_mE}^١6ͶDzdf{ߜ @ÙNkl"%x-rqHMsqҝփuՖ\9Q TWTv5M[$!kI/!둴2 Ӕ::_r󎄨 WFߖ!WnIhz]sG™%fMÛݖV]!)d'Ec#f5>[K]̼-"'ݖBV+Ŧl[kJ-ZGu5;j{ԍh{Z}b$$imR v0mR;$;~te^CDc'Led|i7!nfC%JNcŔhSRp ϴq(Yޛzoӥ/ZY/3_3 oM)Ӕҁ^Ҵ搮iGҎ 2h/jV*h*9&OԌ̌c Ǚep*28}ptpI\Μz̒#I~ϣŏ4bf?yL113>oB_'FNL:1}bWN1q#OO:9)pRIm't/ }a ᄚ-ם w[7xzr9 'zRK+dNɝj)\M05oyy-[}4ôVN|Ztuz˧ទ3c~Y)Lxf,mVĪ:+*#FuXoj>'unEZ; b F68ܩG?ĊF )F|"W[ߎbNJyFU+/^=5bYQn+~;I`'ցˁF]3O'?w'F?uW)[qǜJ1صE\]d-$$!PVb]]@Q뉳jݘ*"wMV]s+~qo2ެ, UDLL1vY%47"NmflFG5J7e l}S#',%b|6ɣ313kʛw2XΖ'2ekǙ=3ůGt\xj$>:jZb{tiDdo؛Zzq k. R#Zb[3vx<-[X.njfO1sj-[ȴEdRi'1s-2߉} F_y/ž:]?RK v=wbqw "sdv2n=thctL<$ A-2nM[33 h{q2Pz3G_Jt[C$o377.Y-(xcu.Cy9hލP,jKm "?#Ѽw )6.*H4(6wNf;e =myC]vv6psExs`HӚ}tvhm?h`Yj_#@ڒdigWÉ$BF"J59l EJr&T z|prF{!ڇ%'iN*hBatH9Mǐt1K n NC"t mL}4 ߫ K`iĞbOi6a&0Ib":-foBN`74}J;Icy]b&v]OЯ8~<OdO擙̧)LLż9FO'L򯙋?P~gMx5Y+!RԜ%IK iTKlYI?HؿR[!tt8G8puʎ8N:N1Y92;8D#̇y<[~E^Gȯɯ'eIyߖ1ZyN$'_T[;>C^>g?GL. c/5\_o QOQhFi$}$#JwAǔ@~RIW)e2W(Y0~Z*ii~QyF/)L2K)$PyYybIU(KeLj,WޔU*)XY|&(_+K͕JF)WH*WR_冢Kj36WGji&HCDiE_z\MRj/5UQ}~ji:H͐FHϪ#ԧ1s?Ss\i4QSKuZ$MQćJ}$IZ8W}4u00mpHiOO9ș%.}qH#OK8>v>#mru6;'8'H:sdT3gK6NyyT<欐M};}wc>+4E uZj=?_m죍 $9@r m6Sfksq5͗h "mR[;hڇF9IDL}}!־Ծh_i;h%T;"?iõeIwF]nȓ."Ou1$,p.< \PU!/tEb]\宩i l?w\^׺^s-]oސ׹zK^z? k,w]>HdM/}yi3#6}? gkZPsHnCPiWZHCIʛ<Q}݅bz)si=ېO8^?xIu~$!-941 ϼ'F=}M&ș A~<!y0L D#A" ^S 3,Pf9 $:&I JHg:A î_#A fmmmmI Қ\xнpUUOϑGM?;ZGIۧb(iS^;v^?A{^>Gz^.r7z^ڠ6%z<V3OP%}4- ~ Ӎ>C_mb}3Z~$7#{}6f *Fi=G6Dqi@9z;pbWDIW|0`6 ˠkn}`?8CGϺN_88N)Pw5Pʯ? z%Q$ς /KAJ:JaP ~GO gpV΁JpT ".; 0&ݎ}(=@* gt GP0LRl =D0 {2t40 ̃ x k`x+ k!?#{`RQ=RG Hm{˕JpsEp eo {TC_=RG(\̅foXHKB񶚤3rxf9<Y,g3}VOji5xQ<S TcIxM9^S)הk5rxM9^S)NVc'rb9vV]+nUcSؕrF9V^U`kUX*h5V+ZU,*Vc˱XrĖkNr|?rd!ds}+1qs}' ~$ȓ1ȓ1ȓ1ȓ1ȓ1ȓ1ȓ1ȓ1ȓ1ȓ1ȕȕ8%8%8%8qf=8Yάgփ|3[3[3[3[3&7pNszM`4GBB GAAAAAAAAAAAYYYY,̕̕U T T K% 88  +%y|90///w gs؁^ϟNN"x{~7&?L+G2:9W+m!MB۹hڦm =BdqFèY̞@y7Ey);9(].֬yO(y5o_?,# 1p,# 1p,# G@h9lBKZ҅.t -]hBKZ6Cvh -ۙ-5RCK -5RCK -5D23y)\ V+< i`H'Nݜ9qws}ʉ6ms\?A[8֠ h ځx${AtDtHd'xT}A?,K2 VJ6Xj>XւA1`>mmWz;7[N?Lw.O^7,| K&-߃]`7~K{>~@0 L?!o\?-_` ؈_C)as~Bi "A1% h b]~X4˔=:맕.i%'T$2P | hFV1oV1oV1o AU_U_M@S 0xܧVAgK=`eC?Po$xϣ%0Ly`޿jL}p<  0WFa'H? zbu(Vbu(Vbu(Vbu(ZPP І 4  €wHA hXphām@[ă  :$Π t@x$ =xޠ `~i`H`0 t 40`& l :_F_ `!x ,%K2 VJ6Xd@րoP k)b-F +| vow`'=d#Jg"4@<ѿ  OBē$D< OBē$D< OBē$D<(u#l`~Al`+l_k@4i/G4GCt_G! _H Syg7f4[2E~e1(-ׁ(( ?OQ|sq e`/M>Ʒo;~ԯ c|m"Wkk7o,*j~J/( ?hBkJpp @4hF4n.=@U]K4_ 8 @.F 8  B@(n"Ʃb*Ʃbj hXp[7Z+ph 7oED?CqWR*!7"ّ|B.c%.U/6ho/bܷ.}q;u kWt!}7 V(nGng(+P^Ery`>x,57,`x oUzR$#f&oDs.{AAz3 Cs ƀ`<(=s`n̓y07<s`n̓y07<s`n̓y07<s`n̓y|S㾽A0P??>>3mLxȃvYvzԜ PJ)m-P.`y(\*v(BC"m %i0&4L'$L)xd+=眗ᄒKM, 7a)F܌oI17&ƤޘzcRoLI1/&ŤbR_LI}H U;{~r%5S95[~Wݜͩݜͩݜd%k/Y{K^d%k/Y{K^d%k/Y{K^d%k/Y{K^W{%a_ojD=Dns n7{{oR$D>7zCo2-ʴ(ӢL2-ʴ(ӢL2-ʴ(ӢL2-ʴ(ӢL2-ʴ(ӢL2-ʴ(ӢL2-ʴ(ӢL2-ʴ(ӢL2/FlXCt6_TP"9offF$WŻͼ̻ͼ̻͢jUE(FQ5QTjUE(FQ5QTjUE(FQ5QTjUE(FQ5QTjTǗLCEV}UmoX[uʽiOxZ"&6ׅP[Mg'b7r4rz7-w|0/-cIm|<)xNi{.Wq9su|Wj\yqz,Ģpp2 +- b'9E_]#agBZc7a)ccewG݉p7'd2^N1PZL $D u8 p4ps\OSEK\¥ _0WJ \q ZuX“T۩Z0"nd<{.TPl){G*W0e;LSÔ0e;LW_~W_~W_~W_~W_~W_~OPԟ'?A \.W˕re\.W˕reV[nV[nV[nV[nV[nV[nE]'7èG]E&7L>Zy$ Ԩ//C0^xQt.Хzox5GMG}~ c?1~ c?1~ c?1@ ,P@ ,P!!!!!!!!Q y9PCy9PCy9PCy9PCy9PCy9'WnSmr/оqh\qh\qh\qh\qh\qh\q5Ƃ b, Ƃ b, Ƃ b, Ƃ b,|\ob,~fdڭ^S1_gFu2Um)V^SiǪD42n78^ 2{ػ+js{|>{17g²؁9g;?ro#M@jgʱw Sχ&^tͮ/NډhFlP̸e8&H< ZL N焾a8r;U BK o^vZScnL-ݞR{@1߿?S:ϥ=~ULVϵa<`}C7㡷P;3tXtXw焖:3}u}'݋H(F}H,*TUUP5C.jUY(5G)9JQJRKT,QD! f)E. f)E 3R0 f)8D! Q0C,7D!ꕨWJ+QDJ(F)5JQJRjR()J*QDaql}9A =J]ry6?6ݟ˳aS&|/ _c©S>IGdEr/묞?㗄9񆰡K]y^us0[}n߸O-]>D8Ǟ m>U'kd zOo->r֖ φ->O=Gk3YNՓ5|:=s.M2k'7ɬYƼ[eU)õ3{dGf&3^Ɋb/#*2"#*25P s{8k?f=5Vw_Iltg.u}(Q?GSxP=Tk|bw5M%|hX>RpWӭvޮw]7lUXK|r };TWceߘIIpY|&78=̋w,=? 'v\9WQwcjcj K(((LQ{ԞvP}ꯏTʏQlIjNOyM/[Y|0. ՠz|&PK25͉NJ&JQٸ>o>o>or*MJSUďe~اj=jD>&aq{Xb_FeDo[F2bc9W#zȔ;.q#] m³& x1<" ƶy]ne؎t,ƫqݍ>߹5~ DKeK:^dސk¼0F7œ~Np#p$1zlX^lo% ~N)㧺3_gzGxg~>GWe5זrm)ז/o{>? ߊGpA1Q׏Kpܡ]BĿ2+R 55W K%KeRY4¿7Lݎap?t}(M`e%nvcqauHU]dQ.KnLGVj='== h&_f칗Z ۰7^BKUE]i{]F{(99!S S0%S> cDEϕ!u~~r.%t] uS]|]b~tg TXW|88 G{g|sށqNS.yNՍn1u߉fuv:E:E:ERꢺ|x? Sukt_LM/*~^jת-ܒ}F6ج 7/T֗UZsyA{UvU$,NoRC2WYXbkR_yIS`R7ܷq+n zީ6fftNSm>f7[6SKjyZNO'vО.W&yR^+\-v˵rkPn ʫjd/jSpcvmvNR~ ʏ& Ϛ^ C\nޭwˇKVʉ_ܻ(Yfn{vxn]elV'9EgmY[LnCu6{{t6Mlt6t6MGbY],et]E`;t*;eu՝ZtݩEwڡ+eu졮Ԣeun;unK9Yw٥AvݺEЭ3t ݜjT+Zu]:@7Z9ժ9Y巩6ߦT|oS-EgU{VgU{jϪn.nUޭʻUy3:W0ʪ+Tr\E=T>4_Ӫ%>QUPMITq|,_΋dyEWdrY\6:hV}''M4}di[e1|]Ǝ`GwlG9 lPdâj"kYkVbUh ZѠ Z~o5V3h5-VQ=FSɝvSΝr4@ܭZݭnn%wk(-FݵDQw.sΝsŨܽ9wϹ{Wχ9g]_q1w˞qtƻsDT+^|T=qڡOzT41("OST;ͩW2gV; Î1cro8l]φu+ɿu_rŹڷuΐ ^WשZ+oշb٭+(-T\"2*"=*2b%]b3XӼ#.9NgbFܻ2=NNmDI9!!+g;*p;;;;i;;;UUIםV D1I@7шGѩa*擢hS)0of6Wxy;]N7n7Wvy3z\Q4Wnvq۸bl探-o(i4vhh{sT#qj7)qz:?T<_wXя~LcD>6uka'!:lLdcѻm+}KoO]pmKs[uѶD.ږ~qf򷀓'uv{]o?GSD^ΈihZ*5=AiTx?O#rudu4 ZA͠ft3h4 Z&ASLњ0Q (Mj~ݱ퀻n/E{5[kCo@^_H4x˥uK{S&]ZνWwLRjTuT/Ez)K^jRF/%z)K^*R ;_b'v1nv1n7Vnx*ʼX^5YV3pXeI2/.WaOSǿ-. D᫘;&0= :,?xq.>AS> Q| 'ħ0 Ƨ7[ߡ!:n̔g/< /ŰaflA3^ >0~uoӎL;*,fʞfʞfʞv wN+xÝ5gC2v@h:<E0F0 'c~az[WԪZ^ky찥\?/x尶 |,&nwjiTKZH=wוk]jPKZ:ujmZ[֩-jmK^g_ϑs9>GωEa<+|n݌o|p+nÓ;_/,".=]U]U]U_&%\]%\]%S:xGw<1O q?jZ:#ع]?_yO3792\iftZsۧ_q64燶xk4-np**,ݵr5ȩqz,",77F<sSEOݎvt]`؉n z%}^xڑC/cN%beё5qȭp4NYan{]yL=en͇|eX,?|c1F.,\y t|=)xJ-RiTڒګkMX;qrQNմ~װrNܣrQ9TΪڡhFmO-~L~,f8`ӭuN43na71cJH\%%čP7 uP7 uP7 u2&ݸ>܏x VOaG2:<܀A$m߂NNu&3iILZg:֙Τu&3iIkLZc֘Ƥ5&1@I!EF՟b tnRYJ7WnOQ!kȚ& kȚ& kȚ::&I oț&I oț&I o뒗뒗뒗G_ Ũsp\|U`^hQQQQQMg馳tY,tnMiB7M 4&tӄnMnn}۾mvw;V1<'tEo[Eo[Eo[EjjYvc/ B0uGuGuGuGuGuB]}PW_hϘ3f>cϘ3f>cϘ3f>cϘ3f>cϘ3f>cϘ3f>cϘ3f>cϘ3f>cϘ3f>cϘ3f>3S>?n'jۉDvv;QNn'jۉDvv;QNn'jۉDvv;QNn'jwH;K<,O;K<,vH;K%)/G)-؊W],eKRTUO^nͶ͞; K`w{ۮ v>fg,,>/?7Eş<朾=:.]Mӝ1{~(eKRv].eKRv].eKRvI:oΛ&I:oΛ&I:oΛ&I:?P YvYvY]i箴sW.& h.& h.& hœY4g͙EsfќY4g͙EsfќY4g͙EsfќYZ eA5ag^hg^hgng/q8e2SB)!Ϛ'N Y;v˧Y4kϲ~qŚSCzSFd0dyh a !u:ydZ3b~h0M4&2M\e<1I$k~8odYs俕if !mhsof?OXAbXA-+|,XB1| Ƿ-|| Bꇅ R?ge\XMFa52@~XK/c- Zcuauauauauauauauauauauauauauauauauau幇!-7\Cܵz ZZZ{'yF i~ lQl,(m6oEJ,v^;\.gaٝ$6 ]ayX|ayX|ayX|ayX|ayX|ayX|ayX|Wk*crKγۭ+Ur[.T'>r]d_OL{ 0ˆUQXa5[ki#$>z|P_=(ںZʺnr i`FPXfQ6{.n>mj?מ'!=G_eSMˊմj k:B )DA A:hI1=YAx ЇSlg[J/lapA@ d& 4٠hZ֠ h ځ:Π 8GZ?`(w7p/#BQx<OQz:TOV\p~O= C-ΨgdF;+$̈mڱ';2ENk'׺E((EI!G;!75M, t$( y:7'>tp+ A`0a^&*x LI 0 otah }0|>'S0GOy`|E{P' HXOdrl:AW;(r09팼DDhODhO &7[]0`=쑯 C[00R"F l[u 4  Z"(OOvnwy0Nv&rܪ']t{^Pg _Wq7|1pcJJg||&gOO2b >Po8 {%-_]m]-\ \cؿ>cؿ>cؿ>cؿ>cث%ث%ث>6j;$Ji7KY̧hlؔs)zCu7 ܡYzi)m@[pRQ*cSh{\f Js]c,O=S΢¯c1oiaXs\^8 {],܏SD?n̵*I:q_q6+]ʚkOy2;3XOEdLWV˭Ğj9rbQrib3vBV8YK ֚v/ݐqk/9ԬM؄rWK"!ɕ0 b x ҩ4/ Ҧi؁bg~gKnhn 0 C0p{ocnBZ #Zޟ>\dZIkJ`_Bi~cW*}^f?%Gڣ(NX2BGanr(CZ5hԴ.O侌8^?^\}|qeK$'Rg2QR(lYbCJ즛)[\F;۔#eq8S××####Sgw]|d8yz4VpV/p=m%>KGRqM{3>4VgiԻ,oJˤ0%nJDQJ[jE9;^% ̕҂Q$s 9GDk,cV,SdX ;@(;ax.CKar+8^s3ܪCЋñw͌-OgeHa!%.L9Ź=3 LK8_ tJq Xdiv$;voGiwå1Zd/ u19V#+ȑCߓ:W͛ː{9W\y .hrOs+.0^)[u+ ML)НEfnm߂Vz q-! (ݥdŕi!z\na3 WO0 R/GKVEȴr eYR9-،ů*RJR4%#b rkrd8 HdXF^D-fl }9zK`'hYQZJ[Di[BQgZ8{w"?UT+J܆vBQwa(Nx.HE" zEReHl81i͸{9i=NwJ,,"_sr(m?fhE5p=:rމkօ ʦږc' eqjF9԰5e& H|')QR5J\+C4ͥ5er%eF>|\+Cm'#i:יpڞN)PZ kS ?h uZG%s+ڛ{ܜrsh~~KjmޖޑN\.V06M)7f zgY%cي6&MҴz;О4Hӑ4IӅ-'ksBǶ!Gr!g=MnC,dH FElT?'z6N(MIQCuY? fo%^_ סJ?I+ {+rtТ}/f3fmWo ooII{8-a3RXvyb Vk u a^QKXP4Q 1X3jBY-朷пGґ+ҙ^jM|ҵ%M;ОHNL.hMʵD`favĪ=gX{ Mz1V/uehM-uG/Ѿڢd܃ͥԧR%32uFkAAA$J(\OUm$ѩ՗K1Yu`.Ŝ xBmOL=Awj5~ WcE ȝП"4s r0AUU?ut`I#ͪZD7FQ3 fVDf=}4uɝJWP_/ &}J ykU~_G??c_hG5ۃܴLgB|>+ ?:mxkq0nM__knPC {UN1Ӡܓ~A|Կ*2hckv{ b[%|9/ZkT%aͻ\`K̜ z\n?3t^"yPfH*aZM.SV%<*OJ-fzUh>7<S!~wak{ YMQ%[șXBJ._Q{| Qҽ٩7,NUVr# ="#u4wu8Mfa!#/GBY)KeEV/l[Թ_P=V[]-2P|2Lb_QkU~U2U&(mmˣcv//^2&Ny64'pf8Sy;|y?2CfFE":e%9ιR/?88rY\bG8un glwts%Q+<33V#g3ps; Vg3j||euvf;Mvm7lp]7ft=7ݺm6zMfֵnҺmw;\*jk{u5ȝNYCbCbwXCJexͭi֧rG3o͚ʭ^".qWP&>*?g팏Tz4=M9MӛX*he4F1OQg128*5}}OәuU1U1+⿖eN@#le46ȾG/=edj4Q?L-SˤZ4F_}1Di0سISt!K ;g==T:ۗ]^@nNZZ*T$PqS. m֡͡-x[C&dVF[oerNvN4%f>FĜ!ssY̓̓s{.%jfK;2gҙ3=ss4rz:=s9E,E%W_&sn&QNgJɷ1Ҙi5BPg(1fY̽I ><bF:#(iw"f3 IF;a~J,w'~3r&8H9љH$A?LvMϼLAΩTd3 >q>Cϝ(sf:tYP"i,q'+bZZ\)uJGg2or6r[-ou"6g;pvPrSFN4qv:;=$ȫVM&a {؄=l6aQH(NN~hElexi %0md,#v2Y.M Vz+%VIWq+joxOR4?z?f&ox[-m#oW˼rInP<>H&,Jx4x)x\ZkMɊgKNn /ޒ4m$+6ޖr@>>b?G-_ ׸8J@/_dl(0ֿRl8m0 &< F` OO 6p-6<8Ɯڒ5STεaRqoSւl0\KZ䫫5TJuz^?7WC{Qg5Җ}7S+!X` +I=*\l$xRG+Kqs|4x\jic!@CP߼@덽e)-I{G4UZְZLy.tɆ9*:mM^՟WVX)e|e31wնָ^T|>k!^s,5 VB$CZ}fw2RS ݛ=٧5 z7KaoR<|~^/TYY*;h]iM>f^XyV, B~e7UwDRga9 n#4Rf-UJw[izPB/ }̬~Q_kF//3@Ӳz~!Ysj"=29s N==ʷRf|ļPCKm՟7-iQ~'*:.4jYe_)nٴz&s/|mY̙fG}9f!vr|F| ?6v[&奋w*o&Կ_unh?y୆tg:Χkv]gJm}Yl3l^w˼AwJ͊՚"mp` [u=xOuy+aYK%uGo`a^6~n@;=tf=Kw]NT9Dgq~ͼ#bf{bQ.t q3 [h|},8'ssjeVK.}Z̄kMe=^ߌZxGZry|k#>]l0$TT^^mz~_LSX3MO_'M# )->Z5kYZXο֐T:rסdi";pK9߳ɻcYMyS룙/׊zOev&}f7SO*T~cĿvw+ ֹH}&:WPG}Sl_]Ú4$ jw7jk/W͊Sgf~'RjV` =ARVm6@޾F9q 5yYg3E75 RշֺWםFF@`'m2)!sۭj$"8n+ʉ|r\H%r )"w˩Jouna)Xg[C%e2c' 5zHF[íQ2zzFZc2zzN[ZG,@Lu:RST7rU?e:U. )Pj +j,Wwe:5]_}>+lTߪI}f5W͕mj/mώ;Δr;mg9Vhw}]ì4HH+nw +>>jb_bVv]9y~+'Pmл%oC+ñp̺:=pFum8+^h>Ժ5<^^e W[k?Zw77X7ˬ;#a둈IFE2"HSHHkkB]w#"XDΎt\Zy0"#"#T(h1<yR9Qʍ#/E^RT;eǪCKH: R)PGGG~P"EH:G3iq:;뜣qj\p#t4uPYnmPV^=vv;pjuwWGqID5?4{{垭us݋݋Ջ5j{OwAUw;Tޭ&IpwzTԛS5ŝNTܷj;W}w݅"-tRwQjݦ:jP4ʣN4vFh3ۊѶѶvhvV!~âmGDF(;0ϻ_=3|5k kck{f{fgfeڈlEģGu#"*QيFUET+^zd#QUx}uΕ}=3;~'Ǟ4.cqgl1h"VM8x&n|&i|8Z1N3kr&ɫ)2 47gzƴI3Դ۴_3曦n4OQQybdW4bB/*5EX ּ/(&k.際]jL1KlIOk+DXK,K6)ibXub6,։״ئM7/++-Y-k>qTնc H;R|,Nkǘ4?k~Qsy i'_4/~eZTA;",jK,b~JVhdr]WɪzKêkY nvz}3?vAKL$Q.;:f%:(zo>+c_al"z@vfY.M|e\IttX+fj7Jzn=׏J@ TB0ԋBБ#EQ$$ԿNmE.*KYNYG ѻݿ~ONJ;ʻD7ontN=zJ=zzPOonCO S7]}M}nnNt_;{7:0=k>~tgaMȝs, h8 g4hQS&Mtf`obo@EC߯BS݊}I6@;O S[,eY% [v5+h_Ӯվk7kjɒ],-V r_V@]/]/ Kbw94u3}iuuc::'QP!*ݺn}tt]u '1ܓO;ӟ/'*ﺿUU֤D 55<uu?}'|7p-u\pz͂U ^4\pjYp `.spn ʪqew\wA܍+x܋+[y+{x/u+|*kS@>3 g[[xs\'<\)0ÿ*wy?5 BXKNRXpK8`e>ϿJ|_w{ _!_˒U*փpkMRoƹo-l0)) Gx}v+wb[|7,cwX ?ʻ]<a1~Eq FYݼWXWwʯv`%ǰ8ƌEߋ̪Dzv%@9~VAv>>7&}\V&IIS8;YF_p%} GMP$3d&( f`&( fXd&f3d&L$35aa 9rIJX'`xk?}U5( B p Oa>0u k.K,pK: 1Ǹv$-T@Z$I ҂ - ew...3 u.?3|&u#cQa%1+L5 ,c,n4M Zik2VެdcRƻw&c_c?XˢFъh]F;:TvLvPlAvPlAvPlL`Xii$㦇Mc>4 GL`>43uL5ȴ s?a?*VI,_nTIPP .Ɗ)^bėėG[|Y|iO1L⫘Oɼb5_ӱ]bs,,1 u%tlI1Sb>V~G|+q*\ tN2Y.^s^!V:/_|WU@\-V+k u,,~$~Zz7Xx Go@*6}Slg! __ޅwo=^ZŚ߈}'`~w9(~aq 18֜'I\CэG#%_2s3;m~ڌw "gx̋͋Yy`dac-QOiG4S%OCP4#y%Avӭ*toc ,DCW#2Kd܏ȸȸ=:1P~{tc(L=:Q~{*)GG=ߣ(~M=P~py{(^n6+fb,*`hIy@,oK/*I ''39 5ş99DĚ@P6ϕAJJ (8ko ˄!-% ^0t% "F1z PW/=. 1N@<''`!΀~Nߏ(5 dVbz=1}51}+19^O4'OJ'R&ROtJ\'.!.oWPx>˳X/Y(zl=bÈ[#!Oܟ/A D%/G]sy _W#%+gZrXJ@V䇈6 gIJ%?JގsV+牕^\77X/Y9Kl%J%7%#Q@,QrQr3Q` d%T$牏 &Uqȸ ds.}=DdBd=!n!sT`"qM(VIYb:JJQRĆSRtQX%O)b)ERj)ERt"1URX;R*)ED)b"VK)b:J1)b:J1ZJQX%ޑ"JJk1Q~*)?LGamw(?tVIa:Q~X%(?>zS~660Oa)?0R~7+ԳO?A a7D Q!z-YCҐbɽd YC*=Lh(: 21܏ 3<5 Y L0#8*LK/L0LY$FpZp^X _7:YO`a*6n s/yA++<çO yyJvv vF3N k&Br8p3`e86_VYcЊ/+fT% EH&!ԥoqc ñ| p3LTWoom$\'OO'Py.%H./+ҟŋb9?yWIٙxșWҙə?3IlBuə$șșL~6s] +!~' b'ILpt/I @JA#XG٤JS62})lҐbD] ̽ͽQ)J3טkqTf F(kGYf7A%)qkb\Ğ"'σ3php_RFwr '24\&(NɅJ. Pr F/mrI+cߕLU+20TΌ0UUj/fVRJVݪVjX?}`VݽV׮{tof Xiy9-mlK-/Xb--O--WTA(-#F 8 pTsl,{-a c >Gbb(3RKQ騔~1ŦP )2eB|ϕ*_Լy] ~BvvMm9e VŸqMlۏ̈́*6 7F#(`4cb 1cD)әjIPm1:0_ c%0bl؅9<9$i:l0.<=x+rQs]`Tc^sV oyPO=3=1cp=kzf1>٧~ki˜cQۗoyWas|sm=cj18rk8qU fhzG\/ϓÇHb1|(gϏ^cq׿t}}}}}t}TV6˺;þ۾~~~}[idjPR kN&yGmhsruLpLvLspvs,t̖Ws,t:VVYYXr$s{.G'gr~zku:S]is[Auhs]+tXҹ&M^7nN%uteݚoZnW^5;Vwz\ź+uo99T85NK"Ctsts$tsݣW=ߚ{Zq@4BKA!ទ1N$TOggggQOeg9tlll&w{.=G<=ݞ3P9U[-=y#Ф7mAGyB'x'CӼ3 -.N~!Q秼g׼7뵷T_[owciha#A'ON gͩ_Q~Y57o^ cPydsWHO}5>Kyܗ|C|á#}cIv,\"Rr*Zf6neAq_* ~7->ZGdwƟPiG''AggCz;+~ οt#SuOB/^_LV_ϼ*7` mM @+tX`tt`tb` tz`f`N`~#4,ҷ#&M]нÁc~.p1pWdA`MB<c "^G@'Aۡs Kˡ83*6!9-#;_`x;x&x>x)x5x>-5Ґ!d Ն!_(MC-6$Q!*`д )4;40:>ZZZgڂ;Q+3GJءׄN8NNɟЅеz܆na&\ X8 X8ͪps&߇pkxXx|O£JSӃW?^^2W@ׇ7sxr]Wd  ='|N>aOFxDD#5G Eli튌^LLc,YYYYYY9h^71rnzx;r&r>r)rnSF5D-}>Z(X%FD|t@%:4V(REtFtvt^tatqS~+nu["]ѝ=CѣSѳ kћ1mb2Ndʔ27 fhkl(G26:6"6.616%6=636'6?[[&WV66:9m½Qc{cl&#vv2v,vw;m;cv]s6T7@ fֆmSC!Pj0$%߁ #Ɣ?9 &o4Lmhwh0aAâ ˄ٰamÆ vȟ  GpL g]ވqئkNP4:GɞytP6csiyaPq|a|qwjG'xov|]|#tTIwI5?~(~Ա%~"~ :*g:/˟5қeMh&(4Q蛰< w"mOf|&$Z$51"1:1zb"v(tfOLILǾy=19ߎ#$%V&$W'6%&'v%&$'%N&N'%.{{{EJz%9HV;a&Hzd<<"Y"yޝN{z<|)8y#]801eWj}SΔw>4S|j@%5%K6R]եƦ&&;o|jZj3;5/xUNOVV֥6R;S{RS:J9::X-{xf@í=zjΥR˕J>t_R[ڝӱtڷ ] [S*^&nzXzDzt+z"HOLO sX9==(='=DHw)"++kӛ[;>vhz{zWzoyOHN KLcߗuTΥ/w;ܧ2Lj<#2ػgj2;5L(dg2 pξHx3cHǗߙ̤`M=3+#37 x5(ޝYYYِّٜٖٝٗ99=v/ɜɜwn\\ȪYCfG֒ٗ퓭:lĹ!-١ٶX4 סl׉lgvEvuv]vcv\}%3'?{({4{"{*{6{^tgeo9F*7g˹s\yջ3B9ךܸܔܜ\GnInYnenMn}nSnkn{nWno@pفNs){ܹ]:WrṰǛy潙|MޑCx5Ctg]|r:oٲ̏$_y /?=x(y<|SZo57pm{w *6*Qm+}#̟__hT s-}kHc:&1Onz.Ȼ4qh#q(okZ 𿍓5&'yqa; ڸG;W4n,I5nlոqOCex=YxxT1ñ6^kYmTl+-YPVRK-Ҩ*-M(M.M+/.+-,-.uVVA7d,$S_:T: =k/?{U}й|=Πܒ9[r5FF2:_I2$_I2'#0 r$#$# !#_tF2߽s2˫^{{=GoXx͞Rx-VQ(-/*(jZԪ]Qk$6Pԭg^YQ~E +Y4h|QIåES)^4aYѼ?Xav(EnqMvҢUE6m-QaўEU-X>Q}q~j4+։֋66FS׉Z[8:$:<:*:6:!:):5BtVt~,4"&>)-37z0z$z7G--v[>%O[VWq vCRpK42f&m-/fHKo.Bovː,3m@ZI[z;% М_ u pVK% pഐjYиRqN+ں U}gaZC[3%]ձ߫"`l IOck t525RtEp , Jk_A^onLV6b(4/3oa/9?VeRw,u{Pw~<'O-X1j6T} zz^үaB5~ XQ6jc[lk@]hyp]Y8x~v z,f-N-Z,^=#sm󆃗LQzJ[ en \1^}Z\](4g%xx\W;hPrme|oazbVd8:"9\ bHuh>«yП3D =C:dWgDz)c:>/ŒR}KY+@)z%(e]@hqh9iuZpZ-l8bZm l/['3"t3X2!!bYq H^jBcBpj\.n>]U0>ᾣgˍB쌅ʵ{4 vOX 4Hzh-vmH^D# d: U_5wq3}>nwǏؠ`bW,J: opcl8~|='3Ҋ-|7ϕݍK^t AS",|f{Ks>jW۬q۠_xo Fg%6JáB>q}{c%6JF|UQ >e8Õ&Z9Mh;Mh;쭑u$T/^'^Ru]o<.USZ'R?B:"c2#h AP?иc1j > =!|kTZ%Gzq_} ">H٬e3BiQ]q GWؙ2^'T{I -KpfSffs`PrƳfrodrŒ vGwon񌳏9y?#c|8Z<%SX~=O\=GZfM2| I4c:VaO=uI?sS)Uio:=6[TvT;Sh}OcyP85ଆSCj}r%|uj#Pǐ_轩{WΨ򴔧+czF:]I+ ㊌􄯈GĀS gpt &_/Ԣk(Ec ?_:i^!+f8p:9L&|_ξfc@s-E\QwmDz:oe"c/dNGW D4z/NsyF@ݩhϸߨk0k#g9/_Lcn{[Mu}IӸ=&Po%q?ɷf|7F%y%Z-|Ufw>#?Gk`+}O;;}r6H"]G90Xٯ_Е»{ksnžicZ Zq'gꗸ 1ӎ [8p^8#3pLeRSͼtZӛ|{5o`"HڽFN 4AkP ,h*<Xs;'t=i 垰m8Ō n9EA CyZ|74gC >βIO[,8fYZ9*v?psq~-iXGC%7 ?-Մڷ$9䛽{!.;I"9+K}%Cg\wZr6q<rϹOEfpm+_!Ӊ`픨֙|c'zv`H^b7e=Q:CPr_5l?yld9_!Chn`kAFZg'>[le9b(;YhW21AdR~d #lM8h/PO9WBB<DK]v w#ףѣԚ-"zC0;]Ȗ.,φ%Jj͇F>Ɉ=E歏aE+|_iΟ׽$mcf),.F0<v8&H/Rs4ȒS%C>z!}Udkc,|,w'bXZ\K\Bμj$?bEӻYN1VC3l{4qOK+GVk^y7r;gva&[͝'Z7`gi=̐_McB%O*'lάhˬ\+aP\pSځOo fѠB&8ϭ]ܐGۀo 1%^ 5OOT\%Ef Y!2lʦűX8`ΤuOe;7>07t>/|8rwK]}#3g@+.@ɝ7QG4{ D㠹 m.C2=߾&>N-n"[kk-Qt&u#%Xۮr%MeÜ+/A5ZXG)GQnew7_ 3>6oB]?+n 6e<1+3Amd+ɦ3Gݭ%__.g/52eȦFSW׈`6u F2]]hw}] +wBHn?;} #X7?@02y[Reza%|L87 p搅:qSs5]9hOM{Ik=)6Jpl'O0w}NF~ttLŪXR^6k'IwEfZƢglb߶'e%]!s*pʩuBveqg32d˾pI)'wD0= pV vw2Y7%̱{XkWŸTI4OO/EO)<"^+u=nVV<.5"vc8G& Uiμ OAw[dm~ vlقm70"u;<r@@—:zzK| 8#{@`|خ,=0%0*>fKu;E'ek`G`O@pX"p6p!h}`HO/Ň:zLgzzI9(;,Zt0 vv}>{tjOIb^>b[jc}Y<[pHp>3Ud^˲_\RE=)VyJJI+GV퓩A eapj)ԑ}n)Wb.{~,45Mm#ce`u$)xR,7rttȳpIxKJ^WU+SrT!$ Oϔ|'fm^uQcI, Wʼ_X215EG"!pHHH3)WHHĈH2Yg{5y.>R) QUkPDdldBdRdU,YoȊȚz{WX'sdSd[dgd9!WGGNEE.ֲkתY/o4A?)IwJ<5 ךN[rN/2;"_kC-|yCJW,E}F|Nvs̳cnV$Χ] \^"9ۇ#b:# Ͱc |@ W ώ>AXήƮ#n A_A,->K+'9ߠ7`vF?6&&Ǻߥ/iXXQ|m}Cd}v [n yDOKC{LOG>:33vu4FG]u]rM[X5%ZaLt n  ;}> OŸci1W虂)`֩:5QsGg$xN;CDuLD}&u`ֵ˺vȄajZӐICe"o4}<%ڻD{etؿ/ހL2Y`h=!94lɚl538 my@+We2NB;f 6#A/G,ur4-KLf\詆j蟅Y\ց!8ƷurE_ :K_W2U~ Nl"='i z>CA^^66y9oұZ-4};f7yl ogm㽝c߭x{ǽNޕwuy7g7s_/3Ujw{G=WUӭT״@5U$?TO[S`5L[2FW%jmjZ֥ lT[Վԟ=: uV]-gW4 uzv#٭B;iwDz۽>v8g=b 9Vu;,W'Rܙ5pß"|N^+)m 紻7D0x`pd_;K=Ka9(V?O6MA! SD""R|)RЈ44SJ) P RJiJ)PA!_ 12Lិo{ M-Чi?+e8Aiu|\ҬrGH Mkuϧ~pzeq7k,yӧo4n1$p/s<\8/ i52ƘɣϺp1\yQWQc.=&ZH#k51xLGo4z1e1S0b5s3tPIn|cC3Wrtӎ{ńA 3(]#}|/z is"v7@Bà"u twzMsLEw{34vEѸ==BZ' Md #bYјGRTnYJc"kY+ 6cb屁!$,Z2VwUΑQ?@Ҩ;KTXYxxlUŒ$I'Y< ,)2(8|:,b%VP*JWHXMT2).5:=>/19=gLY3]|Qtctcb seKIҸ)Hf%}x@|\F#a~{ߑl~wH6Q{E<'%~hp?$r21f:H~Ydcchp]t@d^L3ZE{Кs# FρD7>:첔z_K#owZ'M'HVrh\E*cr9~N20SNWc99}rGz T93I匈N M}4ldp)LMzXS39gjGNM̜9r,ͩU9k)mM9ۢ9;svyo,]Wjd@NW7:]SO=Cn40虩|;w*I=w!. G16o4Y^,_!vfHo"K-g҇ 5σ^ҌL;a]V8\gU]AE&mhI%vF[- d.J=txj P?Lg=bNo؇IڎDwRtklglwBY\'s2mg94'A;֣(p 0߾((u >uXosiN38g8p_w2? F5nPz9=qТnb?{U.ơ1b+=rd4qpƊr^H`{3gCTk@GS_bKJpj?z4#W H @ ھ 9 i )a|Zkks{3I?[іϡ> =unzXDkÈDKɃ;lϖؙ?l}Ckcj<]^$& &L!L0KÜ6|ŭ2 +Vl԰Yv u~GZM . #[@{[.e%^haTa,AY+P0`Z s5,%ukZ m-Z {[VP 8V,VR kZa=>Z .l#t" 5 (n#! f MPUV6L׊6d-״M0`.F} Vk 6Z;{Mϕzݩ2Kn|HHvѾ:ռN${H_=xH|6p|1gd%Mod~sɼ(5 @^*3?u&&)z0_L #I0 _O΋u2m3˙(28.MjO-()%kc^-]-k6KdV庼Xfi8-z~ZE]Yֻ̜E7G_k>yGcQiLY?0nxʣ=Efqy9e[ȯVq_c+K2h_wPG; dyM:߻?-Ҥ|,VY6k-r2GfχawX4G.myO44$hmK_dz}GmpgId+{d}sYJR!\&Ee$ %+/y,QWMWQ2P*=_ien1g0zfYKNS$gdo)}aEmKj^, ZWPkZ@z~f'TYueߕ*yOg{J.J>5Y'sQ:]^:F)3-q+a }jr@xK6ܫzC.z62?e_۩OO>e.ʧ98ǀҞ KNy-̧_>!+vnOȟ)zʟ-w_?=7S{Wi`^Rl;=I,1ۭe쓹'm>oi_8zDU=4)e?d?P@|=О`qR@{bF1]0^LGm$F[$^EO$D=$~C1$BKHpW|HH׏NG{_x􈅈w|vGxꉯ lĿ mSoў2FňGh/xoxhdOIoC=7.(Ѿ$2j > 8oi_+8w;ijC|:ě~!kuO   >m! о  = 1!Y)(]D7X;hOx7_x4/b_?Y K( &^ A_ ,&? 5 LN˙}_ {Sr_N~9ľ՗SFXO#a7g7 O2/63h\3V̊QKY팸oUh}PVg\u6 !mG*!Q?{+~q_?h|Οݸݟ?fO_[;7L;c_[h]HЅ;AA A@! F%(#('$"F0`.%uk4'h B`/CG N2O_zV_/ õ |]Jmpv%!uS6} "*rR;`WL&*r ,"XJ`Z}ݐuMDM_|۲w&GacW$pMۢrNd'nJ䣟4eWˣZ. EP^+W3A7%{]mOgs2{^go7]{}>bOMy}1ω;N{9%N?g `3GQ;N3͙aovj\gP;kN4:{!}9v:K]Mn'-vAPw;-u'dw*5Lw;].uܵ &w[opBk1 '39!9 ^Pu:{ݼ^_LۘS1Q-͠{`z?*v_=w`[ N/8$=tFx#<^} awJ[jq HC2/ڹ1ݢ;Q 5`>:X~з"Ð "M Ҕ.] $%>p/#ӌPHt/4y ҆~)fN#X=i&B&g͌DRJm* f7_Jo kAͥ7[&gG-l7Њ?o楒TU=g{`Lfya{e ơ?gВ^Hel!\Ǥw:: qhZho-bC߂Q@f18b ¹qH?%.??,] ۠owEMF]Ca0bǁ-H{-nA nj tp>r}u.F'FKX[ ?>؏݆^2;I@GXOP9=h2v47ϻ?;mPv??ʿ~e?ɿϯkG,6M(&>b!NY4tE.O&LZ<9V-WR_4L*s]K=Bqh2ãyhwHf? V.oJVq4v/_d.}#0;E:yz-=B%z!m/%CH^*}9߁J|2F58?}tb17]98rhN1|y雛)젰/@ YA?Y,8yZA΋/oUp6Λ;wr tFf{R0~=軩 2eæ!'HeUau 5ȣTzM*zڹڅAt#%i_/K!v9eZCY!: ]Ge7g'CлoJM{Qj3p!M>HV9S[Py19G]w2 ChԘ`ToʞjE>@`j >&ѦxH1ն3͉Tw[}VnjZxHWfp2W7QH~ԃdM0#|4zȧ>FjqpQSs讟gejq#HS>M6 + ogFXsbkZm6Z.k:h[&u6m\bw=bG)J*?͞asή{nCQ}>k_/9v|':N;gSLp*Tƙv9RgGYl9mNJvQIsZL9o;)qr ngm}`wuGcDk;ɝVӭ,w;].sWuc }Fw=ݞ֯crtSn{1֯zyq/7z{.v5]nK^^WzC2z(oWѻkWIb[2RFwFS+ob~Z`x38 {0|m!6/O71! 9xȗ)B쟁gK/N?12R~| nER|fxc9{0Cou8x6x/B o K6]m/ ߆G ] |7A_F޳(?n$0H e|#mгy|qA!gnGzAC`“3 c `O‚yx0{ |o;>cR Az37"#QVdN2zaf'` 1,SQ <h?@0g|0A69#R~Db!M Xh0a >|?m= r1sqaod٣3}$Y+灷 1aiւYt`AϽb2v^,=f*&3?ʼ 7^Ɯ-kʛm|M1fS-cwQ4|zmGўtrj{QHj=&1Ř+I) i&\WeFzj-KZyJZyUgLA/ ǝŻV-}7B#]0R[+v}Xk_[ y?RJ rX̢iOO.=S-=V֍JX^s\7k~^7&NNN'N ;;tc;Bt>uuwVbKHOQy9ꦺ'ͪnUUG^9j݆Mmu҆S(,׫_g+ZGik} ۺ.U’{=~OZd=н˜ڬɫG(F1j(J׳{Brkrd셿AuCM7+V:ZW+Nsz ¿vӛzf)!ן)zۇ:!m-WbA\WB>2Dd-{tIca l eFue!Kπw5/mξ [dIcmK>>hдC%ē/{K' i1=?WTBQz~(3T֝96WL*Jkc aaM`UXia-JXi;`l;M| ZO_} |5dT;ӝYs,v9+Vlv"j9!8N)9\tλq7mv$BTw-q $j;(en[VL3S%XK:` Q[u-;PB=@p {ֽr/y[= 2BוQez}i^APo7+&T5ٛx3-01Nzgs)LȡR [ІPPP7DukCE12kM M"BT5>=4`Qh~h1Hi &X' m mv/>CB{sБqS,[j 'ȵv6G^¹pp֣U"_jnKPc.r5 Uu_@unY` iIx ם;%ȺJ.5ZXuumP)_z"kmf'|ۉW6" J>"O"u5lkNmEW`d9m06_ m+3;3/7q3&WΑwBGd'*Z^v`M͞`Zx\-9&N\Tȹ9^q.܇X<5$ݾyokrهOQM|F yfM9k bqø48r@?9߈pEg!Z|e0ނoጄ rƷH "$++"AXQQ DD$ QBrH@ A!"DDGC@DD}wEV1ˏ{UuիW^OVtVpUՔ&G}Z;2ciXoe`㭧Vi+[c0@h0|om:.k0$7h-KWy+0$r?O_ܸ_z7 huDFeRrompr=x'q+bwQK0[ᣘڢsiZJ보6G5HA>9:}-O \s)B/@+៭wnLuY?8'ruGg&ǀO6= }rE'H ]K2_NL_N/dqJJ|*c_װ^Zt6_y'O4&}+IuokKw18VVj~Oؕh!IS6,+'>i945Ie˜/4_^5\ӢJ{ryonVӄuLF!M4+g,։Չ~r܏<ѽMHse0Ϧg#Nwͣȟ5N_WDzH\Xg G:ܹuFr] QW? }+7 PrlWg[C2hhHCiM}I*̪CmjU jHߊOѴpKhSmezHk,s05wN֗w4+͆Uvrզ͂ިԚR;5*kimvʖVvS."jv;7X^i'ž5چzM-#~^jo#XYS=RmDNK*맟t  h*ؤT3j'V??^74܏VղoS^n;izH+n'k=nuVW4[G)cd@*5w򓲮ϩ9*1KΤfUŲc׷Q|l)LȢ<~ZUgFnM/uXTx*`Z]cF^_7˾uF'5yRY'5yY'5zh zpԭy+Fҩz}5Ykf:w90:y(1:5RE?HJ_7[N}~UX)'@mQd [d4N76pߒ6F{nt2 2A1z);6}]@hhcoLRRR;OB3M;9^zc,o'A+qi1 X0;1ǔca- +Rx[/Q"H\,}iؤ_XEĝݳ4<'7x|]AMԹᝍ] dp)oϧӹ#{ݳty+Cio'U:-AUǻį~UQxNҪTrPU^)%M}jІﺠX31vO >;*KZDψI0O`>CBue j2fg#{p.=ɧLw"r5azD=&ZL5 [W7o/oQޙܣ4dzmgrOJoҟ#r ʴ%>na ]ysrYgSx'l/:.H~щoɱu gw)ېcㆸa1#ӆػ25n0z{ksK?wN#.9^~nb|j].<ãz}kS*S_TmU۪e>Z< Ӡ1=՜ _=͜5G+Wg3@} cy*TDQO=GEAaAE}LT'7NH=zR&&~*S R/^_|h@SGdRYUl)Kk-t YEVK?*TDQ"GE􏊬bIz@Ekr,He}n}8h2Ȗrx VR[uUl6dC6d Ѕv!zv=Ev1҇8Q; N̎N&褝Ӡ/ۀn 22v/|.þ¾x^} UU;۝A>.v~PU/ ??xU/,HwMN+&P(od~ჰ#ǝ%`K`G0ךbo5?("yd-c&aOM>"| ރ4h9N`LHLc . XAۈ^F!l/סE>eU`k@߾\^܀ۄ{ي^} }SVw>н{G6Il1O&Mת?C2MZm OLLivxY\\\ȣ=ŔY;g!Hί7_r=Vϔ2e{e˲ k"<53 ;E~au7H-k..N$yFY$%Mlll^5Z[7fLy{ӟ?MOJgtYY,q:˜Ri:Y393y&Yɳil习K4 қ7O6׮ ~Ã43<_+WdiEJ=B* =ڍ7폝UIB}|WzЭϕd :Y'BkJS\bU݋$/D* Ii&:*!Ι*%:bʆ*q߂W?fdTRd Z[G9FDu6GJUZ;?~ E_L_HWOͻovĸ?"׸`>%%8{!'n Uj&6OMܥM^ -~7ٍ5=g-KE-$O/F 9fZgVGvnwD9O($UV /a s_ckȣ!_n|5!8?c_ZۆPW~]QYj(5ൢ;ͳ~Sng*qz4i5p+2QJhUV'TRyi;QeV䶉mH,H,S*&bˬ։]+ހ[eb#HF8OǦ~Vl,x1 a` `/:^{/!^` [lGl``[`l[\U<$p܌;.V΀R@x9' @80 00&> ـe ׀*~F| CGߏPBOTB} ]x-tDZ'F~cMLL<x s5(̃?/ 5+F؛8Hh3y?[h|f3%7;]e~쁰{zf`?00 qcx$Okb.0+gn@ a2}I!@`qI'YV0$ٜ td[k%e'{ $+Ɋd?CLLr\`Brrr*``6`Brnr/B2|ȳ/w ``%ؘܒ``crPJO)tJh%F~-j#1$ 1=Ջa_?#A> 050*.nRSNÉ?24asRz-0/&V?̇5v>ZȊ[Emjpvjf4:'P[o U#XI,EX %WjY vX.[ m0Cvo<^(g8H톑 I"ڀNB(7=!]|6 (ڧ:t7?;(#|Z`"` `O?x O<*6>)5݇>-9Vss6lO:[UϚ k.|J#sf^8oNKȽͥ_"Fc5rz!OC:e{wέNgs300p+a3ɧG0OxtsR_8K{g Ⱦ 6rrî:n6>[nH9`ms[Eu-.nHs['tt=}[,666SƇ3׭uA࿙ww.'}/n?k4Kq2pN|8_|Ϙ!"g1g[0 tr>"g01˕f4{i-gO8qӘ3(kI9@N{v$ {l''B% f&cur ߤS3Wr%Hl, JSCXAcFng{)1I?%o'6Rwulؒ?eglė9"%skrJz (2ٛi7=jA\ }A DI݂_FcW36GCrffrKj3[9XJ'_D~w'7_”2a$ݏ)$UG#{Yˉz{/ #t!ٝאMdd?'~x6#9\+Oe ^ ZhzS~A?b'~1ziH>|ScM[:ădM3 fp1/LϞ ].qğ?06/V(#]7Ş00Ť#od[J0uH]'>#n bwQA? =)COz*~*.ZZ o?(-`ar#'>(I}zNN i5F_Fڹq&^@%xF$c%'A!B5,a'nB(OGKjM)O"nDuM`혌h0J }ɤM_e|8/,w!%=~\u.˒aKB3ߐa0XA1|w#yΈL EpNlAC~7 IҁNHw' ^9! q)2M9?!YC 1u)wKJ v& e~27RBʼ$%DYKƯ (KO{;styOArΆCrƲed4i}dD >$-33 Ch3;3R[Ky*W 3v%c"lKzrKk߄O$]l㥹(ktp?/SΤ3vСyu$m9tlLsj-/%gm3@4-mʍM  ?*YlgoZ98?(VBbΈM3^,)m㠌9YqHV|&Ľ)s9K-r;(Zs$y7'{hfvr8eS'5~Nt53݉O?M]ՙsfOFT~>[AD]1}; :y$Dgzw0-9鵊XHYbΈx"%I9᳿cʙm7e [ }lgq>LyB!boj31G} r38C< 6LsPP+rӿ~Hm7F׷BvR=֋2G-uowos3Mg‡~~x$h!Ǥy5L?,fLtj,6+dT yS@ ]e_c>ToukoQXx[VI*^Q ś;w(>VŻ¡p8lBa'&VR@yg/< <0 0/<0009<Us y,F{}׿7)|||߇}01c q2!9Ku85̈arKa<㒙50>>嚏Cfd } GL9z޵~}wZZ@=Ltt 4ؾ8@!W/.9n.(5. (.a Vy#z]\i\9h]\hhs\=vĵZ=no>PwḞ޸Sqg8Rܕ^83 oV\ }}!}%qg|@9BEW_B[k"d}M ]3f{F u3 Cxtti~ Xߓ A"] &xto#A2 P8~N| K ~v|n|>Jbs\}W> R3&jZCjj?je|}pxtmA~-~4x AWFG㓜t.u߈Й,r ?4/ u%(y6:<^y%u yƽ:ɧ]?N ƣ>Jyt  K8\,]'Wx @kf'f&lUf%lLpn$4̛Rv @;vzOBg~AО# 8Q?|@lǽ:o׉?μt~nbAPpBF`˼0@k9B/J_87ZSiA*ՠZ FP3h- ;8:[Cxη1рG'I/.  \]E807KaCV \@@BGnsG$?50Osy \]/"#*eRx}@ӂ@>BdH̊K . k@`UpS`}p[pG%l v{ ^^ ^ ^LhF<\Je! I0TZ* mU6jB[B[CCMݡ=AЉPh04Ih$v}eM|A'o&hAo_|\blb1+1wf9m94vv%=䥕L &ޛЂĔJq췿)ls F38a{!l's,-t<--GJHż'ˋkwj-Y_%Ż޾XgWxW1d)ٌ7[~AvyxqtwxaϊP1oY[ [Z>ׅH.caZDvo'>ecCVr3"VNqiGw~D}"b7wl;MuQxb AV[ZHȒ JY }Tqn.U(m뷾͹|vLso53?5)";XoӮC ix[OnĻT?GDdWzRDnŭr>1>tUDqܨMM}}Ūwyϸ|a~,%\Qƫ_ksrfǻ[\ q=>^r]r.]``>qcldjׄgSL7ؿ$޹k|^5ݑa}n?9Zb.ry\KϙsaƧ8.bh?_pY8]Dk~N&ngR ;!$;ivSDqy7-L;+<}%Nyijm=̜?>ٟŖSq$n8 H׉ߊbJ"\ޮs \oWi^8}I߰OO3l}߰YwN;LbfKmvOO*iOuϻ>qJ'=ɚ`g7=ׄwB?5v:׿;tA|9%~~( ɽxz;j2h-aڽ0!:ohx5c&;=T]gP_=D{Nw3NT~y5Z[<ۇ} ڍ}?s~1Asb9  c.$'|5l1OAwrǹj-ҌN6joٝ/R7Y"mB$~*S" JJė&=+_~vDfh\ 9x*O&ufΞ7UI(fLr1\r;qZxq.~?:Loyy>_G(+*Y,7*Y+r쒇)/P3THQ"TZrUmYV{uD>կ.k6ڧzNӋ2W굺TW]NݮAݣOG13ۤfYnMYgF4&j:~s7ys bY\kaeYVZoUX:kbYVu:a!5f۶NSt;ζWثb{]e[.{>dOA=gr8ER')pV;%NSlq9ngs9:}E3˙X %;sT'-*Ÿh9)g!iN*u!09g:Yr')M NK lnzÝRp8PN!8:EZcS6ٛz-Zoٕ*5hgP]dŜT F9r;OdSbU>agQ.Fk#>"ĞK h)b:@# Dt㒌m* e!;+vVqyW9kwp?JqO * gSluz@۝&)Ziݯvjv8-xFT2fg:=ti5Ԏ{Y춯smN}8@;q 3rR7M(WjJ\׹3)Zw/%η`/%ηl|w;3Xi;K/jT)uN}b܉^^gZڹʻ{n+͎J3tOL)/ |t,mwB^;wg_gi[.=A?v:Lqq;#e+n9Q_˜Pfoʼ.t5M=ڮ=]m]]n[vgMOviPor6]psYډ|gk!XnŘmnw8iX*nuY4r+uhS ]kZ|Uv݁u2FN#n+P݅ѷ h/Zj@\]4zc7"R1~q'ȁ }YRir0Gt*T}Wȁ">8Y٣@ިBz<ZY}n/ؗ8\f'>wܰ{R#kRهT~[*W:sWRڍ\*Xv[f{H;+s.Ra)2bI dp0&cRb'[lYq]VZ$56K8~O%>1ȱMYyU^UnZ@6C"e)B13$hZVc1uBJ^i4?6y,~*aΉ~`o /XU!LVj/^PMuYzQ ʨ^sofLSqQG<|k>&KS >I&:jd,0?jޚ9Av:G1Ut:]@,ŜPvU鴤݉3KiN^',_M01hNۍ&pcG/)5//eC9-ew>+JO(Կ%,S6)d4脶BR`=qZg<s\[ @W"fO)V3FOM:jԫ4^v6zs~G#H:CLX]uG*XARe3IFO;}T+0,[v?S˧ܾ0ΣTOZ<Ŕ*d#Ԇ$1z&ٖiRKe>F47pX'tXRjBUQ7݌K91g 6o(_QAN(v0>Nu빎:9LSe\aTf}~ ?Ywq.S'hns_"=!3#2K %>_G\D ~2qjT;qweL#v>89Bi71&'H|/R_ovE(_!kR_*𞌠4 &6NB5!3nfk/_h!z.q&0Pk5YOw!JD8QB=N9NeMHch-)ζ{_;ҎX E;d2?XĿOܔ%/}y=֧‚r5hXTʳ_!9,GMKH xh:o(ӯzDnGKAzZ9%\}*FEʵ+G$P PGu5xD5A@mPǧM N(^ٮϣsQ:^{u^Zw}1DyX<4Ne` 4_Jy2'gm99V>xW=)r|,2,ckoq>j~EjkP 3]Mt.qs8'Ő#&[ʀ 92E. bTf\/WղXeRVZY'dld]<$䀼(/krT)bOQ}'+dM"[=% -;~m샆;krhQZke "~jO.X/5LK <,y kGQ`\$+8 70SøYg#^Wpd!{ s_%qK[%/ZY1Ips %Z)q`~8V["D)8F.ZI_LW۪3g>cd zm1(f&)n?"VqGJw~oh7ƸMԸ91yq{Y%f)9V&= ʹ30ǢZt5~x! V@B xk H p0 ' ;_=}WG䷯.sqW'~Xd8/N g$\h0#UGEaowꌄ#)5rLs Sz./l7}3mxSxH 7 ae.1~%uɛF6*@A1&9M譯C #IX-;If%՘ӭ2\\ pÍpw<!IP[@=e_ɍzL:cV:F<z.T1^3gM櫗OtA$/UQKs.Q\7yx3@;<jp;ha=^g"|ϻ/x:+qc Bofx?}2(F:&,,yꤕ2|3,-oDb-"Tv~聉|1Y]o,Z'x^g53*dװQߑE~j{`jپW?ImF8G|, d/GzX?|M_|xA?'jeQO& ZWNbFGbE'ȷ鄕}ovRkփ8d!{q4c:1?Nu.QRKCV):Ƭ:A࣎1-Tǘ/o}j4eġ"sMvo RM[TB"[Izjs1Fr b*!,R=/NMz^/|y׼h Ct:P%LN܂wbY g|(I(tV/?Xτ#FNFTavG/V׻)jDfL<˫6"荬B7]@RLSuGu0jPoVyxM#+Yh b3Nuqq] ֶu9>v1ˤNAP'h[wԅ/631r[~Z~DD)m\/F1Ut6+͜Ut)@T>0|H),qWG9L&.רgtC/g*Fٖ]5"R`P4ቿ=ڟ~6ǚ#jڿIW0ͬTRbm.OcQ,2' r^>y}U d0r >1|#sߧ7 xʊ7]a)k@[@[B;סwxw?|Vb^ʻxA6w :`}@)\>av&ҳB}_4<,DRjR*GiJ8$tNhk)"7-U}5o x,ʟ^w XYGfbL&LUl?%jQ%jڭ~uSbRWFݥO&ƤB5f)5&3f!u9aZHWqE7.:uu&)ԣè^qCdQ>Y8.}MuatYҵgPLFY,Sq& wb쨻q'RSXPƻE\;ꮡiP6RP E4Bz'"NWs5թ:|&mB7fFjnbGQ=ƨ_aÓpMU =JcH+Uu*T$j@ZtRtʀ,.C=oQйj>fxY6yCwBjaB*Gޠ;u%ϓq#!5_N7QwCC fÐVZhJgLb? "DV1QҪ_e thf@Od'A OQ蔓l?1CXr:E⼏)d;bfo#nla9N!Tsʩк)S0!9Yr 1qi?;LR+3D! {םy.'-ǿR}irػ_6_Ck.n[-"hn4eHK(J^^MHM#uWz*&fzLӗζסw",)v^ m8'Xxjzerc\UjJo!s:]~>/qtf9`N!KYVZVu3sրuѺ w$֐5lnrKsףJk.Gf Y(º:eJ=E4+[늢|HXV皢oJ:'o%{=!iD皣H@j.ΚA$U9:+& VwUAf?$EZYdZ 3ͦZU\I1%-%:Hf+9YAlVCufeŚYp%Jcf31G l:/$u ^w$0s(›k裺ufNi3So8C:e2!i9gj'1ifNsZ0! L:4R7&Y8O D]u~!cfcΣܥ( EkQjFF/5EkPn(ʦٟZJh>$Uy7|lRTW=I<;w )QyTZTrܣA\.mTBuHm\/+_VeH"Rq +#Ԉ̂>;H.2E])p쳃O3<E3 9fl"Nq6ZQ,)GZ+!գZQV'N A6I֚CAd~ώ[89[TO_ļ+cHGq$TϘhPӤYfjkHe@-ʩy4gs9?E|^?rQ93;l|;b4wAs@&9MX _AFRa!gG3ObI4a+Ř%0E[~N.;/+H0ҘS!|v.:S`wQ?Gև^ !-a s*}/8}czlg<}g$'_C_$IRVH%$$IHJHHJ"k[Jm5k~y޼yf={{Yئ7iSW:\KTJm:|pmgjlSK1́k>F=gqoȧ>p-ޖm*1 jwOֺSƗW~:L5UOئR{t\SO12J#NS6N*zqXHm`Jow;NJS WOmPo+|]!VjC6ZMv|5nb6ҵM/MZ31i^Uk4)1] |pIA)3zEWQmFʦZ;˘SEtJ'}mvM}~^/+L5vٞ-Klf狢S+?háռ3TSQ؄^śIflj8LgՎ|u !/CizoT36UjjM7kǓ^iU&Ij!jjFB\~nBSk9]Ra~&͙Q5yM5@?aٌ˔m 9m@/*LN;+t@"vrŷJU]ITQ Ws,\*Hg;C fzU)xNSpUIEg>sT[?Q.\!bx "Rgt= +N=T7AOu|"TaP92|T*5Q˨!ӌ4%4R5ђjmhOu[tqѕ݌kbџd )̑h$1x8t7Tohu*C#${a},IBxkvm#[tTADiz7(pP;< OwٵPT ywrky5"aZ4Z]jyV_sR>ס-E.h \c u xKrQppr>JtO7-UEmؽNfB%ٽHTSﭜWp4__%jLM}U|AjkkNm}˃oCm'HhDGuQeXI]z%%fIV7#,61^,s]W3|>gw3ߥ6#0S7{[.Ds .;cN=\zF8Xsnc1r//';'(ee!ec4g:bbB \)ܻT7hH(՘Dj57+&t͔åD[aTVUQ1qsfi-$>l8|A[nhg5'̟hƬiָXb.H|dk7vлowuDh:2֧^ |GmjNcWRkr?~ށ U)<]Zi3gD8vT*}Jv;'r;_ ZF.rc!ٗ[i/',MVG+@*+7zka} TLhpx'ƦKY6~"4on}<6iFJ?m]32o63΁^-gvSf[oe4@Nv'bwaUvos sdy$+JfȊ$x;Lo7{o   +xwplpVs(wKΘ:,Suʩ#r@ )TL%g5QIZt>xZV(-ː4."_aO'-ػS6Mˁ+.@`W   @p p8|>? cO<۽kEߚ($={bpF:W.Yr8#&i|<>b-k b=>eg-fhXݠU ~V[ϴ\ku3+EmяsTk#s7\ g*~6E|wR|ƱFm+Vp|s ##99e{?_ bwRZ5ڷez[8;NEګOUP>EڸxX 4욋kIsD߯2uҩ ǀ _-e=C'53mS3n1bbݷZ˃ E=Acf Ӟ3U^k蔥Jm_#Dų[[U? .@69UYB_aQºUw-2 aƢWtpiXHϝat6Yw bOŐ^5\i$kE֙o >*7 q y=w.%j̳Hm7ͽ**[U1Q5 {K^pVT|0}T;6Ucq bHۉpu !Wu)}ӐviEUr6 .M;:_CD:okJK%&o E~b~bv$a 8bc|b},a=GšuK?p?\Muoe%lq9H'lqe8&ljXK؞_y:vb98O9xq~(7Mdr,U)H(Zvf^'#/Ek%_lzѓ#b~ӱl$%l4E~:ٶBC1ϾZ)ݡš<:ޢ15f= -~-\d/v"{jq6.$X1n[{QpuԊa5%Ƀs8(m侰y(>-<KɑoQ.£s_xf^h/%Eh-oL>w3qx@C"'̒{卉3?~ k;^==wY~ $"|X>Fet$-&S>#PP.rM'E:yD 'd6ݐzJ@jnIZJE}S֥[9ワ$9t san&Q)9YN! s0ST*'Py9MN Q(U1ߕ"Wf')gR| 9cryfs??r9Oɧ/ʹOsim.3\r>I|R.U.B.\ ոp- _r\J5E)eTK$_r\NueJ+ HIʕr%Փ*/Wt35kj(_P#VU*5:D)]n8kTn|]NMr5fj!-R!ߠVrJMLnۨ|KEmvɷ^;Iw;Q|WK=|:WpH2ɏ*ѰW>OGZyQ(Qroo^f3bz1171J뜯1 =:zJ=D90T* SFBRE ГTg( Uz z,|n  Ą|S P.+ 75@L-6PR(IJ.J%z@IPR(|>.> @F# # Ȩx &%D:hFND3`0L&.&Ҁ@C=! hho).(<,3 _1 cB@@;QxZS夾ԯ5ڥj"o7o7*{} ʕ*ǾHx{N#wPy޻wQe={{x$ww2SS(;;zCzyP=RԌ*u"ݱ~zVM^]E2XݍXkSǴIJL[ ,;*~w]:*znR tNл^z>TTN9ǘ %r}N:mw~T?g'G)z☾Ss[RGsS[==ÝR3_<miix#h-v7p-9qG)030S4^ε/AQ > Tpp"*m]@B1Ԓ洈φ"8Ak@:'ОH"O4ʿ9'zXW`DY",!Eu&tR{Z%_ eHnHQUb"'KR9u1H}X©՜z;:eSXGx6n&cߧ@!:P+:dXGyu9%Rʕ} 4g 7=t|\ A?E+#zPhO+PȞ>ŐZ5c ݯv='R 9O=KσʕJv+sꞒ;V ! pz:miK+,k-^=-TvY^+v K,NkeP4z Wꂖf"h?$E/FЅ/nAWmn^m?z n#Թj]mywYbne^F9FuJ|Q:N|Gj2G[=(Uiuoo_l(/e'tWnYq'&)11{H,+Zo[C'2~qP|)'┦ieB8I5hZH^x*N0a>qi]0aݴ^Zu0.=؋y_VdfAA ٠Yl,G6h$TK 7٠Yl,P6h$)4 ͂lefA²A g٠Yl,\6h$/4 ܻe. Җ ig075`5a;L-lfaKe#[([abۄ֪sa,j7mbg" @CZ31]QDsJǺ[]8l/i7lT-bL!~Έ ZW{nǾuF7i(5qPgTu4-E&JR0.q˒@nRAD͈\nnU ']]:+L$kJz%7Vbh3 ı/~aΌo m4M"` 3bCwsW;ctRٛ[[{o3evގ>޾rFd7D ԙaihH{o9z=Ȓ:^ITH\wωHKdݒJ,x:CH,Fz :3I}7q`X\V{m5*|6F 9Yrځ:t |0!,#y$J̍߉|GW93VBխ(o_;hLeLg(?Yg SBJ=l\6FavQsf_0';3fps hᏹA\hA1sXD5XG6I<8ԯE @'ـT 3'a33"J~ERQ6Ƽ洄3׼'%V`^ؙscU3gF! V;voE<, X'Q?ۮ ?t=|0b<3.HI($Ԁ[Ю.Ԛӱ~Eomo=o#ޖV޶ ]j3~9(t0q㟠uALXӁ]})W804s, 3ZSD;:3:]h;㩗2># }bkm|jhM @~\Ǔ}(淴WYx!Ôuv],lqv!Mx''0 fr GӻAaOP?7&8FK뉳(f%sLvϏsƄeQUfI30aՎ33̞et:B|}=_O_oB||ӃIh~^|6wߡ-:KQRGSb 5nǎc88᜶F=|vw]mU*Sk=[홫'Qxh!fwMJqys@5QQ mxsaW< ӌ4*?F y0*ek%a̤2\3ϩڳʪ[ohDA99cdϘ)|\HU͗kI75k>iV XV*Unn*V?Xk,}}dYXϚi1?tZuu`amkUYB 'j~;1׽ ν ̕!$QIYI4S4I3RJ$+ ACzk^ks`.n 2fUr`MYp謹@UêuYclQ(#٣!cA8=™Ynao0))U| !&$ed ,e2d2LL62˔Cx_*ZE-9@+PJR*F!rh-Z hZ $; CALc 6@ lf s 9ass lf6 0_a@,`,֜ͅ5#Xs6(iGP0Jr; s& EIbR_#.L]M t>Ov[uw)72 ?ԙ5zk ;/w5two&Nw1_0H_}|)@J~RJI=. R#-$ Wt5A1c|$l?lOuT u G*Hȗ BK)rK_@{Rҁ4 lh U+D6 A}{@A;X t``tD0AL0TL L LLR$&W1X/I P19Q4) LSR1 X$@_䉧 :qlEC'kt+g,W8 3ލ=k[̯/&v=B&WS?? 9~*9~*9~9~:9~*9~rrr1~Rt`$߽Xbɚ/st>?Q"~D??ggO7h/<"+KblQa)h FH $< &vnn Hug{P CaZ?+?ZJ=x$xDwt  H!dLw"Z-`iQQqwL+2珷RVS(dTV|n@({c蒑yvȘ?֎џJ꣟Y%ړnKQn)<84 C *z/')ыI_ޮ}e!7)lw9q 鋀-ֈԳR3Q1%bb@g׹'u_TT0}\¿ae&CYĬab113SY|`$XYG_z} }1dװB"U6& _LSZ"pѢKo+'e2dl(HAH ׳ngXxr%fPyL@7c}ķ2Ei[W2{ȀGftF/U`2/)TqL}cտ Uߜ0pU '˟Kj+!0įe~ e5—1A_-AwĘtr-PпY7J,D &bDfՅ/Uki^/'spTwEAw%Sq`I5D`t*'TUΨ (@P}Fpc7:59jQkt:$oc8YQY&XGHCD*OWPzs 彟TYW?x07+l,ky_1qg&}2qx)Ax<&qMC @$6"2##q2&H /$ #5̇ <a=xB 䐐K⑰?2&'u@Cx的W):$^ J {kWN[:ILb*HSdaK +Y38 >F@U8UI^S^ f#f !lƺ:- ]&?"Ay~8ALa7nDS& v0q(eJP%<Ox ?<.DrL!ILR)wN&IBB eeO^Sɚĵ4'1H(O@@lA/<ި1i8Ow V AJ&O>b)T, MxRZ#>ꇑ>$V|3؁9  "a6!ԏMzuNG;l9YuQ&h8?JA(&?zGŎ@>~- IJ`R:r dL HR)eh[( D?ѝ#=MCd8#pcܐch`d Fx\/.BE4;{>8$?;\\vH[PhP\gDr;|7C0BT" A!8(2xOE􈇥~3_.g^}쬃bv0M-b?XUNysͥ'y\Ș',3kAΥ.Jyi1bj0"fY쵉>_Z<UMke+'XeTVc7.=mVe\B* `QBNu+f6\%q^H{oMO12\NWⴷC{m]yoq5L " g)igrs9W&g8(¤ ɫP+Ey\|R| ܉@'֙ ~a#uu=Ãt?ghnX? ۷*RV]Ƥ6[},㔄ѽ7X`@7 HIw(Mg|dIlCR )IwZ`o웪ZzZ6IZ{p;gq*ewF m@zc1ߎ7Mޡy\UzZrUSdYW4pqW|Q3Y-:D1fܟ7dW 3Jnż[k51 VT[4tgANt׺%ꓤV6|+[͋]pR/RSs]Z/s)9謏+_|dʝ MMpس~jYR{L3>ϚTcPLJlzt/oEGȕPd\!!npq{٧"KK~MmjMѬa;>ޑ`%$ݑz:CE}XW$[Dh<]Mu;H] -ugÓUMwœBG54ƭϞ^o4⻈W^Z\_TU#{ >CC{*QYB"H-1b(@7ƍHONi 4 >j"%:D>϶3GA[rSn5w]9u͎etnt[>Hnμ):gFT1*QW]^_I ߻}ᤥMk] Kmr+$$<\Vuwz5$4ِ#3X= "D ?º!2,V-/cS4r0\/H>ab٣7U?MP<{zDz+M(w8\=*w.,D;CKgd߶J0PszUxq=䃑FNY֩'JO;Ք$(N2%=[[_iu$QYgU+V0&\9+2wmAR17򑺅ځ Td4|5}| Kia^F|Ԩnd2 [4U(,v5QK|0rUy=DQ~g$8t ?OѠ%½6ǥd+Bm d?eWsfeT@P2g|pacǚ4ڮ\r@s֎3ED&V(0ūߌ>㒯Sn K :`+|muY;yp+Uw-nZ12TZlUs:0&)kǑ,3,_JvRJϩ˥(cs=ޠhn('zxgn'Gr*P?w*xφ #@a {(vP{nr:kC$mOsQʘ0xx3W}di'cx^VQFr㛈4g$hSgloVUf Ҝ?jιazlY3OätoV0L:o_ۥඑ3د-N3:e;SBƸ9#zәSǴtΦ\<鉵F6S}w"+D֍5mˌ3 _5Z;efIe“U2Ս\.=JE9sM&vzu2wپސ[d^u&qUl/HShCs)W7 I$}s]%Iw1n#TLI ?[kfsJq=w.4s9g&| H<."-. KM[x; Gc@pd | |Ӊ7&nζvgb)gE *Ŵgsy̳Yu2/pq|7FU`WtS"b1W8B,L{$SYʧ4Tm]fkZ_Ik N?({D;eU6 [xy"pt@tְX/lPp0hl3G5&p3A0X|̡N3KJpQ*P簎4}?MP~Pq Fˠ)^npn=Rqp]SFEhE]E'ʟ5w[nQ5Bg'YiFA͚-EU󧍺e BR%6nyQ>z41JE/'v n׵JbŨJvsxJᲆ3V.yO&=MM֤Q.'T9)P?̩vҊ,EOT?GaA R4koL/""}:G|p|ԙYmR.kdn5ןy{GӺۢ.C oio VTpmO>b>ҒS:o R endstream endobj 898 0 obj [ 0[ 507] 3[ 226 579] 6[ 579] 8[ 579] 18[ 533] 23[ 533 615] 28[ 488] 38[ 459 631] 47[ 252] 68[ 855 646] 75[ 662] 87[ 517] 90[ 543] 94[ 459] 100[ 487] 104[ 642] 115[ 567] 271[ 525] 349[ 230] 367[ 230] 396[ 349] 465[ 422] 876[ 386] 882[ 306] 884[ 498] 1004[ 507 507 507] 1010[ 507] 1012[ 507] ] endobj 899 0 obj [ 226 0 0 0 0 0 0 0 0 0 0 0 0 306 0 386 507 507 507 0 0 0 507 0 507 0 0 0 0 0 0 0 0 579 0 533 615 488 459 631 0 252 0 0 0 855 646 662 517 0 543 459 487 642 567 0 0 0 0 0 0 0 0 0 0 0 525 0 0 0 0 0 0 230 0 0 230 0 0 0 0 0 349 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 422 0 0 0 0 0 0 579 0 579 0 0 0 533] endobj 900 0 obj <> stream x]j0 ~ Cq]C`kn,8(!o? L`-}11.ae0I8oޕ&*-p- ƠK . xT ^~gj[p8ʠofF;uNt0-"K_E64j*gV!N 2OUP{,yJCT>? Io+ endstream endobj 901 0 obj <> stream x `Uw̽w&ۛi&mII&M(-]Hjҍ"!|!*"?( P|>|<;3ss,WRrO;9ۜsf2s9:6n''[*ڰ@3o0a˩ZO>۰mGw{Lp壛m8< \+O޾mp[}=u[So7-}'o}0v?exy`0;SBw=^"돿K`>v|:Pz:kC8etyoM{?"]>;~T CO_}%}z󺓱u~ ;v{>7vK`p.;qXQ o#doW׋(&ɧ꒴~O?^=KVZYz6C/KQq~B (@x)1`Fwb3*kC_ﱘvQOAc^LVd)}2%ozVaH4 kM_=Y~ufIo0ŰQi}.´wm1\ǥ D԰Spe1ݴ-3i'hr ?i| n7nu< ) u o=v tUU1|Yq_F0M؂\L/{qZw\/I5\_MḬW׃UnW+a Kgu䇩ubW:aCE_zMU?m&lOom8l|mu^_zd.0.L>:L奖<9?wf)zԕp"o79p8p8p8sX8Fׅ9Q}dkp8y .'\7E0^ 8ɸЍ6v0R]i! kWUtM0W];L߁sLKpu܆ zXcZ2QE0齆j ދmo2)B{&0w djB ppbXFi _an2>P] &~ 76 U sL8I͇K :/?dǺz]F)wZհF\6ĥUz `Åf36ɻ|}^|?;ǣ 5 :3f0f3 ,UID<11O1}$Vnhs*sn߶ϼiի=߅}[ۘ:J 49s@X$(5N_Zp1I93|Wp8"gGYB_1fH$EյԀNcN5bӨk5tZ4e P @Smnn׿]>9 ,+Sv@i#L2=g^k`kU vTDT8PL]DF}ԋ,ԋ^ҿ٨9oC}.sQ/oQ`p]pai'bKPޚ~ KQ*x[Ix\z5\z pE w^ ĐP]BWgP_P?W;8|U7ըk0&^ԏx7QfcLo~VOQ>)7Oӏm_Qo';&Q? Eͨ_ _8p+]/GKL >z>z7܆z/_L w~3gQC&|[#mH~&?2~LwC_Qݨ?f ܃|'0O5ԟQ{ϙ> D| m_1} k.o8c Cԧ> >~;x0#=?Cga>?E< ?G}_Q_~?L_?Q~qԗ W OӨixǿM ަ?;6S(h?E6hӟδOMѦ? 'YdV$kӟdmYmm1֦cmMAi#kI lvFdRM+3ey-Ku`nrHAi,pS}2s,ы9)ߕ۝;m8RI"B=$:UNjX0QI0.`L*X>CsLhA3w c1R#Ad ʘr8#b`Ad 쓶ħ jY hح6g>C(0یf)cɶf/W۔lp⶙Cw8)r_(eILw*Zm.jcfXh17\3PXl3H=1l36m3NWo ,L`54یnY6`mM}1a0)iY1MfEm8$ԒXҲ( 11izTی(-',NJ_fN™%zW|Wp8"(ƅbX(Qtp-Lw*n&Z :N`ը<GbX eXuXF=f S6v-bҥx5G%-${DTAsQWܐdl3f:'m3 mnEM,v.?/0j5aNF6; ذ634vnns,ѻw8)pfIi]MDs6cSl36:v`6`M`*Q`amƜ4Gf,)' pNpN06c'ی=jq8NrmˁpC6n7m%t6Sv$!+/c]N,Y(CWv9PvX>fpQJ9 g轵]p\(eII.بD"ut:NAtٍVv0dDb:EQyn{ !A_HWJrl3N-bҥx5G2ZH2梮NOJt~ zi%͂bTPO|r:$N)ӁטbDjW1mFު^ 0{ $"IX󮸂34mFcVg4/&,J:fN™%rp8Nߕ eGJ:ID 5urI!D$RB~thw`)GR^=qNX c{2 ٸ\SsbŐ4G2ZH[7eAU9#){;m nuEu{%[r]\d֒N,}Ni&qЛ6 0 9«3M6ovcsq)YWG2bxfg *O͉I#9 B]+Sn{dS1m&HxH  C, =6fxn͸\R یf"ٶO@D"p_Ϝ3Kp8EP~.Bُ4یzR^d\P6,"6cSm3^6qBdAl3z@˳Ll3!Dt1šf8 5b`lX8Q7쯊V+ CX5>WDOv|>lH$6y߂3o`1fŠm-{ AyPfX(6a41o4"Nk:k=젎ScʪXX`u+cJ"iжt! ˲vA=w6SsbŨk!ʮOQ\ԕ)7[. 4.UA5JVWUǓuhueC]:jH$2i++D]QDUc'$,WrT潚P0SLW(@M2IfVd&,Jd$Y"7Up82Ӆ2{B1%RW+**+*cNꖞԗHVQga>JWFqG*\OT&.R6^$)A"P$E=O6uuSsbX9 5BGD1upʍK$y za$9Ud.ѐtUMɆd]ujj,+VJ [!Nf/!+ $6C2fS`9͟!mgum<.2+}9wq<%9 gw8)$f~sB1%%$rJWb'@}#r%}QrD\QKZ6!W$={2 ib#jkk?5;7dRyjNL#PeAU9=-x~BPEʆ:oɠ V6{4Դ7lXoXƢ55K0mM˵ĵ ,A6`0v0S'9jWgrVfs 4(+ (‹H gP~$Yb{|Wp8"( TtDkkP]+Z6qq ]5K,_&UV5/G2"iotJP_PMSȦ"VIע9eAU9cQHѧa?'3Zjiikkil׶$:[:ZZkdd&nw$.\O@vA4 $,WrYP Ot/0r?-K6CYŎX$xfxabqp8N Ŧ( ,Jb!::Up8 Tt&ZVlO5еD`1D׺ku`]]MEj2l 3wtLSʦ"rk©seק(c.{7Djaߝc Qop{`c̓}kE;:Z::*;vܬ=XsG0{ cCBF*#e)t<(@׽0ǧ؜ɟ]zz[%ߛ*p8SIBbؘʒNڶUm+S:U8tPm@KjÁ]-ֆW7 ]׾5mKchH{ tOStlo,lƍ94G-䣅(>EsQW 1K t]>t?F! 8&a 23Rx; )e }_3#[e$ɗ/ܟN}mB=aXnGਚp sirD-T޿==lτү#} .W,&{Jۏg#P@h/uze*/p=<[ |΁\8"w:s^7؛!S^1`4`tInCH4V [,YyEKUmaMҊ0qɧl>uӶm߱8sכB}(rks}ߒÓ#C\A#?%*u oYsU\|х.8ysw~u='Zӹ}֖M ˖T'ʊX4~\NhY-d4u?10*jGS`c001h 7MJeܔ=r^%eO&NaܟSOGuglF#ry>o`nq@X/trj1 /ѷְ&lvtѕ &Mku̡wNJ"pb= eۛڲu}4iXINA7gI2V|6 \+O,w&NF w=>|ӡI/f:;6j-w|j9u8kF m4U#)UXL{B{߾D?#āsFOOiǏD"=wA_>N&F&|0~w{pnL ɭ KulǾLs:-sduTFL)"븖W5,>8$ɸ[؎t6|؍Ê_#T?ҏR̽Zb2&L5+6%:S4mg ڞS;2q+6DK5X<)wegXLk𿙝{ <+YNHIYnt4mVLus'Z3m9qx)nTWxܗxe{;hzQ< ՛0G:;`C7>>GǎNRbn7??8G\M \7ꀮaybNN蘣ڑԩ#D<1e>tw"fDmg -G:}hD5 -㭂)#txh-,},Q0=GJT ={-,Ja%R5c$˕"&г}ٳg$= :!`5:s$]t<Xt0Ù09%Sv|8cε3@/Xk5Lt^?,LJH-+Z SD-wHZc _ʞÊRny sIޭ);Q) 4rkť- kҝIOAB)J1za9`Mnb5ѱM%9l&&Z{1-x]wR%袡DDt#aKk4N)x\wRӨ4/쒍Ή$}k.NZF!uxV7$0`û#H7qg 7:>'KltDaF;[yV%ƨآlq56 ESg%qM}kۆSO9UĘ}m\Vg[(OUugz&JfGB&$$L@$YĘ#$ 1 A)ʪ+H."+^F/> \|TLuNϩ:]}ԩ󪚠ᜩ3xfw+Of$SdW32'؀$4W%  ^L[)aummb-|#*!4~ &.TޡF(I ݨɽܢ~煓ZW5hKh/"-v*LJ|d$5.BqቹQ jV4>6z | [}w.Y]Nn{;`֟_4Yn *X!(ˏ<':ԯXNT`tjr.41X.ChC؅p]ܨbɟ!lA8͟> RUG܈z;5y;Q!YܐGN I *I6'k[nzSH9qNd|> !I:"[3ٟ8HdTiYڕ|B:Ȗk闰 0_\XV!lA8pDO9^B?B*&-!hX O,e1Nc,-#>!ke*.L!3EG JFdٸC-fA~hlWG Z]D߇v~>> G a#Vv2,e=7AACw8L&P'_oZMP뷰a}PmXXsOT[aB*Z& =L6 RF;<ٯF "4*İJhӓxˋGEu"x9bͽ1^7#ƋФ&x1̾y9$PmPJPJPJ@? ?D Pbp~ sCm,i{ m夭L¤K|M!mI9(WV(nv$m-DrI[_ eJjZuTsa},4 '$BBS($:*y?pHd .Fc'c, CH HHoPK UM!H*;(KKe3]bA㕍W>W˿c#ߪY1ӏ&Uzn1Uo< W;PHH.ЪޗWҗD%?@gycow˜[btܿJl^R(`FͭxXcCFxo+^fe_,h2UaKt„lLjk"ƯhZV֚F^JZAK0? K2$˔ܔ>p-g1t̸dLi0@q91Ǎ3`d1ㇷ4e1횺&&d}ոu?1FiB+ߊ]effoSRe}gx1&FKw3=cϏb#G'?a~6kXΆhh#*HJ( %6'r}+ WT:pݭ}GݷJ @J 94* 4ǝm}J"ϫ,$^_&)L!Yeot:Mc:4gpt m6cM9aJwr<{ZC|+4ix9iCΌrFv'CsF#O=Y1":T:2gꈆQu%eWg謎wVUQ|2>Vk2J TU[ ;Aj;Ny0Uz` vcv4z@5YeޡA-Hfkp/Xغ#gH~[M r'p೑ ƴ^ NSjn3FGqodU6.E?a[A=AY 7fu(t++Zp$LZ}!y|iX0d U'WZ"pa{$@Vgxj3 s"`=VB~F:mߠH#^ L,EB7:>;-k=zX N2va 9o <OxVa-k`,^"?J2Pb|N p/'q'e·V q2u0"%d\:擶#d4N$Ί0'sn(8JR> wf(/A! r q%j叉QB#̂pQ4(NN$NǸ {} x>|1~4Hb%܀ 퇓!^×D$b+@d{C9l'8ʻK&R T̥xFCQ=׻gbٸ-eCVxa_YI!r-6%/yɨ]cwAgqoG㝉/k1pTq7SĈ"d%DI %L^PyB)CMԫ< ڂ#~@af``lkd3v7اKv]+!-0Jh ߈ŷů$tRI?`4LSAӨ٠٫y_;uzHNl$iwP`:tYMNWKJBY[E:Ր1d4Կ*סK8s{{K2{9QL*p7XfoGs=q."C-xU&N { ^a-d)#jס_Ov_O"' Ee~CЎWd0C1Y*ۥAޢ4t*H_D;<@fIAV#ǒYhKa%$D=2\4z%,"^^e2hTlq\z1=f@?!F;)1) zX< 'V%`+Ȋ=0wm_'^CO$еC:nr}Qڹ Z0=p fgpgq߱#PN\|?/&Ds j¸==0M,`3QP Jk!5Bp3C߄f+n£3h`x'%g$M>d(agdj% ePtr;,_쮼^PY] U˗TX`%E_! !ю؀1Llj_[RO)1K1h+%nP) !Lʳ۫> S 6 ˅J(G:VIi^oX| LԑK>]BUU5&"&PD+yp4pWUe j`b+cŎo>/I2K?=qp3렋9|(Oٹ%b,/1Hz\d8jV-6a8Lg (&k 4欇Dpc*Xlw%j0HD Y G]wV#'|:D %K֣  0NG^+l̦.f ^l+\?XK|P 绻fmyXp 0,XTtXf7ˊ2bu"}$Ģ@?`a&F?qX, id9~͵™s }qU|&_TJG9!8דbBͳElZgI @`ُ\|`>G6L&=u.ؼVId3o nOoSpee>yM)-f-֊U|30c/[^.GEZ0\:SyrM.4x9dB>읚IߝwU/~!1wn:j\ѝ*G~Luzoq~ #Xwv98)t"?uZ,*rdR*Nfj~ٖ⚯Xti3rZW6i7wW-^~hR 4Mk'kGgk9w`1D؋6Ҡug-]Hg^i2FϪoPU) .+=0\k 1A+%ao"l휓t=&$/I1R O H!#Ìo+?rvጌaRMLNG#n'btV.{H`vD˃̩7!7$Fm)R9g #9@H)KL5t *\((*(4DW)Rer"@؊4[u.@;zO}&"4 @cI,jqF(v1bJVϾ-=v,v؁*WāFT9 Ik?c1!`!q5? g20Vo(\uV0pXyrXs2/ ؓ{-EE*Ļy F#/y[OTUta-tduk3Ϙ옜93G30-ccNttaef#cKVKrSĿІ )'0(ժS9%Eh:sj=&%Mm[Fc(VD&"V{ 9M )$IFOa8uOhcDA[^ݮMR N' mcn9d$AP0Wsƃӆ@^(CQ*r5҄9]0ԳKl~k)"^n'>|by:di>;{%muLO\:=3O# 蓲g<Ǟ#,Ze@)ӉHq*]=_' 5/  [e&C%Z%ywZ*7(UE*:YFg}P]O}^3> }1zyһ\lms O@!Wp/F Ӟ6UTt+MsZ125wqPoƭGSSF JA͛ڷxtb5C26ˠ>,כffy'J1XFes7[]r'r uOm2*/vFS0ub01y q2LVydGҟAZZ&Fc> ͝snWb)ӎ` Js04RuqmOsSdO?uw/ɾ;+WSk3N~Ή;=z ׂ51L.LM&l7Y^y_W7嘌LL27€&ĵ ǀ*pq 'uL>f#~&iiIizuΕӝ MwWx^0 FYpExbnEFL:K!w"g]^zalMyps; ixI%M4!5vY_mh)wƀ3Dc䑔r՝G_7Ā3܌դWT 0NTH W" D1,zuhxf2:Tṋ07"d7u}{cv]Ѕv6yGr^99~o>=ӯAMs`^o!~D)&b2a:}vG W扖ג}.K.uJmNB~#B]FBd1"sD`m|`mM,.Ю~}i%]4!'s:E<EcR\Mye.%P[5׻+ѾឭS2VַdT& G3/ڥj!Dԛ:e2y٪NMQ NED4,ӡ~:KciV_S$ѡ"%mBb׃Vj04=X>7qI/a^a׾^vKz_aULV@/`!`-#wFiwMߝ>q3btfG4Q4QJVGzp(8tQzxr'$϶FUz@vtB'  y5 9(bF}G ྫྷ%7Pu d맺I nA**sPi=*d{yޮ4ϟ#ϹmC~-+Z֙8n-{yh[o}<Շ?zRfc۱ R}ܲ|P@']>Sgctϵbl%j\p~\/VU1ym6Z33PG 4ViF6|si 7FTQ:ˍH7zz1q9]R |ɪʱ {uSɹycέl󶬙9e=ܞu({ׁ8w:ِ57!Ѱ^O>Iz{ \^lmci+M[An r[=V`UԺ1|`LY@J{R! an8 HC ilP`0' ʼ'R#aSLҒ<T|U=Y U?2\2uҺd^"cYs/?Ҿ>s͝;d2$b3,Td H".ܭ%V\oi]R7\(KHgbkťnRV!|{d"Wssܙ{γ9yWny>W_0)yBﯞGVl0?0`V^)c^ ʢV2ln7 Fh-;hX<"}+:I6+ #gك:|М:+땻C 4-䜼X?Er'B+s:<%Hқa8^he$mcaC.F[r䎍!+iط/3,lSQP_Ť;m<)OMe9Iښ& *݌ğ-?,AlTY9L*qHᏲ&1}(/vU?wcr5&ilxA +cIvLv64[=՞A[_k2c_ܺsbvFe'k9<_.twat~Ot=xw{/6F%)-%3 PWQ$JF5IpY3{\ PˉSPV][]N KR\eUΖ'I3/deXald5n]M&,U5W&^,`xx/ ݱo~l`wy3Qthtؑ220($ӜxBE-D,f8j6bhX*; ?}%I\"ȋȊ, Wdd^Ǐ $MP&_v'Z_Thuc|R U&SO-Q+N=76n(Aa 'j0aO蟵qRK8CBa\\A,2Y+(fp:+w2e&IBϰvG?F8HPh-k8}IK65x?|mPh{m c8F<6r:6 8rq^ ]U%IO%]˥1tdSh'JަBB TŜ9+*X:!Te@ˡgRFK{$ :)bLx8 IlE$WF/]+tEeP%˓{= sIU{xI&J謳O"L> eSNhܶLGPQCQXF;{M?9^vJE): Oa ɒ(se8|5JI[A0u5pAnc"94 CMiRis u#P Aֈai%꧵n! - DUl37AHN &zU7C&xCw7n4K ,v|g݈`TxL(ÒWy$~?&Lbfroz3dJ*1˔`A|C@Jg =Qڳ &[A{.&?f<i |cW?ZҮGs >*r&}:}/-o->[.-q丯9XG}A=ԟ3 O` !&FL`b9Qԝšd&j9$@QRtFT:Oɿr|pdk۹x՝XfƩT.-K݊+W.#ȠLdhԄl6Q0qVo0ǘsYvyg2$Ww0 HY/$D+0"ԗP.TVjc rJ}&*3}6Nbv.ލ q7K8UMkDLi@@(`#.DŽvq[8쀶62rr"T?|-;`NK$ E*qkຸۖ[hMi ȷ x&> m6Rs;lkpfTx8˜37RE Yɛv}LBdJgzyMH!}ΑX>?z`B Hbw TA Xm?t܋Lc_9:(aWFFT%g*c*U?Mc{nsEn!!  $,nѢJ:9}.5g:ta*pJҥ,SzNKcX;MXoŲt1-u_݇?$eɬf)8v  #17 -I@b* [ 2b"3Fa" C_Q D,Ȇsy\"ς`.w[x_Vg9c'X[/}O Ux/.jrCo!ȔÕsBtAٹEeD[D6E2QC(a kPoyUǪ {7{ci}|a阨gDg$( EKWWn׸~=p}2.O]^vɰ_Mғ%wmvZ\ $˩ bN(]VDi>yDx}'RR=)*cj؊.]/} X(?h~tp2j@%?a%ue\$9:D¡*&~h!Q^_E3E (8, ^(aW OFj6x*qk mi[!x^ګ>k&g_ЍNÅn엮o_2uen0['*e媓# ?f{i@'К7SUR_.x {C e:$ׯJ -#c!EdsgR2)h0+6Դ9SXW}G <)tCT9D+btCTrt PUWsIS$rs+*hzR֮v]k\ZQ ݬܤqc;uu6MH:,k@aj&8.,ƪG{UTJPbq?Ii7SA_$;2k QYyP*x.Xte`-ؔUωs/Hk ~ҨѐiUJ35֐"\nLX,H$!2 `ӉB %)w2i %uHa!'=$0i*m Fc9 Uq jaSMB^/;Gl31o۴E/]{ɓs:N.,K~=*nkLoz_ ;qISTΪkyx%/soo3f75]X=S+5`v;Ew ¿2NA7Y9?#  j''YyV;xۇt{Br7wBot B)D2"OhAկmv]S7"aÑ/=9:i|vX3;Y/w=}TI+//yGLo@xGR4t"zXagI?"zOA]e?(?фG Ͳ#;rzʬYS.ZO9#v#o' H/%*VL5]7۵?pdٮ7\>÷S4{p}?EWm`$M#}p `nӌGcifTH\hrzQ[sWӞ#$H5+!䰃jNr{(v&Rf8IcX()NsFrڠv77Ik՝!UI*d"B4]Bq6Z|?-KRB伢1X 煐4!3XHvՙkE| @V"n@w`ŭvr8kzMz+hXkC vM$)Bqa&d'z tTt1wh(p@Z cDrHLM C/\{\YXpCGYvl ΃SHaP[sb>RckO#%pl]m1P6`Xcx&4Q(M&lzH$Ni4]Jh 'vBiFVj9$NR7"Ņts X^ ^/6/cssyg{pSv@fȾ,)3?f???2tՍ ?*"ike7O"O: )vHxc J  aq Cs j R=xz$I0V$PWU h2bpBͪm ySF[d@Vfc |QVN0!oW{ݩá|@``N]|Mœ^Mr֍VqwlwIBaM E01Ic$v,ՊdH,%Jٲhƃ_zLxŔBpX_nf5<0d" J9O#h+A}}lD߀6J0"d 1T^u % k |沶yơ2v|G궕Pa g+a%V؊Xbxi(vͳ\౭`9RX&v\,߸Xr4 }k~1DP 71V㍉XuqnhT`LH989Dki%TU&S$ܲAZV%)EUIrdY |y@t`yI[j!էo!ub oq{:_w=< :`i!-?nH#YI ,t pU 嬧P!+M0ݑm SUf%h)` ZkŊ6ڔB$@BoGVYH#^С/Bg ~=?=l:?Aó,_"0|NeQTrCAuhWfU`UD2kv kJ?HhcwhϔϜ@+p/ݣ=b<VE-$_Gp˴1OTկR ^uk 6t'·y9CrKaF1o.)鰹殜+ޔGZu6xRʰ uV!k3ڣ&XZ8OQ>R&;VQ>}N|((B&_ P,8# ->¸H"iaIrϱ&vw&NVF~?Om̰EI-)ƤW]5%etfe& Z7>ۅ. m \Gn6pc`^^ȅK}~54̹[C5ejZvƍ΃˧yDsޮβ?r{ ~eeuaFgN)8$8^ jӼӣ䜶D;?!]1\XS*ۜQml̎tFiU׷[*4Wpg]7֫DT,6rSY7OM': Sv;ÊRS,.嬼eqYL Nd M=/} `Tչ9̽ϝ%3Y& HL& \\XDFDE!l颶Rk’ UVb]EѺx N9ޙPf|;ˆk.aj%ҦI3!J9R/vIxoA4/s,/[P0[B/!B;S ) +TՔm6umc6v۷,~]o>~O=2w͙<' W_"y%XV1Dž(Dž o%],fq+Ŋ4O94."T"N{>vׄ;7 vIl`_j߻k a͊UN }CŨڽKYlBt3.5. ,y{F7"a +`W igY{kdVu pcdli%PkEmaWO]Eix,?Rpy JPfˌF9 h^^x{5/`8`*!?I܍[J+$dh55Md,;"z*Hپe݅ b.:7ݽ,;ߏ) qWW9qS,'Hg* Uҁ Je<\L t*(' zƕVM*Tua5mS)+WD=W}\/G~Z:Z S;24vuM|~Y%Fҁuv"v9 C-l{l-~ZT Z(LFBW&XatȨ9]5*L͐I!C;/oGMmj;lZj\JŊ%lfcqrEfGGj&UԮ)%)3(Y OTAQsJz nlak/?QKϸvvųTvM4뱌\`Ye!z+dީ4;"nן]=?=q'y'/I7,߼۰`WK3cx^$d 4#;;&als>үa=.o PPd({*mUd4ώHp@!j̄ ߯< x):wRN1`ڛ}$U"'؏Y4Ύ  ]B6l u _1@ /d6ҌѠ"c_SgG6vwƆvg*P5c#=+"`7 ih{ZpXr-HIf`o ny`ݯf]6Vc[@l0ޛbufVM alu+#`V9t_Rl?&x0Q8h]iA6ZO &L8)Ҝf ai)$lBoMKOHvg%vY &ɠ3ǧ49yWE𻏣_bcƭe9obvʗ3k<,+'Hmvw'_*tJ77pI?'_A,s "DAŴ eX6meYRr@퇪!q,MS0E3 ي"fceS{_+OӉ~Kr۹#ێ_qL[p#DFi$#Qc)cdĢϢŔpXL&sh9~vȈ]i)30̈6#)#KtvKm`Z|%ʙj;6 iU:ḃ9訃N8:2tAGQfv:h]A{a;u:hmT1f*ld?Lqp'R(,ʥH,%1LyIK|yTCi5#Xz[Ҹ%"yiƔ-,*%ձ^+b vFSa%3 g3K&|cDR"">5')s%ix@V@I@4Ct !M<q#@]=ܮHfScݫfmtWr,ʀ>wv0ٿ4 YXTB^ bC 1| &,MǶ Muam:$4tMixb7zLZݾK]ެ+qOЏ_=l#C#es GOj_1'3nʯF_wma%ul7ᗧ 1)'P: 뮩4/Ŭk 5EffΏ,Hi]EkkEڵkC"às˘y<2rf1X^qVb { 82@BMTh-FM(l&<:Sꔰ@f;{ MS PNBG5$idgc%'5\ݥQ8e*ހ>5؉{.+ΊϞL6OF&)!Z5+}3 ݊ )l`Op-EhZ;;_ mGٳ=mكuɿٷ` t|/*-KRU>PߡRhKضԮJj\剆`C֔n] )^Z^[*.s-Ѯ / U2,9Iٌ 6-mYbXS&'e|(QGPC;C2dC^(lUʰUrtY)Y!URpoD-Lw|}]x9 /Q'N/fXW‹UyQ(Ȑo-:F\YEg ^uX(=ӫa<޲;-]{dyX?]z̹{džO}–)_z^#iKk4\\A4&2@7`>CZƮ_[XS6#ק2jrMGS\O>?}TȺѸ"x@Ŭ4QF2C$UPQ/пZ4пJ )t'Xs9k6ӜMVc>*}hDa}+g P`V=VQx+\?*\;恋b[7hW?sdž q,8 ;oyޓ2|%vm;eLCl=^ͮay+J{%7`DPadzŲQ;:g_Ǽ ? pੌeaokׅH+R29{2Nf|#F%%~fÖtڑf*N:G'-iI3@ [HVMm[*6öxқ_A'qfՎ%DrԖJEA;2]S#rc[(k.Ϋ([\QW køp4QnY . RiTYZR f||SYTzMU?P培zP̕DMTD~CrAvJrŪKf KDILe*zޮ_yUO+#:ӑNIFaB7l@ H=EF4B2%Ssˊо^,pcȩa BnْcL^Ki՘†ӀHF!]>)1`LrG.2ePGBR7,{ds*j D1j;xeQ`yЪYvn&M).)ː]bi.3y+ Q5 Vz5̝ZAn,~) (+w9$ϰ1+0ꌎl޼8d7dts L(q憚= &,]ZOMjjʎo>Y#hhmz熍9P c{\l\ n}၎%nz=xv|٪]I7L|̬=s 3GJ| zNYHkc d3~X!C.)XM{ШCaQP:&(=i!죥Ap!XEVe͂*TxIԎxg@)n% jeVtsVa8?&sf\v35B[[Bm}Fl)̓ 0 vuE#0 ,6 kjb0cg]">Yp„N`F>x9'5-E>~(jd$r"$+ wJHmxd>Q8Y67hS(s@1< ==cw+?yfwV;誶O3KU2d*MW;)tC`Jb9I &F{9jʡ PQZ^2.'ܓ7]2| .XFtY7,mcD~7H?W_Fv2C3 \}T_=Sςib zX~ǞGT7m"C *tTwQ炓֨/r(ɨ\aT׎z|G7*joYnmѲh˱א-gT8 )H7(A bM7dtbn~t4=?r\'C8{xA9#N1gy7\k _ő_G{}|Scdnܒhg<͚fhRT*-=mN.8GU2&6 Y5=@\TƯʘ}4|܃а ]̌6(QBC.}c `$NG Q)&nCO_{q=UG::싣M jܗ1?fX'WPS.MRTjahdk2o+}nE%SlXgp2eٰ`:&aVaɭ1Y؏Ayܽ@gٹ!? ƢA<6V t{mD^ҭM{\6e+w\}[K;^m׮5N)< 泃9;GgP)a@ 3ƶEWcH7N F+`XPa@Qv]d{o$8إ}f /ܑ`dp87[fX{tƠ6o2da ֙C9q1 UlćfgTow}y߽P7("YsbQnҌ{a:;Z--զӣ4XW[|(Ic1!=2y$ da|7]y~Cx@I)~XF4>u#GyAg#PFFՀ EKQt}n4vȠ!v1Ok#&> s}؜2Sh^㑙yD$WR:Wh+9BQMu0]qyWMPoK93,ž+&tO8V 5sFZRG_~g.ufmGu`SD?ZJ?s"bYf~yL>3X B24 0 !` @( 0 0rM6o&Ib/&XG! m?HJRabK`KsҲ2[̵ھyn,L4>Hzu:NOU 0G~0gqPK7-j={{[hb\^Oe]kh ~ag js?0q2#~SPAD0kK̆?ډU#VkoA}ԓ$,`@6dAyጫo`rtXzvKW|}q(ú"hmaeF##/] 0]恞J#xPxk8vr-t8x&S?\mŒuϛ1a7z ݎ?v\!V_FH ?F'}0+k b'sW@|X<Lj1"c/k \ 泗T, ԁfvp ޾<+|ϽIn$BBv QUq Rp "Z[Qq.V3:ֶt:Ӆ7mU_u:MY蛙1wM@kpsos{h Xu ,i߶p;ͮ̕y 4"v׌L+sSo1h4fkMՖMni-}k_AhC.iqO+# 䆾>5]sEso5oӜ#Ftkߐ  pț'Mo|ۜpy<Ƌ1LSicsB!!1NO.z Ѹ;7_ s?&p9 *99y؞HKW>&'Toy~y*ʪ ZW2bEQ40E<5] djU/@Y3?6N.֊J Z%M$J0L >ZY^6?I6:՚fqUmW.ōtNUK3ȏC~?: ̬%H J{bA beL, N|8KTih<L^#"\p/ |ҐjU!~<ټn#͑+ 7 GGay )ѬM"(UEB$^#?W= RBsBMcM犚bD#|ÆFF˔}mm#_l?MN$&mR\fe45_U*8 țǎ FKiB 94 &-m&BPHCss` U*yC2(I- \,x- ;;/vxQ?>,\H()yP,YMTmEVR^lQD$`$R^5-z5 ~Hg"7i䌔z"|8&̥ 4ApGtHOdmՋ޴;}ŋOH_V\]a~`٬B "#>I()a[oQi3f1Oa0 È'u抨8OJ2]jU3R1ζ{h5Nxp`x/ѣNeHWz;yC{q!g: X׻x哽N{w9;,+o; o榻^n5sfs gcFqjN>R'3 *J?բ L)H>! %ŸBP+ cBi/0"2D_ 79FIedn)^Ts+duDawGJ9wKy)'8+]=>LL'X\U@9%܂{&#ۮ&S&Y&>M:-M *LqI4=FC.%Owo}z댒ާc#wagV:{¡Cv?T}^-$md#ĺF*L"ZXvx$ä,V@ָEz&ٻi1"unKڟ-Z ҽ>_j~1L_L\Nxy.^лҋg{-b/{u:f#4D tDuEEMTũ?obx5MBH1Gxp#q0"D_箹29dGW;PS z"bkVNe}%*+: =L mfԿg: P.uP ^?wAuЬZ`H C hem&Bf/8lGm6 U t7F,ɆS՚ jR5-zL W\= :PPIP}B4M7 Mדm6fR(bX|b k]U?'&yd[t¬hrmU${~Tқwlnme-͙r˝2n,>/ R4vzھ]V\}w\Ά|Py4E)QQVʉT'qJ.&q *0M %aR5㡐Nm܍:N`z4^aC+xC,ǺI/ZͲς}B `Hmm2\)*iCʔI`. ))nNnrrmf\a4)&#P2%(Z!b戣'Ƴ$Lwy'My` < <_6ttN|c#b,??MЅ{N-x| .X-6Xk31f#V=k5O_{eC2<'2t''ngă=.ޭRevq)5~gM+rDS,0Apʎ4MaaKZKBǙ8 ^ǖÁv~/~Z[Zw>vf0zy@/_0ssn_a/2GitmS财2Q+^2?'NG X>$U=sV%spȫ,/Dcӧ4{n=х <'HF8 goe$RttPT$ B 0ؑ@2@ R1H@q^iHb 4A&tD20A<ׂD+1+ŴrL!ãy+\Q]B]6aog-~b,sA .pBotAQ ۠m)PoI`2qډ3ea/[)ՔIAfp=&ރ8Z&MZm)"$ /kbХq!Nѡ518> N E[1P0=.",ApB(„M׬=l/ήn|osn^?ퟏϪ>ӱyFnzT'ks>ƦQf%ʅ3տ>ѱc_dIXKcNȏE"rB[ +̘68bt1+| 9+7VFderK#ɦ ; >.20ū|{G[˃[gyfv=mLOrgpa…|#WrVݹzO:gXwxKz! fCΨn1n S/DD3_:GK:EdNMD/~7G T͍+0]&`$< nfZ TL6Y8LV65*D,#ٵaBߩ%}s+ZQ:"m-g~ ;Jdą hI$R\\UC-й\\i\ 994^i TS"lو5'" FN}Goyt{Eqmk˕9Y-@ͺ謶*_} |v -Z86Oĩ9 ]}%'[$GDE,tzT#qn8 qbAQ|n>pS//ɜv33-ECOACnߚ%wdi$[5&\VIPX_2~]3Sɶ;SdJ|yh:Kߝ^cwX>ZZ=omiڨ喇{jJyQݿo}ޭ}?i[&[!S ZΫA&yFhqXgoFH=+/NbMLPrMO>Ta)yl׃8 h-#FzH}y 3f|}s.53lX^^4vUٳ>U߼啷>mw/lXV..^He0czLo$aXBBQĢ܈CK@xk$ (I4rƵ: '`3ٌS vk6 ٨2hbV$WUcb3d$[Y߀(AW峧i|8ŗHnc926fH֩,(2O55Zf^Zzĩlinyoa :8락,|t[gZRf_tᕚª;zخgl8']zWfwpmtAUJ`$PR]F#rNθ\ ew1.J 2dUpU$[[Z/CsJ "[l/!%J(fJ8I  nR% kq?XBĢ!$&ETwPwܓ~_ƞeWO1 W"xi0{ĺ^;PLUp)`6D$P!ȅ,X,$(J2oĽFt}'v=7tݝ߻{c?*GV_R{(Av݉%}{ON,<nn<93*dAm}FܧݯbkҫRj7RUXJeE}5;& N̍^~;o }h3ؕmeH\Sy_U`%N!艽alA~d[tcW D(@v;m(5,%$g ֐6h N2OA+.JnY [ VNP(]ݫMjV45IV9"I2D¨إ&ڥ4B&"xmS.CvӱtﵨB^!: _ ʯ;ТI)[ka~ >X`jL9v5HVo#r Y$K# sv+c͜;nl9 H#4?ğHAy@k.{]''y0ߴhtBt") 0;aAo2l@j50A\.e͙zsgV΅r8w0!%,HTM*NML41 CӭI{|Xx|T'TQ\n&?A5]?vA7Lte^kYߊzHPm/O [fG۪|) wo+cnGrjz꫶/ S4ےsr&gvʼn=/-5*X6 xS@slc*̗|Y~'K+AS4#K5$4-Xܞ HA4wM"4ԡsll5MF(8B H.iX|ݹ:3#m ,Lm1RsD7VR ΜD ren:3 V(N0 XH64V*g eB`y9_@$_ mt}0➖]s 'œA l׿kcapzi(QfU]l4pHBjz& 1 D [7Hz )fX) rAH:Ij(a2|MAB@Vw&m"4ûbɹ CpߎT5[,WfDmbrh-0*AtEQ'o}DTQH)f;Gp95G x#@f#H`3ӧ<]E] ˲[n@V+z9XsQĚm_FL.mUrj8OdO@ȴ1z6ԩXMRpjeEPbha|tRc5=d&FHHz:w2EL'N7/>J}"$F~m3 seHDDY?(ĺB)&BjP|/xzTA UZ!{qBGⳒ$rg%BjeQDis@oӿ/,e'^TP HJDy&cwHK?HR>6>w( ^$}$$:%QYï{&$ݓ"G"WB @$$3!B&;I<>Dt]S=~UU?W>>wW]W]]\\e=$$ LUR^^ff%oK@c퍔7Dn?O027. z[cɂ]zF)w$Soٔ5/k&`fypiњVS9•ZMuTsPyQEb*OyZN_7+Rn?;s\sc}#1w#"yn__.=G~!k-l1z4BAo3Q0/ RAڧXfzl$-g*?P? A7T~3Ѷ%Hy ~/]>4D\\LL |d巠}T~|ۏOA?+:u4oz4n M-\" }-z%u$xas>;| K}rn$ 񹙹s|ȇu+CGw,C>C>C>C>C>C>[xsBG!/=z 4tпPyEE}qŇ/>Y|kItI!%JYR+]ۮ`O]55W=rī޻l?.;1qoKJ/}۲Ier^s|Q7+h\+r+Va#݊rЗבt?~}.`?rty?\VY]rs录V>Q\{gWƬ]Y܂i76x[ЪY!!!=лr0p Ro0I=a2Z03(Lˌ:X Y;Xk7{g4LZT+){Cwg1pNާay2d1rC)F!d*SAav ." l?c 3}g`,̠2Y lTB6d9FmbKP,mÐLm&cLյOS 3![.Djo0+0p)K )> Ӄ ) z_,jYa rP& Oq8˿pDD pK5̂o -0 9yI20߽iGpX/bZ!9!3j)J_Kp$aP5j5C xP:k<`,|Cpmq1G SaM$]Ap5x@@%T7K/͡eW<`gd}EGcy aP._PC)"BDT;uPK c^JJ3+T4`J.^dav=`l e!\y^_?hÒ hp` 5XV~k V T[4qT5KO9BybKu'c*K=xVm7`]/c)'qNt}>2&7ի&΢.*U'㴓BSU(Sj|3˯C*XB%pML#y%]c.9+ȏ*GXM#6W$aL-e#eVH{7,$4`jrn> {r(S7kinH&?vƳIgq#-54JmDo_ X!ml$j<ͫ^yHM.IjǓWS?5DV⸃ڮRuj|禎$$7xܩ!܉urQ7׏yڌ5Hs񬁏M:UEڣkNAc8o] ]>$lzM l$X?6zI{I~jb8&{Ti6* f6["F>z;$w-ɨf[5͹%&s**QN\EԹlxN.M-Yƒeg㜉DI>VrѬ:0qhyLVr^qL-P+2Fކ2'͕͓.5.Z3z2]*_46`gͷ&. j>4f/_g4,ͳ.ǚ\p m]Iٞu\8䠱{'#o4qZժ̌il~nc]%P㑓V*i:#zz-dtޛk3i4p:]ݖ_k+>d=KwH[ bkVhq7DD>㵤%U>t6Rk \i2DqU;Q_ ns@B֧/X,`kkI#W+=dqﯵd~cZ\q_s̨7Zjj]"m \+i -N)v)B,SS1e ch: iڰcx ٸtPg",miPL}akTNmgcji1S gZ9XK;-d5QTeR:eوٱ mgR{~:9>:9)#2ks>REK-8S)4fC:kcI# X |Z9Ɵ"ї?AQ|r-"kH{iglYG| *A*;;-֌[LRRx88K6 +b|.4sIӨT 8'!$tj}P6]tDkE/3ݔ/)FWZNx@cř (JJN(3'5^I+γ+v%3;/+3 2sgf,Pa\\|2Qт\uțLgeg 2/3+$^I,amc)J^ s~aV]+alNfN{IN)H^1MI+BDHʢR z;7?7Ğ @JMyiHYʼ4+x%5%;eAVTS8#_Æ1?7h<^ૺ83?-^Ig3syNK`4j0#Xi~ZRR|V9pkOU d[/=Ϗc`;sD a 6u hoE\.zNEsRY׋AD f-EG{{!@}LOijir"XY^`YpZ\zi?|V-*X`ZgCڈZZY֟ ͺ Ửw!=l2aS¦%lZX—B89<p7<+<| . _pqx1%W"4zW7 &f7߂[_E ,"GxOd "׃%H]u;i)y`/}J4Ϛ> D%GEx\FAѨ?!T~ /DbKQ'0_~*3OGA/>2+ɳD O?YϢO+]iTbjدӶA .66,1+0emsmEeۇd;eeS>})c, Xc` 1&ux  E>3p49HBJ0>􅓖:JA)kV^JT*Ž*G]5Cbǽ~vVSsR[hOe6}aۃ91+{GE0} #2J)Dh`bVA ZI-@1 THYK5?Qe55&Sx³,ĕ.oM( ),›(Dnp'G)|(|dΣU+Wp[)N}a P$_/rvlf0a ]h! XD*Yi] #d_Db%(AF(M#P2P2ѱx q(IpM'' `:$0 f7jkDˤV11$ ㅙBꄛmNa_xMx_8-Z(q*Nqe%Dzu5úںݺͰȰ"#*"D5r}obܨQ5QGFѻ9}<. FKӥtH*VK.it@:$y<]NryA.Cq-666ݖn+V6ضvَΠ3:fzLzLQLy 1cv9s(x`_+ GF qn.Ҿ^(r8x8v#Mr$cħF|G _>qτ>ꍀv|3b۰ǫy|~C-vh"OXq2[orxy[~Fs9޸oot?\o{H7s|5~m>K 췄}ya-N~ cUx‡)|%b\kH\5&1OX(y-^-gksZ|;۵<5yk<#(sm1]cySc^s Sc.r;-ckFiq(ѻMDRxu^5sp??o1k1]M>SyDa(Lez,ų|//ho,s!ngta.ŏ(tN#\WZSTz`3lݰ I8 V!Z/ F T!YHp;UY{͸فp>/-N (wACp;d eq8}?ſw|G8{8'?^v .{O5\7OF[?8RS\iy%>gEZ,_ߟ9כ?s1X/p_|%_/ve/ů<ůrV->KZooxZů_oF}k M{[?7dߩn~ɻq:q;:*duKΡ|m8rLZxcֱ#mSZ{?ۭV,:7}~qz| j·{LM. ؄?j3Mׄф0/WMk&M ?nOS& ʈ&<܄51&| bGQ&| kǛx`'&| n/73M\n³݈d< ۈZo?Mxl?}ʈn_ 6g'/4__kĿk.j w?0Ĉ >=ꟙ!׉NtN0k#m\uFE۸Ӯ&iw%AVR} AAxy9*aYuw ͷNov(ۧ;}wbP֓ˇԶ7j(^n(ȆFP]GѮw[ҾtwS?ƨmV+M%6$n?;[w:}mUovBK|XosLkKnj*qp]K*X{9uBVT;ﳦuUϽuH:^.]]WkB;\g] 9ͩ4B.ЩWOp={jmt:z᩷xזUp>F\\w+εS7SKZB.׍h[k ]w:u5۩2lI,t*ZVct%DIg;o^gT=c»bX+=s{zL[0̹:Z\w:Yku֩3TH>?/`z{td#P-'hWԿ%kדg>k4c^'Xޅso;#w~ܝN=$-m4h;`m? }o~? |;)뭎wZ[Y-,N!I#kjԝyz=;o@nN`z?q6;Mο2H[gatJѥE@Ԟ.9zRJCNσu!U{ޱVrƜCNNu͌QӞOۇ\:ȸĵe߅b%X8}§cmzwvzԹBkmK5 _7p̷k%ArHj㯇t+׹k!o*zLw]-wVheOط6J;H+,+pʵ'= 0)8VW˝љf{wǭ(N*zs|iʡzNcOM6u:2JNN澻F-w)Vow>la!?ՂNˍ&)5@!!=\iN::j4;eԽPE~k5w[.~]kdSCkѴdOb|Г}>4C ٩ŚT2މ|bW 5`9vw:osip3;=Xtf]tK7߳G:,M碧J[p ~_߫Zנ=ssܟ]ZWq/S(}'9qnvo?ut{`@fL_3YrtW;m 7woN޵ݟg_3Iϼ¥ u&u>-?I]wͭg%xnzʞZʅ@0`TZyG{*.w^w%}&wGk) ws>3 ZA0$w9㓬$ͼ 퍃:n]'?SԵlw;OfMw%-S\[-?SW C:w5]+x]䙮3 3wC.5ǻ7 |_4;Oql1_MOćL:Sxd߅w;vq9_hI\XߜiDB_;(ƣ_q9vc`oUnS7|}Ci5vo"nfy}~gM\wgMv+whۥ2Y^?Kukeȅ6_ i7Xy'6Z=uuɽW.K<o_{;v` \avyG՞tͻN3\Vyosm󍭮.W[퐽3}' NNT}l k_mZῪІQsiOjmv:~OujkV.ߥfu{}-NY%%;]ZO}kG.;vۛ}ӁjVQ]-w{U_҇٠Ng.:zhE_27}Gw_aOʟjRAwv]tڷ?5w~g8YOΪg7v'm̝?]<NK8$v{:S? xͿW[ڎ(C(#7[;um7~׺k>ۦdon&_Q0a L$3f&B ,P e3x~ ap|$U+\"\* FqB0AH& S³+ApD8&CD\8#|!|)|-(ab)Ѣ$ā%q#Qhq'Ƌ b8I*NLq,sq8_Ltq!f Eb-戹bC.bX$.qxTJZ\&.StbX)UbkZq 7RZU*mvHI?~!JzP[aiit@zO:"II'IIϥ3ҷw*,Ȣl#r,ɱr?$+8CyIp)r3 "Qv 24P!e)(D/L j Ġl-EW,J"XA?DZ=/F PnX0| KPEEb(  Fٴa+ KRKp:8!0 070x ۅ³³0eA2~˼-) bxD81CB.CF1_Xԅ/a5GáP?" u$QODԕ0 %&H0SPwTԟK`Х0h$. Q`:5f^[1e881x1f%@2["FWM9{`._^Pg`Lq&G}ɐz9Q7s ut.dBX+ULEiZ٨ 0=C̀L !5y6gQZٹPڝLñ|EuS"(F_ %ŰuӗKJWRK*Whehr hP6NB[Qh/*aڌPv h;VA%ڏjX6UhGj`ڒZF{Xgp ڣ_h~ס]z>-=)UJGzMǰGҿϤ3η25h,p-ڦh@mT4܀vJB8V^fǔA L,~ hÆ-hdžFe ܊l\6m$-c1 XL/G8NYh6w`3ڼ؂v/3w?F+8DK?Ak8E wU2&c h!s\yU]e{IB9s3)i&ELFSi)ňHRHiLC̊#1"2c(bVad"" Fi|Hu曵5:yϳ߳>-xccb/T}Pyx :mxk(j)5Ja4D>h|6_>/> M,6`_h*N%=uAL(:'DGHfSqL`memꬭsqxE %E)x# bAG9̊aE-88{808C:::*|DVՉNR&+te ;!-d дV*YTnX'25q k⽬dL+ӤWz}>KKZP@[P@G:P @H%!ґVˈ@(Lq]B&wz'e>Ty4tW #%+A dEZ" e!Tu|@>.Òb>8 X `5\:RV'Y~p1+Sо@HfKk܇X㖱=W,krָƭ`\!W@>"?u#[z1ֻr11jq}o k'Yֲ=ڷY|J^'\%+dTPOVf,d:} 9sЯ`?:H UUZ:+_տ K*UEVɭ/п!Mz4/CՏz# s xUh5t+kK/F63ȁꑞ~ _` d"VϗY=wz^^ih%kXC_17KլzS)PLZc1 sti5+c1:i18in]_a kPLY8gP9/ɠ Xոgݸr28ovnFf(z{߅s7>N]Yz> %sNK~|=BHoq-s9j:f6Fg7iz3='=]@q p0 cCz8Sb}^/ Po1f!6}Z_C-v}^èC]>p~pN;V~8 N8/d y1gpA!P+:plLpsHAA3<}L`P^Xf`\/㭌JP52Pd0`0:gnF/'\4 1b} al<3lꩶS Y}ply,v .CkC^ב>g ;qct:ϋrRAg5pPQ@y&Q쓜9;#~CcQ ^5b$+j3/uF3s cu*O:ZEW?lbr T[:UN-cΞi0f:MFB8Nayv0:<'Fq1p.{`l/6c{)Jn7FݎPCuq찻mpSMQP? [΀-`;-^?_Պ؆Ⱥ*PN{a~ OVF?.O 5wy,#Oq<W1&/ɎW(2peّ{6G [3*'a;GE=v#qHr~稜qי{_5\}Ȉ{6~.s=o^}-~Mc; 5=A#.'KWePԇF&_uJ34P˰m ~ ;g%_7b/_k!yv7lx6(HX^HqqeN˜#@O/UŊkyhq>cm)^S~*?ΚÜ#SMU;fZ9%ѓ!^X/{]?4׳ҨFHNF3(QR&e`1geR^j=4 DX79~ƣIy?QQ]@q!~Th.<МFv\b,x(MOOi^52b_"T U1*T?;pM }zo.#TkyKx+cWB7"Ta5cS} bXQC )J2])Q*+fRQ&UiW>'d<#e4p^^e?y `'e=`pvHɋ 1\lk\)wj]V~ I6A=܆QJ`m^ aY*72V\噲)e/d)~Y(` r|$Β` mAHrAf#[JrMQn`(ͲU9;=A(gj^9H5nA?Lʀ2elW1p[<]2e<+37 5B{wuo:}# M>LQ?]۹+Z xB6z2OwZ#=^\ept""O$>oyd,hӵ*k l)t̊Q^EOJܽw Eh-Lv]JڭfTi^*(s \ |_kWw}igeȯjjs:M׺L4o{KRZ ڢ r?џ <s'/ nd\D)]\^s&}Sș7|C><970\1D{6O{ mIʡRdϿmv!VsG=tT sy/r͟fSǟ Ucř=}}+1i_u=Ocol͞ǣsNdoQom:W5r;\at2>wf]&vD0VUkޑydhRCVNaγ g2D{\䧯(c+f]KfJN_c<(/iU̜s?濘K濙W{| g_u5@=) p8'2Ofc身L8+쩷bA'8%NsN*XzZf'$v7}w*y1Lv.bd&ilױ]CQ0o7=I[ Y#n,.ٵ߉^_;B;ꗅT{5;{pg/.gDe^'&fo,ޑb+bzvM>f sϝ"^<'=?>=,>g<(&`7B$q,ĨӘCY7&>#Ĩ"BEeR%)uϔjP&[бzZ^U!K'Uvjʽq%kkRS!YѬ'+P^Ts^̩sjzZAnNr~3$G~<7'7G~>5\+7(+s{UVyyd ]Q=*{d^}ssgbU`1xP& goCK`^35/1{#%mvf'dP}h]NG8A}Nߓ~Oe|}y<n'澥GemY^ʭVjUZUVjfuNxXݰEuͺaݴFakݴvQfO?Dٳ`ړ6{.jGCv.Wګu=mҮwv#گ탰B}>iwgKU{uA{q,8!'Lt )tؙ O l}YERg wq;-vg' PƩs9q5Ns9wN9s7s:ΐK϶zFAo1{v^bEN LϺк__fWXW嚰ajoo:vzP/7X7M!?7Ĝnw{WPĞP%/@@Ҟ@~ 090 \@&2]ǖf=` l̞ TvFg_7&RY-^@9C!p qHY;_ ?V[s> "=v}bbYms98@s, N N;\Pk#(4n_  z]S^>/ 8q^`>+<ԅZ-*hvJ0]Z EĀJY RnD#Ic#%o,,<2/&,,w&F6-`d{d'):;R(߇{G#F,] ȩi*e"G8OyDw"xnzT,2d`Q$Gn,ִ zg4;_B䜉M-c{F4bDSIhQ aΌ(5D<;]]l)Jj]fGW<45F+[QӈVFѽRhS%zȺm\l5E;(Cu"=mCmA/E77W rySQ!RADVEZ싩b5"7ZݱX,|4V{ȿ"͊Vml.i͇jJ3=$V[[[+cX{u3v2;.ŮbaX\]q-[*xRƺnO?L=^euħħNjPO$P_"X/ ŗ:V|9Vb(*&>1!%-=3;^CbYX(Ō]&*`76$&*֊0;%*X}Z7ѐhR,AQYdPf&&EY{ڔhK[G ':ND{3ni~K.MGSWXx[3Efd{fb$#kIYMtuD2 #8*W;5dzr(999N>LҚJMΏ'%K-1Uv{2\h ha9 W#\ \i7ʓIPD3~v b<}]zWHngsr[rziPOIJdqx*˜wdɮdcjJLN'%OFk; ɮp6ٓ샽ju&^,SG`r8ڑ#RZcNYB X[#DR dO(U]SSOg^_A2fj5NT d"?` }n?PN-Rru(YZ#layUkؿFu ֕^Hz^ԟbOc5EӻDOmg>NTU3?@>f{2Ew $KN6[ojFHRwkd¨_f\_y)η 3H9}ڬSp}2> >$>,>*> c11^9S^ϊWk Kꞃ򛺫uuEWpxr"B6(wxv_X & Eৄl#3׸K_40 ;7'F)Mo?MCqO4|_6]lW0^ SQ;[AY ~god͊û o;LϖMf dp΂smfړ jp^p61ǘ {C2ƴ|8O YpF2 )W nP6+ = =ug*[CꋠC;r+赌v?Yg(R bԷFyl^}Zh}2U.X2J{>el{sk!y k۠-Ö9 dQ{l8 ahnHUmSD!x^Eb92*B1փ(e 40Q6H3lNoDi'hCL~pXR "is9J/rԫ-8U0[Bu,G.KVTֳxi=ts } zڛBSͩ2_),.F?i!˒2l^as҃vAA;`N\& *౛UZ5 'PjEfHgnA@TCb|bme?j**۪'rAr3#jFW7G%&s˟GoBwh)譯FkiD YFZ~D4N;h3`(=Ƚ=#5{1-Ct8(``x+R5%e8&DQx3vN.П~$zT~%zqmǕT̃YE_GYh{[7|~'J?Y5J?@E5ܵjtB_ȇdʭU6jgX><PT}zżz21#y9π󚚝ljj=̢}Ч"Őyed;?üix \r |ui-tݡyv'dMGIBvf8bWUDJG/`_(Q0ެg?'KZLC$婙Twu`6I0yxjzjw}v!f@Dw>"s99v!sa̱5Xxg8ЏVvCci+hfgx/72ѧ^D{Za | ('ٶ1*US:.aQмC VGǠSNo3ւ˨MXa> ޅ|s1ybor݁RJ"C#H B3HQUXrS+Xh!z;g)jE/cͶ_T+vއeްgyox #! "yuev:'_ Ixt6|uFE'm@3{/^ 7Q՘B. |@~_ dt;tOQ{^/Eb6:ZsD)8YWshm-4jw*@A5"6?—6!Օ y5 5=+"S=Ԝ|044y 12Ќ_Ź0^lz=85anqlfU-CۃQHW3F}.<<Rqհ@]/py-b;c5p&Cr"K̞]0G<;'c^X?!mߨcڹfs'!1^ѾO` ГiB ^̑sgLAaZeUY䱉E[<6TMwٷۼ3[zj]hiG'Jm0 #!j-Ɖr1݉5)3 4m|M=xl5JΪ~|UZ]~;ΡW.*0fu\E<[,x~l_b(xR<-ab w1DCͷɋw[q닢luíVW1º& q!FY~GZwX7RUfq/n!qI[d6e.{ʾԡ~G=#+ 9[Ε"T.+Ur"ɝr< 91IGswQ8աOYrd֍B"6X+_#2m6%jƳbxH>4>`x'{;F#Ӳ>]8I (4lΑAp*秐al cJ^z׳9Zg;}K̑?%zй,of8~A5kO V_F=/whmal 2h< zd&as J@gg16f'W+CG̘C{ɀQQXs</o@}v/GM3>h֛-ek[v7vncާ|Z?ݏ==`={`lX&X˼V.kU#-KF1s1݂KtD>,Kf>e ] uq\t7l ]T}PLJC69U_:mKkM+8,Qw.? VTf2p>..8e-; Y[ǵ -89S+i[uuycӻp><{vܞٵvqN϶=_^ 2ZؙTVV=$q +褘E9nmeڷ(=ר[_#o|TV⥞]PPAGO_h@hHh53_O)g_9)iͿCz_%סO;'ڽ*9ɱDžq#4%T9c?Cա.C:g  m ' ݤc<1<5\ 4&xlҟʧu /j.M/ /:$boEJN*u\r|6W׸cHx}xSxKx[xgxOWU)jR]Ec3Éy*1"H$6B;DbHH!ޑ"̹.88DFF"c#"Pk@dZE$ϥőeUsOdmsQds ~M UDFs}Q]}w2r6_ Q5hF4+>)%Z-NI }<_\u}n:c+-ݸ=~wLtN?qomN:<='zX"n1RQ<'~ʘ|-{g3\:W%wgMH;:+ZhMt!hm.:.Pm`H]}nDrnsN~yJ{{%JvFE/)c;Edh-F8.ed2݃c3zf(oJNtJ1|ᳫRȌeUU?+K8U]kL%g#u|)a}ȼ ,<{&"U? j\u? r@F? چ|䗁_ `T{n,?lˡ yOB'ɛ^p h@Tݏ> O d~<Ӿh/mjM~ mȻywy: shY@bmqhmj#g2:~3~ t> B O G~D_ t&Ј ;][@#J5S@cdB?Ѡ @= QQGx m*x VyuD0<@"w%? oA (~z#jL@@D?yUo |ĘH`\%m N { /!b&b)R UJ=ԏ1,B.uz%H> {qOJQ(Y<%zto[-v=t|M!.JŸ˼H X*bX/6-bI9D'q^\Ґ>{d[#c8B½(`YBF29VN4:LdBJF%0e$듅4ל3ݍ/+.lDȣa2-A>3= G@[= uځ|t>/Fp^[IGPklTas{m<?CC/qx#NC(M{,@]D&$,[)"zR$!nQ"^b.f࿅?Hb%bD2eJs<ZAl[ o>qP%<:NЖ6 G3-!ENF z-p5>_8 P*r \hESO@7yD7E=*md/׻œn΢k̅p\GD՛ ~yKSp:zRD煔ZNh `VȎm:;ǎ%y]rv7ګkKV2ןs$,w [-"=.IX̳G6[ޢķ˸`T9Z?"< *{ooﰹMw5 hu]5 C("}gm9?-ửbUtyḊ;?v %}!)\iCԑd?&IwϜ;m"?Ɇ-Dss&u $(K3NHCsJb!b֭C"bI:~JYZTr3/@0`Aէ9_|9Q[-W9h;s9f If,V4ElyUJ?\K`syl4Eѱ/r<ug .\`\ G4m2Oe2%ᦇTZ׋Sǫt㒡l o:t!(Hյ!~gP~Tha)bE0ڡǩI9O! -R]9Z̥K-PssTww~'_V6:[+@`7~C N#Hp%p&}1)~ʸY-qv5kccR_O=ӝۦq7ROz(id?]cL[~&'onoLl*p׫ ԇ}4ܵ[>4O7ۀDd}ខkoGooJ_L(\h~\Фqב HҖ1۳w0&UЯbGM!3:ccc @+[1!cib+G@#7 @+=Qp@W"TF2~?8c.X৐!WWh+EjN Apᓥy ?〕3g.h9A@AB@>"S *gY%°G#JJyZh?c?#rE"]ŗQ??#n l Nx] FmE`V0K7/H9Z1\H`{FɿȨ/l6á$&w||=.8_a;| gz)dOC09Jp K:Y!YNzA XgE:ƑTc\tl_ vk66d] lGdq7[{x;u|ދh"֓zLp"a> \|;c o!a47;;Oz 2B#JE'17Mx|wFNG+6G#C]Ce"2OMC.?򅺈B3lᡀ{~Gt//hGJJF::Gt|E8NG/_tUq>"_Ǣ"qD?~]Z)K;dPa1PFeT mdq,o7F1D~^~^|CPq(;qq&;bI$FʺZ˫h1R.}r\,F [/ʥT.7i]+r\< Wb4ăr\)Urxb\#׈oɵrko\/׋77b|Y,WD|U*D;;|]Lo7d|SLɷ[b|[->O%%4K[ֶ''۩N8|6!.!|[K-Sz0o(]?h*mUۮiI,/h)`L=gYz{E/{}s">@Gqz>EЧ\=z^/ԗzZ_o}[߯ҏsE FF4Fot7z}bc10J1x1јj7*lc1Xd,5+S ܳc{NȻq~3McWvRSg>Aaq8%cx|'yy ==EO`<%2X,_zT+>0v٫}'1nz?Z~%bک*v _D#4`||m@{ U8, 6~%_k ͍?f|]W;V,10Kaz 0|%v]7{(Pϡa?K1塏L9Ao1_LE>o!#rމ ̤5diy3拥O;Iz_9ryu4|+ayh xh]G9Mf4{(e=UW߳3;{7r1b#b H1bc! )"RD^?kyE6EJRKR4RDj*"""FDH3{s%>?;;s̙3gc4El=]m lJ {c."p_bd39U1*z/ØɰGa_."A$U=caCE zzG1ܨb6 .jTQs'ߗu2r{1A?Y j guL)fnӠ6' , Wnۚr0cȯxFԤXI\ `@L5:1(oD ʏ_7Oېێf)ɶUq 0X%~(<{O.y{l74|t{`#+  WU]ossssoh)ot)9^r7T$g"EDz=- wL$.NS®<ug{@U |gl w%|/ap° #O(N08D,SS%'A7qfV8pVHI$)d橥xL/&adTD>9uחt__=~:%[Sko|h, -?5~|]]⺬{Uu@WLu͎HgvLZ}FDͽOoTҎ, nVQO6h{"_Ҽ+9ܗ6H_ك<0~.q2/댁+`o47[S_l +i ŁNSAx iJP uǠZn85f4SQo-frnw4rkV^I_-na(¸qoǸq(~ZXShz dvi%ESk!fүFllXj]x m PcVvsoUU=wҵSS9 @uM6e=T"O(]қyoPsRkCMn{ diW{}rR;p=}L~,nuVsXQɱDRRSH%h9f-eiwQ2a MCVX 9])cUNQ~XJ[M46){ʹKZF[I?ĩ9enFE6hϚݲ]kST Qz*-Fo6WMU 7`֎U6S+Y;LV+#3qIIK{XZP}ۺ,uIY';> NuZ0 jO,v*Smp>uu8V@}O_r4ƧR>?;늵I_R%oX %]S+ԮsbhFNUgE/Q\ZBkbʭvkoUXGUsy3yގglލ}xU~y>E5 ^D^)O=*_GiJx)p*I|*gSyV?ß :1ʋ=fI\{^w ;NGX5}¹zG/ ~,]EʱUﵭ~bn7i:k˱c~'/ïcPݷdf!S; ~}NybϨ ?|NYW{|IcOޣ,p?z'vd 23li$ f>OFGR3%|Yҡtit?$h|y$ʶ]-|N*+Q˻[{s᪑ 󗥹i! 2}2TnU#F^q5&LY-2r9e*ҷywqwY2rWp]꤁2Vζ]7Kθ*Qenu㝫{k韅xd( >ȫR{7ղ:7fD'Q#z 5o<%fV q[N܅gIԵ1uY = ߶1KJECjd(K`+ Ԭ!B_g:㰪TJم qR}ꃪF_4oà }G<[ٰb{hmc ʏ%hj̱8|QM}TM_UcKtE5]S:Xҡ95QSl:RZC{rNS.81f^pROf4јP}wsX}A0goʛ4ޚgLxWރx>y:zk:E| eZ|;\"3D3*ENdlэlS9bi@EDFCS\@ kTLS 1[OkuL 4j銦VZtyXn_!^ub,}WtJ۶uSv+ݾC/^w86 U3X;p^uf VViھ`c vj+j^8B<135gFۑӧ|U$GUYW"?!&@ZMqPdiro^mElO&=QmPcǺ^q㠎 l5u-ѧK[1:^Wj P[Vvo ( YrUV࿀ʱdm[!p~ P)?0#*׏,:Gs5Ͽ)VN$HWM:G3y|K$*gN1fX9T+'ֹ msP̬i,ٺzo\Ew5hz#xXԼ ٦̚jn0S6%>6V{mi/7m0WxMuߓ^l^í>bCFJ,|9;}U}-HgmX;۰,lо(uz* M)XT)a; AVZc) տ)oONŗYk!oaBLߟJM~QH%&x[Hx) ^e R UQK8F!/! G۰F);o?o:? )+x寺ecBi }χ?wS/V߇UɃ0 <]N*&mk/?om rX9g>L4,6Wz5ȥ@5GƖ5]ox+j /&=DhG`6R[mD\-g?*5ig ꬭ7GYi֘kc9Pf|%am1XVu([dj2YH6:[ߌ iQKL5F4WSYǔZ9f!0\5rmKjE|:൦tjdhNA縘){y'|=Ez:<Ђo͓:ܦZ4ۘ-9Gm|(m$=n>f68?⟩Q º砘#Z}Zzf0Zc\kmm)\[F~Ro셗M[|įRO)h9W9'r*H5\*4`4r %jj,ʃn z5F[ti?<8FZ_JfaAh s_wj,bYꊴYV + jVNvLŮ$PLOz_|* -m+ fbfzUTӭQm63?ķ[-g_QN\l6?r M˵%8#*ׯ5՗nsV3a{jX8BO@Yb׏ Pڭ5RIhKuOMkZOz1FH kCZ.1EZќ"'@QI}E8A Fo^5 z-ZJd5jkX+f֊Ԡe3nzKKkij^%bǖ/ԯ( VrRF*SV_mdjM{/3f͋r#<P*JITk5ۚg=m=c=WqZ(w}Q }ka7O\N/)/^׽H{^D;t28k^,2W"vDR M>H :9c2p̬+g;Z19xHK`q!tOw[iCJ{]K[ޑ֯g:+n.ٌUU$&Y"-%4g|J<_g˩^C4kP 7`.`>C Khq'N:b&|ŀ/p l>p=v+ ,΀= +>;p`>`#E%/2Ԟ8p!ೀe#Fد\ p1o  6>tS[fOv00r0QNa#di3ΧlBŀK_\y*n{,ZX؀!D -`{!pz4澡aE'3& g.EK\ p,p+v]{vpVQ0=LLl~lȡN]{T+Nƚvz,vN-ЦKXx~qWXwZWh҅Ɓkh\ƷhDbެiMVlQ+jTv^=|äZQ)̀,vqL2k&jj?o:VXOZ,T+JK ]23V7UlY $[[wl![HfBJkm.olޛ-|H"Ct}@1JbxV6GT;lڣR{R愜t'8$gYXXXqq&d'Nȣi $LX5aw¡D7ybމy#X MXixVIjIG6'pͨ߷#==uMMM3;̸Ngqvʛ:yWK㞏GӨ0y޸bl4.<6|{c-D>ZKc.i܃4w#sH+ž!"mv[qk7qwhJ S7E&'9ƍkfrEˣ*ҸoMxlM%pxml8El]Z\xr\xS,ǴނM_c!j6^¸./BI2MŸz[KynVH[S\<0.a`?@C՝͌ksvMZPqCw>4ĸ=vvp^pR̗/0fp[CkPRCM˸ swvwA{~-#BF³cin. WĆGƖ7XF-FWDŽʋף^+}lޮqWviὐS_v@gJ.QH~,U=\fyn;-u'!avk>>wg X{]tIҥ스̤L1io^v Ʋ$7IaW7iޤ90@FLjE`i`9jeeXYVgʵZ(k5ޚdMfaUyZa .ku\M2&w`AU)żOlւy'B+n_K+Um|'=Eh+2#h&Z$gރ$\'b 3\X,2X#6$/"9Mb!vBTڎS4hw{}\ QLP]=xJ~wy`ϑp wYe^XwYp<7J|`S>wYpl<Jn=+ۑo{$w"n$>"ߍ>g|OxE)?rߏAݑr?'R'rG4RpJV㋭$m)[3ӛy$m}ꤌO6ZvzJ/s7>3oZF—"oIjiM> 6fؙ|jq#w*A;}wED6b @|SiTfzO!PeT n iAV-T:"Qx,љ<ʚ(<` Yߨթ,ӆG ]WLe/%=u7X;㌞`}-gT.eEJAQY&&7rYnnW!rpIvrqR4Miq:N;tpt.εuN3عBRY {^.xm wwwxT<^8n{7O_ VI______/2_ }?46$ߛ|ĸD UD%wiYjjC؏ds֍hNPLsR6fSt (+sMwȣ4FY4JIDo8,f!h8E$Fq\@sF?*`%Li*PVw L\AJ9$}Ap44;\'xSJ:gsi<(*!{n*mu&"C )}^ I9sXӤ Ll@(T5 ~3*( ZFu*r'ߎdwF*.#x" ,j֐sm*9SF [i[SnvKSN'ύ87\bU]v>\#Y粢)]q%# l݆Y3s;.ppd&-IzIc}ioa]kku&spU;{cP ^$vE)R1FĊ#{GET`Ů1vg{ūM$?s̙sfv:w*y9㏎?JM:eu4act\9t־H֨x~Fy )/ްN-1ڋu|.+}mosPs@ѿc7k-~=JNQ,+Zݿ i;yEOKQjԐy /yͽz)m,kIӦbՙ xdI2R_1"'*-=}tݒ6HioIĊ'>t{??@}ɗ,زRޓuYեodϒuߐB'[ ,uUo$ b6{MJʸo^x]W&n5K5%;D05~mK ܉9Y8ZXߺm UsמYzGZ!,9.߾X$O8|rK]8.=RtFz8sdȖ5{.s]:a%~ZSIhQZ_>\>kd>O2O Bȗ|9_8>>/*QB8Ruu1Cq "@>8jm YuvalUl[I'CZ^4EuպkϥBRa zZzI%VZyޑGx_ގ ݞw 瑼3iDz񟤽~܁R}x_K5tT$ݙm9ϒ?$]~#?Pz,=eFBP;}zLc,+E޼7}>cyX>B| +̾`y0flBƻx6bsv/_1vfgH^;KoGko>~w"-;WvxwI%_oxE^WUxU^W5'ɽx-^x]^ xCވ{Ƽ 7xq^ݹ/K2,/fx3\.6HDH&kpv\Ɲy^ snϳpȳl܉g9xN s~yx>/xQ^E8v%RbvPI9bԾ*[;)i!Pm Fh#Qhm6Vixm6QM֦hS8mi mHKԖh2m\[Vkk5:m^ۤm6k[tm6tmh[햶CKvk۴.m_;i絋U7vC=sZSKh^vX;iWvL;hKevMh'SθI{=W;c)J22R؛ DQ )(uv%.k`FIT^^-_)TRR lEֽdYmbvd{?;ZxƊTo?CAcfMOj-yda /&,~&q[{`ᢆՇ,%j[dDw'bbDmȋ:^)jt~`2E=3RTe(9lc2E-" Ec#S(%S?vQ+/ōWbVSyuvUY7|Xե4"Mkݼm.$F[Tsg}ǺvN6û򵮤*~-a׎[|{YrJVXNzUd_gYݠ >: __۪j'O8g:gTH>"y:WH}T WTU*3/YqĬ+W|zZJikm|h=_x =zLe]3} se/ϴ27zube]}uE%io6dfg\Cؤxv;eG& TQoG o:}Ugo2’]}6!_< u)#ʭ'X ],'gkg[ йϴ{Qɬ:؇OM)t1i#[w Q"HMcNM&'sl*RweFɍzbi݂hvn& |1BLj68",VҾueQ䁦N"%K!tZ(]HgLev̑db_J 2duXC֔b~ׅdQl fcf0dMH eђ'z,l$9$s]HSk[&z,NK_d}C}SM-$Iׇ黐&KO?@}~ QX9$g藐LԯЯ#FId>Ed(#$/o@A zigp4 bTe^CAYf#= b4׆/:$Zlnhc gho#b4 Џda!P(C,$C<8, ̰708ِQ G0,^4\([!(Fh'ƥ1Qje+F]E8Ncqi,kXde*suH676!mlnlC؞d;c1dɞ(@CH0'`3"98ϘH2̸*#EXc1niƳ$O/jeOI"̤$d4qSvLLyI:\MEH27y4ʚ**jꚼ))ӨSkg q8 𲈹D3p030#3(03h030c3L 01`ƁfX0`b3x0L3L80q`fx0`L3t033L033 ,03l0s3\0s3<03|0 ,B0 ,&LE`Y&L"D0,0K,R0K, 20, 0+J0+ *00kZ0k:00[lV0[$Ifm`f;`vfd0`N0)`Rf=`RI^0{>00sA0s!0sL40i`Is0G W09 (`9`9`N9 $`N9`N9 3`΀9 ,`΁9`΃9 `."`.FeP?^Pe' +Ѻ*P,Z:ơ+ˢCLs0L 0-`~V`Zi5`Zi 6`| /`ڂi ?0` &L @0`ځi 0A`L{0tLG0t &L00!`B  & L00t L8p0`"D &L$X ,Zt ^S;$e{xZ{xZe{xZ{xZe{xZ{xZe{xZ{xZe{xZ{xZe `6f#`6fM```^mdPej17sM07s -0s0ws]0YbdVYTQ*yJRC\j%Jeqd=u)hkfbEѣN'fX|^b'/yy/x@grB^(!bIR%HK0,u;Zsbv{EN:&/:HY%[O>Qnݰm?ҿ1D>'і)rDgSTO c ccbbbbbb'"v"^"F".""ODEEET8ȓIRGB,5Qb qdy8+ C-b2jSP[”WЈw+*bH7ioYDx_iyDPoey #Χ3^(ODɇgy'9\;z4o,l>&P~1#C*DX ZꬣX߭ge57DoC.ާWY&E2F=1ޏjWHw5yw_xJ4 Oln(}[55ǒ(m3Y)gRFݽŻl9^n]uR^%Yq=EK]vCU=[w}9>AsG39?$Lϣ}sG[>fr~ZΟu>Okݪwgq:b;n(/Fn3IUR&ًge3bo~A!a`?1P~|| || ||.2\ @;=0@/lb.*!*ӕs嶩xE2*'$ERk3\ZI{{=ec֒IER{rZ%)b^,e}+fT+Kbwo5!t'eV}ٜ߲ {Z5zN#g%'vz=t!ͯI;9trwAΏ"> Ĝ:Q;fb/ófy-/+ۡ\ H@+Seyk9yWBh9"k[;;!N G0VBhJz7b69nΐaxU:JV*ZCthҡU:JV%4-aR>ƎX{D_/gɹrAlWUe/-7rG9\&Ƀ#O"O=GNWnGy|K/?W\ɮV\BJqC)TT+J⫴SBHּRb) ePaTrrM H 47uBkM{=riܴb|}|o%o)j;5d+"u ~a^]w=cq B-m^=$˜r<% 3g_<#1'^2cf^W+rnd3E\܆qٺHN=WB) K_Q|mNfO1[-m.k91fn\TF(u9JLJ[Lurb2e:ҫ+Tz'q#w'sVdODwG3/84=Y0vN9 jR-4<,4'2o'+N^n /('8̥~*漟he_˹+S{sY槹L,NlwRԫ^\+w;.ލhTBRU%̞e(N X?KP[ssM_( o'G1&M:M6b{kpj&Vi|PAkj`ӣRDgCIG {~.o#Oili!R'/)2읽@6 ^qK%n--vȧ~g\+f\EFU(YmxG64dX 62dF6\D&M.z#KZ\Y]v}qHsUX+)RڻCóc\&Lخo+iES{tX;^g~r^|[}ٔWjzl:s|ײ/6qI{٩a"KE%?|^vydr#m_^g[L[OZ)oqϗ~.Cxʙ˻{S^4Gf~[ V xR͓ݛ>n`Z*Y[ޑ/-+:%mxkȴ;l+B|cvnMם&9Y>;k k̵6oneWDucv\;N[NGJ>p|oiݞ {o֯Η;n~G$-*vq{:NvlyڱסRW2iO{NJ\&8䋞u'Ra;zvUj\~/[ KK64JE>7ˇo/QoJwp7qeT]J͗Wniy y[b *555%իнC9(e6{k[\ڷO_.QڣTK(G/ãL逶@ u}R9)owoPad.ddd~[ (a.W\.66S]x^xw\"ҜE(sU6Kg%J~|ǾR?@ү?xgM~z䠚I}2Y٤tzB[ܸo t|λMcMpn;355[^ÛZyk#QsJpM^pV! ;36mҒ_chr+#KQȡhL}+TV-v11GmŚ}̜; pu}Ov;wؙB oP8_uoOs䠾ʦ<Uʚ}}sly~r-m&W. ڮv_ѻnKu>4:w7iS/N,n=Z.^axߎϻ:Ӿ|3BϾǽ1Mfh+[Mo>:f mS#ЫKpTiSo&՚]CiZ#KTśIGJLSh7O{x  7-A'gίW`[ÝڙF4Nq?iNS' c%3,f_͆:*!Q_dpηT_&߹\ɏzi 4J^ӾV%VU8:0qF](Vxzf9~s/w'?6nz=8t׸Qpe5FLj Z95޸36!O}cy}kJxO]['i><'L\R]~Pu >Rd! ڥpyToQoƄL0O7a3wv M&]I3v6;?cZ>nQV;n:M-AP\**zqpp6in/ubq,gaJkqT=qe®R7-v"8 ?_v([`U˻8G߯]t{'E!Xcқ(B>?cx?Y꣘ o!4GS(nRzBm;9{^^ r ^qѧm ;#m)}W'1ZN&J."Motʳ IA,Gƞ^|1W0l{_(/Aؐ`mή:,Un׳QV&2=J_H +5:׬Kn%^OН{׮W<L V>Q4Qq07 Fh4[yVoFRNJF. 7RDo#=]XROzE \2,RzfzG&Y#67l㩗pNG {fh(Dn=uSvU~!#)܋6[_plψ9側>)pvI:,ҫ^GG&qF_t6:ٲ쌄mRzHmx3+4GTI da~GS q75OF0_e Bqו*|Zl\kyL{> stream x]j0 ~ Cq]C`kn,8(!o? L`-}11.ae0I8oޕ&*-p- ƠK . xT ^~gj[p8ʠofF;uNt0-"K_E64j*gV!N 2OUP{,yJCT>? Io+ endstream endobj 905 0 obj <> stream x `Ź?Xݫ[eiɗ|v;C$AC!)zPbZ m(тJz-*[ͷsjfvY@ -Z꘣Ohewd2C0pG<~|%rC7{%+^w|qÖ0Um8o|N_O-T;'N}lܭ#'azμഋgy%{6or?p:M#_hJߌ΋}Wm޲|Xz>c9g}+\ܣ5ggoynoD.,+Ci˦m#ͺ<!{ȖMȏ9׼cnK),/[ٴ?~]yq{@\|uL dK/-p5\s [o](B&$!8\7n9a(e/Z1ryN㜂3A{S0Y#I{ pwNдizALNjt=>U$3en iυebh@n36_4hVBs *4}Əi=LuhF|Q=;a=Ǽ4hAn _KҸbx=ڿ[,I+>]p:U^?kSJJb7T $itf.~WݜJ2Sީ1>O_\;rY-^.p}fxe{sg͚w^ RvR/Ժ:M+M`0G>  QL4G@#B= `0 `0 `04l9wY / 1wH{1;ThGTS<:XUH{מ띰N ϣlX~Ѭ~ZpR{%iQ8Iw+= kuu8\x/ 7j> > !~JӰs1sa=O>ڇ1\_vz` qP} a,hWn)8V[^]kDovv,]_.˴+\_G>#vX|G ͼ+z4M)7]+'xJeDqUFښ6Y:"6nt.I Ðv26U\j6oc.dv(<^E`0 # S*qDPf5zGi((h$i:MJGQ'iAJC6$Cfi#]*Wjywd0pxiz׽ho I@HF04 ɷVQi[_ J'8P ?C<(}E_-(?P?lP2Aa@)Ae(灔|(b0e%DQVA e55PPơ:AMu(eԣllk (`>(_ЂZQv@NX ?(hG ({"bB ('2"T.(B/eЇh*a y%ɿñrXCTQǠ<E<p"|((Wq(Or Da81*'Sy F$_Q~Sa0M FdA >485Wa88FP~6<6<- Ypʳc?V،?tǓs L<؂pVy8T~ ApnplCy1yɃ>p>(?Kp!S"W쀋Q^ (w§Q^EYKp]p9kH>_((pDy=\>j7P~ʯ._kP~ Mn&ʛ(סtn}nP/&g[o57nB;fwQ~nEoKܖ w7Q=6(';(A4 wBy?$O|c(q?Q>#0a*}_?{QO~F?P>Q>0$<|~|~ WTb(Q> ?F oP~ ?E, {*PQ~cp?“(_埩 <9F7x&(A"K,ʿPߣ|C ʟ?WɟkpTD<7O( AO+P /|! /d}z>5ڧFצ>i}?hڧ>ڧBWhʴ>eڧ}!ڧ}!ڧ}!ڧ}!ڧwէ|}hڧ}ڧ}sOOܧ?ڧA7hߠ}O%קd}:Y=.8j >R] ? /o`7Lh"L>7``yo СK?|KQn3PuP S3ZH!(+ $-vZrdx29*M6 Ga-v Ȃ|gAFTIp*c*hq^C'y_Q:pD\ Ґ/Np/|*PZo~oI-1JHt3zZӺCnC $0(MƝɴL4ژw1*it30LQ,b`0,0 #O $sM&6f ZL C Q71!(FPO7cO0րonFͤQk0 fɈػ1ਪF?Aktz-v.#F3ӜtZ;өܦpT"0 lt3Y)T7C.h26P9-z3F2JN&Q0tI[RfLGjc%PLfj~ F>pb`0,ו)H $flmk3X3Q ::2Y,zdWWcC( 3]uͤcIa*`_\dHF*tam.lgbZu:E6qM({b1-I1m>n$P8HUԟb- h''^"0 TFzL7s)H7c1ZSF:BvVf,A#-fUoEZ޾HUSLE%ڧS9ss' l<(QNRʹS z@Da:St9D jEqS0:٢iKYLsՓ@94A2hBP1(༚yE`0 # R?G$UȶYgp8Nz+l h7VZ6),mLEʂP S9J-N l<(QI/O;% \n ngaT80>٢i]dCRǭ~Уl9?n ze qw*щM3PJ*dz Jm:m''ּ0jd5KI=0cnQ*v Ȃ<+LuDRP%qXP.:D9MTcvS7ElNSi:]" QSn_;O,kԢVeP`g[pob;vїvL~9At;\G@j"U٬C@x*gr%J FC7>u|F]+ynXN7.f75Vnq&(%nUU7S8HU<)-\yF]`0 KE7S*TI\6r@asVNti5qv9vЗNfG @Dyiyɏ R LEUZX;(OAΝD~ܴS[, )HE( "!/"ACASR@DoE4@Lڽz8HUlY<s 'b`0,7KeW*TIN/ P8+ `ob|R( r;ʃ~@W~%e,ApԢVeP S㩜9ȹ66c(`ڼ_ZD9V81+X" ) t qkR YfMH1`g;)}+M=AwLNs$~jz]nܢQGa䉾q]`0 F;Yb}P(wH zT)7TM[0)Aa 6K0X CVo"\dITS*4EjQ] ALdjyys'l<(QZ6Vf/O n3T#X, WǬX6VXDE ng0.p7ՇapK[RdTNiJSO]l9t31AfFsgsGO}b`0,ȗrT:")TxD)o0X$h5hԂA @DÁ*)t+BV#LE%莦bSUZΝtDYxf-=3_CR:WCՑx cRu bDbDتӖgFQiQ}+M= T\t\{$I,Ku?͘[nd(<1, FV%$#t*['N%JTOr N:xQtmQtI\ )Hm<6E)otū:(.h7ۢ(|-H O1fԩ2Oj+'iP<@d$MKcOܡQcGa䉡k[`0 F+}T9" <,H"U[ QD K)FcX$TUB UIX)QT:WtZJ\J]Or +se>[S\R64777Զ5*k;ST⭭u9+]ݵ@Wji Ls4Y/PbM\{$IlZrdx2[;{F `dRʼ9G$UꊪXUeUؚ_1?JVYjjkjqTmWAj^mT+,!tZԪUtTI/1JuQMl'!Yp–Ʈ Z] [%JF3誝ԉ.L['a0@k]JMkB$6-9Y<sGm= #O˯+v B?ʻYG$UH6^[WG(ju ״WA;/*|ƆxfoUuPWH(h"J2%^hOAΝ,c9Fj"մ_M3no5vmޑJ`k+n;$t5MQd>Q0m>n\Чl9&&HbjG9٣0ĴjO`0 F;Yb}P`3F $ͱ\cMMMsjqP$|--Mu kZzڛQ͊ZȏE+A%@otOדWj9w2seR*i헧 Z3Z1hX?==ГnX;:e;:: ՟ژg;ڝVbmPNs'TԚ;s= #O,&]`0 !0RP%YPւKsk[kM[ۂm}D{J Fζ棻zڠs,XH >:sf7eS9sJ w=0 ~Wx ^4vY}d\RD*]0SdȗbP'9413mrJɃY d_K>|39ܑK~G?xn|[>ҫ|Yh&gCpl#m!R@^Zt}x}@y0*kju M[ZaN8*ˎ<Zq+O8qCkL&Ӗ-pV\e>sSKszorތ )?Yd)?fM']Ύm-5U輈Ue~v9fMFiyNKˆDpB[l z(<z-'! hԘ4U^9fo&F^Z.JOBKkKԾwQn -o^"%4IJ6.^5L dFm _t^oZ8ҮV,T"]4Q]BJ+lLFMB?0lNioѫ&DX?\g8n(%y80% ߅O:1qr~tt8GGORF\meã0 ._%anek0K +y6EK c?yFp@w_Jڑ%n=^ljHC^!ؽ6{b*-2aF3GVCJ=+DB aIODl nJlq`xT"dRJրK/NI+ׁXI=T5 OuuxTXEԽ nat( c; $B' n ֗AoS7LBC<'Qw“2?u-ܕxg$/_]~CԱ]zKȄl _Υl\9OCRD&!KB[?=rėxD\|h}izP P?! 'Uьz`ÄVM֢ mcפb "{#l$PtՁ }X,;qWYwp ܌^;kKnֵKGKW+ob;ThE;N"w.i֣u|`%͚p`OَGy47y t<&2,)܆ mxd{Q>&߆rJhT-$[Vf;y Fy$m`-_b.A_FaL}H vWKo V h8L0.7ZD  {ѐ;]^gݧƚd˸oYG| Ÿz_VZqز[ }T>4'lr>~[ ok K7Ivx^Єϛ5=Y=nq7Wa c5xϢ 5 9|v_\/CtM8_ nu-I_$WEV[>#C|xUG U5Ќc| .~m?5(jkWbȕ]hnB;V1<%VӲ/x`{Pj70nǜ.?n,?f/mo9^>Nw~_N6:~'5%A<T1O8F7ab{$IWC7Y4~4NY rcbrqrA3nn/b\?އV\3y$=!1f 1]+qwqw@9V@oW{1= wm"3q_ i^H7d NvȮ>n[лolnhKR.Ds؁avlڃ.1m{m'_lGy3 JmR̄Lmx4q1KlGi"뷪[n/- i4Y 3!a06u4BPAd\Ot$naS$BA!q!# #wv@~{ֿԩsNSJ XF@4:hDhGoD hD tD AmDD jQ#jQ@@FGPB* T@Pu " B:" B B |§#|!B#d@Ȁ!Y_fH~@_GD?iig 9 :(@(@ꐣ9 S_3ج jH ^W bÀ" " 0 :" 0 :hDhD+ ZѪ#ZumDs/ ׊גx^Bgr%{P^ލrO/blAr)RDܡǕ;TCH[!Q'0$A;$()TS8Z* n_ q|5|?O| ĬQ0-h;H@^ߕl!\@G,; obp\#>HŁ`:R:EJ7>+A(Bj>HŐ eCJuYоVM H~H>:D YEu?1ηHdd@GFj(udQ%܅2Wrwr ^+^P@C)##*f|#RX 2XNyrR2MP@Y0P:k)(QiR;Pt(%2ceqhtAǵ,VʀrcAko›+'׆w&ՅM42|/=TOyL~bE]~čDƊ:hvJolf(L|ؓQQ]O hg0.`0XL۵T|zt6}6 1hV>\K[TN#E&ي_w`}pOM^mR(6+m&?*;5|S5!в9>_@Ü i9{~9u~Exej}؛MzXjE;zs̔7acRgWu֖lWǪ-Jigt_x]N_ѱXt2Lk"*5"U7XI(8 ~ʄ RG͐r 􌾲W# =x+"ڨ2\82C4v|7G0O3{X~tRB@#C߂[p? Vdg/.kۋ~UP'ڃG9,H &d3Dѯ0Ml!;{{H-h۴ǴWc}c ;?Gx Fǡsg(Kq ~,~F,>G#G|N%d8&)b0ede6jv:&s۹]97_ k?D"ՐP k "Hrijy=G ^@w +qo}x$~?_I9Lfd YG!{!I]L*d1 vRf%8a3gX56٧mk7p=zce2Ox//^(jGb#NY@گ!t0$v$>`AXɠߣ2Fu@[נAi6 camAT5l:?%oZxqni*ف`P@vT٩IqЄb7%$W ɥRXdz\n  NȰ:^O- 2ҝN;;.{QQaA ־#/ozq>gonz/srmшjʙOOZεwn/*?ދNY ~nï g$F,wT-jB8XՒ!$#x)#jiSMt렦eFeer s85@ e{Qq>!ITܩkz/0UxkpjH!6/j۟R2(QuJƫ aX@mdE@&S9=&J]o"~N}$SX@|-!f_%޼m*_&vvd|wy1^45 GC r즇]L*0UB`:&2jo[k<:Oa-\/,>ZyA6S)m~/Su:Teusw"H*2'1X6Hl>7qSuIvf%.7QukC\R_5G?O6QAOhlF y.Ud\)[e3?*$wn珵!ϯq&T =,k36l˧Fj`'ú<5W0:qtTl[{}(/cGG{F{4w'8TA3 $>3qghCIr/iXҲ5I>N8ID6%ɰJ b}|: 6#TŔk"&v6;'9p`UI,M1l:B JvXK( qzZVK8 $vPӟF)@zQɨX{%DQ"h0ؿzlيA6gy5]ΐ[Ͼڅx}Uvz'Kci7Μˊįչs*U$* A'Լuœ%6fp]Oݟ{D?|E3b+f~Aj6cռLfDSvb쵷%pXWA5ۖaza LNoA٪V+/U4oj}ȓuUH$~pAhFa-d)*0؇nW8i t7A)iUX6/8eJel" y#,8r~k o_xEn0tkn{% ׾; e+dF'\"Gȡ:G7ޥ:VEΕMX8 '8uaՅ]^Ewl|(*ڊvy[_?h&p!oukZdWU՟ j*!P+f`iYUfpj#9Йs`v(w%ͺcunKڿ;7>YYtTtHqY\'nl㶉;,;-]C^9+V˝{ɟ:p nEY ,Jh3+\?meVRTbn\ݹcL,&sKr_ >'1#{8cRD "qo<3L]B^Lv_/p߷}yn Lld''Oiܭip^\zڰvH4_7H=~uX`7w_3~hfycP0E6+oXEo[򶌶;B]-8e[`sDә:CWՉ5'&L=fL5dvGU\RT/)}RK:y<}LKz3{U_цA>tѤND0HbpvMMɠUkDǏa*-nY5 &LlM[n|ƕ\Ë[\w)3gMn},[pϣ;-q jQv:߸\\/vm6^k޷ڭ:,${p-Χ\'B;) ʩ>PLdYWΐҹAl)5;rBL?jyczjF?_dy),դ :/uc0e̴[r K߽yϤ @?'״^^Vm֬ݮ=I|p]8/_'GM`c !|G⇻ȋ^A)NK Ga̴},& 0p~$DTτLE7W!>Ɵ frMQ1WfB37s xLE I aC+/Nj՛4ҠoSޤC:aP-@8H4\^egF14UR$VKD!i<}q+! 6)wd=N3L)+=ԃu.M uoH_6N 'O/:DՀSyV Q5 \ogH];d.z\ur=K|~z8?8o}(SZB˝Y_XVK|PӦWǓPxHMIE##ȯ _lu%cPSӐӘ:gcNk rw<ԙ=l'N}Ӆ`OiMGWw$SKvAk"ƫ8|?/\1?<8E  Z7Yln i͌3x%*ozl'GMVzIY ^f\5PY$;+4%._S2OuSgGp3! H[ѓGG2Ri4q q6s(r !YL:'drOq[\lp?:GFV~XiyU;-V`AWe)le*]yCIg 8NPz +'_&`G ҒӸӀT5=~9 aa˰2JA`yygޗ[$ 3}7v֙᱋|}sv3  V׻M\5Y\J\E 69JnKEOndJc?j)C2~Q ebr5sQ;P_KhZ\CaE"(6 /jLb "^1d$Ɵo%c"R% DFyg(m/]lwn2qiƴֵ&A]|eKȴf38 v4x ]^tߑ?&QmSoB=031lTlvlfږ̎cYPaJ)dpA1?h֟i|~I/bGHST7xB40% V\cu0^Q)#+뵭{vܻ?Aؘ?TTٵ_?0$鞾uiQ0F0pq+j 1R琙 b<T>Q OXYޅ%w)4Mo 9-V"5ҤWW)T)V:x8*jS~l"'AP"8$Zt: z`6^W&\șpW]La;F}Fn0"ގގ#Lp}ίgK&}Gwj1JIrwF hЋHEz>h,O?fr٥:,O L‹r VqE?m6- h_-`d^XȊ'ńTx3bjZ/:5ܥҰDd%S6杓&ey+"o$UÂ#fYXA ![:j*r֑C5e9ɮܫʝZ-kcPVռɓfnU]./GTc| V^,k6bQ裦^Y1pfedذbpKR!iNKFMxqTGIgO |\ki\&HgH} ɵ1M6y6|G;A\mێnsqQqsaѱId$9eN(bϒ Z^Xۻڿ***pH^#5F8`H(*TQ*4 vv“НV>wwC3rvow˦A{iջQZjh;w}n\+3ܚgmwY* (rXlB;_.‡zJu)vqr_XO*>|=y}@d2iy0-r^6W׌?r\O#>K[*<"I@b\sg;\c\WI7h78h+:lvI[~=9ukV{DYp*PT~rNr.r.w>O;\ ~cũ@pNv 4Mw;Ca+$Q,Yxb%.%L38^' ]y`X#GZω|q~N&= RMA端~nNfVo?a &}?*x~|ɴ^7%;9۳po!_(f,.o.aѦNqNI%8fygpEÛ8KKsfNLLLx%I:;w$}R̨zI$Yg-jޔAU-Z'Mߞ\ń=IU'(45lFba4?5L. V+<7Q4ƈeiu @JLMX eC-R:e *NwwoA_{ |7-aml%:,4&s.fMt G$fv] 8zk6]:=SEϝ08שa}/s?\k 1DsIʢ4U@$1 ,:#3Ō+>0l_W.)G!ww0 xgѽ}֟ubvL;~-xm;~X˖Vκ݈կ`ٜB3YT*UYt*ID.%<8Y [4TE)8zxg+^;:LpD}6++ v6f6ۤ?i}tGƓWϜ9K tzlBM)n#)r.%.^1!k76?יxKt#(!d?LugYzuH0BEfaNrpyT}Ly1ILPbp!.9zOKяl4g_##`&1[oCD2]%OJ(OhEKFY mVҶ'x@ 64UGGQ^5F*&rzܫ>@]};UJ?%oDR"j/eCX8| Qbډpj _`O4}BeCQD큳E.K4kʕL잶LuO1)%OV~@ʬNGGp0Loh:JGX/Zp/>hz:YK`9gкi {5ҼD="@xޏa䧡[z&&Jj "1`yNPex6h%q-1XNh:gV|hL*>l.z>}N N/GѰRoq{p8+є/\~bK/z7 %\Fɐ  16:`LoG<ʐHsԬԊԃO77QA1L偶b?)_/g?q’z-1ef痜+%,ʎ(D4kkGwpL8K-Oc܌a6=Dr;V׬+׊rLo+vlu`}@Mg00&dQFtהgБCφjvtN>:,&(de*cBoJ4E K/L{A,¦Иs08lʡC˲)KB32>ZjIsK'rOȃu~dt͐? tŨ0hCmYyת &V SSCKfW6<0|h7;cF/bTq:585V$֒zWEZߨC&Eu8FA O\Ƃ"T.|E;Fk#;6|9{oby(7rgs 0363I=0r:.Wȝ^w[sw-=spCq;m[p',ޟ=Jmh{#{s4W-85;7x{G___ }|cc6\4;484/V +\#۽ۂ޽A44u2:ktz&Re˓ © 3GL3:fpx$DϢ8W=>1 Y3q=S=:;#aPV?_ƎD| l so_vcgNW֟Q/_'M~[_W$mM]כu@oئymmqFQu|1<cMMgQ1tAWrBTS\.XKu'.G 5o!9oc]sչ^[[\[<^o 0U\kt}Y]wHkW-}-W4 w'<<}ż?g[Y ]s?97fnY_.lS_T^Gb:hWkPqFV \,Dtzˁw|iCQ#+!(}&Eo݉a/e{#,`ja&23.4]`N(pCgxt.Ѽa*M2`+QeьE[H+.+ [=t?lf 6`V3O*Wxie"oTrW`f`? o-vVKF9x Rr҇:&F,ehlZ 1T9>pf"!֟ kw^{4dr<9Bz:xG-9na| 67TAbtƁAN}G_]iX "7$}ϯ*5U2wg{#bN_ gp]CA:8HhI7e4+倜Dqa&ç6u\ĬBfl=M85kBR+O*nbcط&v *xŅ+ ס/BLb(|5Fծ6[U7xzMf`KYӀސz?l͡k= uPp {`0%٭9첬R2?CؕSHpD(RF%1`0AM){#Uϩq{;S9~ϱʱaK\-]\[geV˅c~Vd iTCՀ(\v+T.,:ohO_zۯC_w"/swϾ՜w5kyv_<|}ԣ?{]v=23.ThG/Cy~C$<3# }~1rQ򒢪8MMɊ+>>)[1LdׅxAdFaΟ قkd"F[ 30;1OC4ܐO @݉t=[&ZcG4ϫ,b>o^۴zE_Ѡl JnNVh* Tv(׊P+˔.8!3pL`a`"Q%b |&xID|. a 3ii?^DsgǒOi=nMDO5渠b!^Y !_w;?׈n_q! $k)F! #/ 8ag]y82XxFTU'<֥,^%" {##߈xi_m=ۿ֊$`SZ) eBeTׯ\6/4+č`Ө+_Y]1Y9&(yT)哔Oۤ'{=ˏ;V#bidḓ})Hq"R8Dr{]tgұtU/Mґ?6dNW{#i`tfE_<@y_PyuZ-ECW5?E*LO3:^89$SL<M{5^¸o=gǼIYj%_7]#Ao&WnAd uѡi1J9f9G@j)W-6{I_=0{{ 8iLss ŸٙZﲊIj #,j\Z`> 7 {#BDmQ(opW>>S>p't67"y\=L H:h.3}v&#^]\dn QΗڋ7ʢTE{z e=(~޼7o=N܋{7m޵ev5֏hxfs0hf:Η6c1wQr~>vZ.*5rtOJ݌i4@G Wg>/_45@5=B uO[;8x\٫k[~gZO~w~ Ͳ Rh0KX$i9^*.Gu9pc;f$~XT8ŭT) ˼[xwya/Y1D]p4 ^$@mQtp-;B˟ho66Җ E=Ʀ.Qe%ImA>m X6VWCGL'ߐ~B~}Qv"yF?)Lamw[!]4KRקVzWW$*QFX}9~YBJSCq˩-DU(v$T0رkE+6x!BRDkC7U@UP4(^ŹeF/lHf~*s`mٌ\ނkj{|@VDHDAJ 7'hn4RQ#e>݁ˌ2@FO.WO#JgL".,XB..#;6s$J N WCYF'8QeB}cu琛E +2q ' Mp`MȄLiȬ אYZ+T&7Ihav3p,|\͜^hG 9Oo,{T4o 6 ~Gq?|X5 tj:.I|/ HW]RX 4c={O2[όib)J۴S_ҋ*3WN)+Kn `(P0klˊWOo<%U]Ýcm.)|0>? yyER%GŅB;B|;B|&s7t:4R`YS!@y? ?b,-;g&}hPStb̽.=ƀvt?iH<ښR퐖.H _+nӔ;@I&ߙ)~ZQ3q;G{Z $| ]Y/pxc1:тUESG 3P=}@ |褌OlO gOR4<?8Ƨ@+G/@S Y?a1tS4کʌʬD7"tP23g7$, (b n怱} Ʋ*'h~.rZv/M e $r*@7huQӫq*TEa3\Pb5OPp TejiL <9u.G-bt+8~ՕezrrY2*utM('D> (tH{FEL v&Ӎ2M7J3tRd aL G6HRS(# Aåf4VڨHJ)IIj WGkDBLMtY/P? T'P 4D :\ިn#[iH9aړX 8ѕ@8E׫# =q\Œu %܉v!p Br9 p:j,(mb~[f5;jp x 35uZξ})VFb0}t㊽a`0Lt?WӴv%l`4} `ӃNp,6!cƴ2ZP Ri, 5+ً$pAVBwZH~`IJ[1Ču3;v |8b`8c`.c\,Hz?fY]Bi_Y h?=eSUߩU,ٶ l XkOYfd7٫oѕ1yx@O?]eR 2՞3+ h݅4kz ,YZdkksi(FZ[bIoKTXk#CKp=v׬t$BjEnKPߚޜ@!1DtKa* LN$WBa{4RAcT d75suٳcb_-Tvl:97mK'[ZT䠺O#T2{kkV5[;nkS&Oh'ENtlk.Q`Eo;#}o_qܞ^Jо*:~RHo]BGHo. YASY "W,+C\z3fp,g/)O/ңu{9#&~)k"^)c8iYyE>wQrm;hr;aIq !Sobݿ\e2}vpO. eӳTq+17Ndeh9/g U+F~F T&h.ZVN䲕kg^ؼe%m޺Z&#%z Y猩.4~ǶuiMD> g|Wm_[B(ƹ 稣ϙ5?_y1U/m_k~S銫ί:Oǽ))NƢbB H#=d ơ?Y&,Oi)  /b7Vv=@-`wD"%-e{$RZ{>3 -J&r9!A|!YQSbHFK`tvȭ /4o=d`l^a0XE18a~yŋZ<9̭ q&+8M_0mӬѢ9i*vc®TUSwY1|:wëPZRMR ?!_%ZjI-߫EJu\OPkpV $ނղ/N v}֧&<j1j6:i|RQjAAɩ~s(z@q9j 2kˍt.=]o:XKK-̀L&p8l|K0P`}LV1HK [f6~k8)8o6^bזR ZXН,4;Y^-HêѦi_о635kzg?Wݯy(nbNɎ/_DP ؽsJIn9sfl.NkWJۗ9pǖIz|S\:{LA8݇`?i3U!y/Ȑ@I?vK[9=ؿuvypImOq#߽cțZϪ15nJD4Nf:^p^:տ+?T΅.''gAוI|xCTc%E WXT~)o- ZeiMi^| /]S]$T]VZTTbرOO2[*Her7Êz~V&7hڇkBkJGY)(Ֆ TE^=aV# :J2~1B `9G%ھ  l)W$z!?fH2SGI;g{܆'պ C[.-|"JbI-*a;*z| OP5~[йiC~ܴC¡ip]78yo[вcHK?QҍDP*@#Xba5c@cs1诿-0iiqk,R 5"{*䅵'cbQA{]>oB6zg7O۴|[`_ 0u+ s# p0J*!}O=~L%+V4WHevl[ҥ(]J*,{ Q !Տ`VAKK xdEa-KJ׈e"VƇJD9u `Sj7-95s]nc6U*bHgv-=gN¹czXz>b}slahӡoY(pc}Ѩu=ћEi`5ªK1,$@%)pIPĽLӅ o#asv}Υ f+V| _Fz}@M 5%nw0GpQ-ߓaTtiy@tV-Rڈ]"4* }SZMuSj]+wO[4/w^9[;L}S7yɥ͕RO.k]/ {xK:U[&nwV$dJ&#XL ۠Sh/`Ab0`j>#X U./iJnZTj&]1qO0FE#)1ٰľL^J[Qw82|A^~ fk)xd3{30iҨ/juΪOktXRRt<ݓc/2Ȕfi:k+xE0:) u%k|J&}5MVyx\a>Noׅwd/&Ÿ$5 z|z2\>o /qy]ޒ49Vȱ B(Tq4͈މ] kՙD%T/ NUڰnfWnYKɹwmvַ?{ê_3}\oɕS&1IN8߅{tw.TuH#_RmP2PcNӂ[rL,YNʧI #ucV(*fr\O7f&j9X.,oq/h/(vtԭZPgB~LF0reEѩ'MSӪKGUvM(8ذp=~7yd1a4xx`t 6Ȇ: ~H.mqBii4t^Jѥ@ )-/M˄m| ;$*9s>_MK錍nj8ރohxºK򶭥zIvȍ~-0A#UV0<,Eh8wpvR=3O/-sв &D(Għ@>Mg֡YT-Wi: <ޅ^=z@˒~0v7!p$@܁H BGLgKcrЬT+8%hLLR.1 T@qrMf8摗`"~f`s6O)}㋳ʞC9vm90/s-+$9ncrL&rcSC;b<8qTDQ$KC {.]H8v-E0>~]Eb ȡ-!Z/S IuA|h{\PiҞaVv۰fwkƣVk*q_uy.{fBc Y4 c<4&NQw/ ?LVQmqfflrD3ҍJR2\.Sx/SJ8f8hU>wu*_TVN"C<':™nDi隣 ape=2pԔleexP™;qP:ЌN{'P/UdW <={^$pᆌsX7%hjGdtIG{3l6RƃK6\CCtk,E.P_LǛKS1c,|c6 .L瀌)F/}2,WG2\k&S8fΎy1J!qOƤ/ZZ7 ɰfYVhζZ7ߏl~02A)ٚm4Rfg6:4=l$)E7aKMD")b~A5YF\o=:ޙi9?;+|[ }۟a9<)#gWwrbEKN4cQ<9!ﰘ`x?\HNcNGq:Uzw˛` <IZ,>d^$or2G0O?Q^V "yI9%0: $O xVb' /]/3vg$q+W$ ?=$`TZ ]-\Uh~Q8qIQr5<r"tzZ+FZ&IWz9r/?"ms<Ɛ:O2I4K(ɀS[c+QER2C+35uTFhd#+tc+I=cZ5O>t_@)N!*?>HTZ>Ժ|iBZM h4pr| -V?(C8HS%);E5!*`fZR'8>|iI<{pҜ&,= 5oe5Wp!N#;eϋVRa<*;'%KYYv#+ ʇR32XQ҅p .L"FM6Ip6_B~31ryuE~16iD)4L7Si~3yeIf)Ȑ,3dKYT""I$F~-|Ig70gLZFNW*-u:J<>d~Yndً[~>l*MA\;[U(8N:֔fMJ:NdD2μrv:_ڐku{Q9+}(!k5 y y,< ` N0x?D_ %90 (B20?= 0 0 0 0 0 0 _ vw/(D(LTP~EE) CP8Tj - - m :3t_d8'ȌFM]cы^F_"1d6vq_|Q\]g!cu^j;} |@Ȕ `[wC򟗿PF/Wh*2*c$VY`ŏ+~Y0 0 Eup @cȊ"/%W±+k8i0 ^xQ'rYC&Op8 !jH,v T TIXˎuz#@ f8A=5p̂e2H˖el:*m (^`e+,Rg+8shW?gqk% #c\V3$H8* 瑕pr'$\@mC(Q|&*5Zuz^v{**YK8F2?J8AwΡlK#M !c # KEQ"~ W65c%Σ lڹMy\p9\;K8ν WP9pN+ ]. /"E\俈q"._h._ENo2~[_X#1 us" 瑫P䕖V] uc 瑳ÍN[( "B'VFϳNhw$G—F0<:% Ϥ2 VH84axNe*.opýT2 .dxOp /b.ᴞ)+GK9_#kGEwFJQ'Zh+ZϮL.w!HFkܨ:v{XN@--h3\j_کڷB7 uve/|=u >(hhC^7 :Rީpԍ@uC}|`X,gppRVƉ+()ZXr{3bW6B697\Oc Dʭc-gYvڤncGDQ*]Pp?hz7P%.TbRhe4Q hc-RW-chu-cE<,f=)KCŵ4i )bҷQR_KW=K]z2tױK{*^Z%Z~t{%t Z/Dڔ4SМts:*$ מ]ll`6-ɖ+Yb95)._A&VIzpv%䳑s,2,%Xƭv&VF9rR% q,E_3}qT!m^D9͙kbX\/Ϩ,>(oQ ڥV0]^'=%3CGVQ)=j4-y@W iJ+ϯd1ġVNiImFh#>jk$OEtbFwgI(2kg㟩\*nF.M&#k/>#"""$$4 !"!ِ@Ȧ)*RRRj)UKS?O)*UǷ)g"Բs1Hbr'{|f65+Q` {E/Af!*Gk+1b,y e8k8Tx~mk5 o2Jc& =.i:|7X*5 Ay!,BkGExl A7քyh+ \eB \B: srZ-wg_.Tnxq 7׷Jg3(L\-DN*5 gr!%"79Q"[/Vj q3Byd̥҅i(x$%HBk٢dh{:rd9^c2rf@)Q˸[HDc9׃34*UtHYh?EM@۩=>~HǙ,G t[mNƈ҄sgg\?AmC2sI#=˹~rF||i8BJ:H o2x&F۟9 bB{IRg|iB Xb6\\HOM .KXZ3n8*e/AƓ2dd!刵gZfyD:SXb( fdai6?c X^ϐ+]S/\ B'|\/r/Æ_yRo2>+*zBIU\{|Ux]US< |zF4I[K |or懍qv}WRV{#wTO,(=%z}%y%eT/V=`K|+AG"<>WC^+,-ֽN sQs@08>6LKL %T[Z\P(,!zwAq^_-+3*|yzve>1#ee%Ř_"^ԗ-+1 SWx|'Aqz^i^+|eߒ 4`g@k8BCBq:ԍu`bK0-Eť%ܴ,4V/8Zkbs}<\o|B (F/%|U}ěW`^*EW++`>M^SRf(t, B?E 1xUU-) cҠAa@QEEءC=Ky ⽾C4%o?+̢7Sci\͋WS6{3WɟU5/Np*B_4SpvjKŅ{B*1"hzA%wr)3{hRC5]N#5-Ȼ9r7b0@+Ʋȓ_0 5L~dqwL@Mү8N!7i_qV,(g1͹99oCJ'k⺛:Եم|C-X 2-,cCYpN41zV44='΋G\]*z9X.w"^9wE߅uH=7Dߋ&_/1`bBb 1n4<̵gW:Tq=tӖ[@zr_ -[, E>^WQJS&'dfzlFe'4qFV"G~\m䔿υF:tLwX)eIgP ] (zdMqM2J2 Õ[JʺR)YInt /+/7E|Rğ++lWEWE#oov*))E)qgd%j&o"~\Oi?#º Huf@g]XX!_!#濕WƊT%_,l{!ºzz6`t-{`=A#i]GzC7Nh/j}C>M|I R*9JRU6+;jrR9ì3FD N%ݲrrݚbnuìEu8=zc~Kb&d̏)Y#:渽=>^dbi 9f~V]~h5YU *uEݩUԏԳMFkZVUi-NmvH;}u]Ɏ\Gʱαűӱqq,s3ٙ,tV998w::99?r%q F8C qpY~~m%o + ;z0? mOG #&Y2,_YjO5CrPsʰ" B(ӫ%Lμ8}rD!۠Aٹ6u9J^{J0OH~X ~ -$O|.PoK~Hw9%Oe **,y̕|ȕ[R^YxWJ.L旭;BUCSq;G< ZCAF.CY:LћtNtNabq胫\7&)S,٢OzOZjvɥ*WH VWn5xU'ɥT4RiK̖~eeRc˥u,[!5BMjj㕲Jϒ\cUG ~G Z"=3Nx^E2k:i'[1]rKm/}~卣%_'ÒOHy@bE=(vsh.KdMҫ6m3Jq>(R?سY|vfIlJZKfN;h7U~:HG zNi:C_+VŮtVz(}8e2^ITҰۙN v<+g?>Gyk>(; I"GE=m$MxۻG X#t9*2Ce9J/ I~࿔W_JK%%xҿ-ߓ DeoyV{ ^-Y{fYa%䲽}ү}mee"@opv|&lxio<,?w',?aajߎ3,k53忆;B.,{]/?{[o_͏ƷѲAK! xX{i[Iuͬ^6uͺ![!ߤiO\O2Դ#k) VMja`A?V X ()#n=_㑋n+ZDNPOdjm9T7ڢ=Naa<ZS{ڈ(Z Z\#׊n7~d 4rZE:ܣhoQ.>f-_[ ]]'ES¡EǛ G֒'6mФUzTߛA@ؙ5 k~Bk-y_G'9[egzTh|:'ϐk˽c'J_ⱴXi}u(X~3S˓ӹ#7\{2'YM;>ճZss ͢p2j^uΟ3PҿܣӼ_bAa",h\/Ww[8o}H[k_=z&FO 8NO\^jB>S|Ix > j;߿Fu?8Q:{zP*ݶdoO#m)y?ǥ n jȮ/ယ!SGAm /v?!%MsPwrZ_/Z9*&N6ϨZ`iҎi"od[OoS( ;^|"-mVp(VN:n  vd\9j\cݨO+^U"{? NDm  N&=K4Fz8)bDft<26ZӰ#/!aik^c2뇲ZrC>S Xfָ$ߏ7RX@vPgfT[&?l4]˗"tbK#M#-B:wMZ}p]RTOKi_xm}g[yS󹔼S0#yn9I}Kcd;&aIF6 z+S+p̕W&.N'O95.C؝MթmN=Bmǻpy'6A {ö'w4l'o2?=q&*W oEb6)^}BH#x9Pe[B6:KN?YX+VF+ݥF@O Z|?qoRیi]ڨ߅}->EDh=!)oMK}oOcm3!Vrݾt!%b?^ZZ;^}*#hmޕo6LOmSS~;%\z M]5Ž#ea~~?ZKhSl7Vk .cZr;77fnod+Z^q]`;F"?5歐Lmq ~mgshZy󅶳y=ޔw?G:B6N~G)yrZ%}՚l~X{=49ۮ=h)B 4*Zߞ"=;w4-5vK[7A^kkٺx}7M,j"BKP՘ o߫tqoo7k -j}x~FxsгaoBnY}b4P{Nc=ژYc*3:ߊf =w5-ZR!P[2/ЗdԗPItJ3h6͡Mh/t^OXUq(`%N UF(#-Wוc;{_ϕ/?)f:h֑ub1T`WX֋7l0gC(vac86&,%$RT6,eLrX.f9f6[| "-f%l +e^VY[ʖul=OTVu]}X}Ds.WnsA!]=}73s 9_#ͪu:j4Msj. J]JҮjj mkôm6J]njZMRTm6MK2L-Kr\@hBH+imVy2O+*JJ[-ӖXm V3U i +V(E_ )puENH%;c٤J2in-N#6ܰQ,g/zއ XAK:2/p'8U1r²UEEP{)JXZoăG`uC;,o(]A=`#jX{į*ROXhr 9( ==( W\zZ${zjI}`k+`k1L(E`,:ê;Xv'뎡Ap; ް+) xX~/ *x@o/K ha Hdzx Jwi4|d ]?Kc+x o&xD@Ct(&—)BSSi2j%·( 5c4~A)LJeT\MR|o&M͢tʀLŹ-G[)9f?(>Z@3_-"]D7o\n ]Båt+Ke.*ʇ_/2Q!||=-d^I*Z-ofZJml2`]#&ʁ ? `/$ZxN}CHT%?Q>SΩA;5r`':R`EGZ4-n8iÅ++sv%F+%vU ғ\^(yv Jk_@m  ;9i p'Z?t7h @Qth4"]O* @Xm, 7j7"6D-b%@)%EK@T6UJŦ& YZ2gj=KB dC Z.}VJnį( pD t(1.F(@hvh*%(Rp8) p)G,,P хfR `WvM8_Ap\Mѓ~C{U` uG 5*J<]+p2LFpp 0Zh}q`ǯ>*_)_ Yf "P T&Pi(s2'p\@17s}bY,3 ºq8r]Ǻ@n;X6\` jv5p' 6^ڵ]v]8MdY`6g9Mb 9MdCh61ǸDhIђMX",U`TRMMX.,C`Y&Xl66q!+WL_~5Gl|Xvyne BG}x1fh3%((YvO۫Wxiv;`Og9ⶸ)22:FEZԘq%٦Qg[-fRoltM1ORۉՙ<G79n+?$ێS:4y6|vsɨ ; }!foM6˝3%j@TmoG&&+*يmOmm%c6\󛘧Ry']YG+u~Y\~\\~߹qaumvmfR4 RЄS iPh9i~-H 4~NI%]A9r.HsZ;BNiNڊ:iNO{Pۊ퀼 SHמZ/#ȧ!}IH;rrttti#^P'Z(XD#ّrrSWq xGc~Q%i$֣ڱwlT86mb:v!AhIIjchHkㄠ9:>tqʃV !Ɏwtvi?k?E y4HB$($pr|A999 ~Bg;}qBUε8ۛs'&ȜH.19Ap>!Z>IBv>rQkB6<.(hHs ڰ]ARvԊ8lyJ[L{yV:6A.Xb!{Ŷ6:$4*~8/h DAS]qtվiNEHs*E}ऺ]+\C8Z>ЃH?q̵յڵUzXy]7X~?o]rrt9 p 'ˎxAoso {G>(cO9>rv}w}:ﶂ:|9@n.zH#ixIc4u;KMwRT^_^^ ͽ1^F ֹw:=݇U1p?v pOaWkA3]Aϸq t, :kkWO rՂڏEs>: cqaFĎ$u;^;^ˌMMy>BK_XeW|ͱ2v-fG鐻nPm`uRrnw>'}89Ղz4 AR/@^CqAםw4(8S)-3䳜3:39AGWuU_xG{MiJid(E|4F)#)HaRH#EĔ/1E4`0 M1 4ҔRiޟZbvg}gsFfzadzNB#jo5&f2d3fsyDhFi!X" umQM7261eP`7o@c >4.k/:]ov83"F5e8G_:OL`\}aבs0ħ9bxyz>lP~6-9/$ ev> ITʌ6Sa7T2'3FrY`es t;Ȑ5J@Y9q4eC 7LF"YŐ̍36lN? 8 hh" 3f;3ݾ k:#g\=r2/iD1ӳ'j0pDKxE8O,$q.1'4}=S S4d^<ڎ ?dI'J\ .L-D ; )`,]*\0i[Gbb2N+R@&[O5 n00A p-S*&bD'~ZYKW@xqsXi1 rO$"0UW귈36qwRV,#*xvd*$1 unSb`)MLǔil2wo_V$2 _2N#z*x۔9.A:t檿Vѷj!Cؗ8Ŝ/kg6O*Og =twJHh])ZI ^'!yqB% {[eN}+qeib0W:yMcye^Xq6[lGLGL= 4c!qfa^q%HIkǑ8m䳠U[`aNJs[aOx Zheܒ >SؒSKGx=峄$|1[og?$y9+Ɯ aإȢa(VDF b<gk#W,eL>ZWNp_i|DHӓy0Xr[9 GA],?*O~!+GLed!7s%A>5b2X)qA/EA]F# aEci`\4^~6 4qdĕ?(CѵH8_jҬyM^d=Ï!c< u+bŻR}$3 /N/! tx%mԎXW-2dOC[C!RbOsK`﫽l?ih{3&} 8V5 t%<=;/P#>}Sa%}y.tX;[92i>v7e~U>R/a'"-!ƺЏ3wA\v+*DVm⣨w^Z 绠RL{@9>m*Vphjp(6+#@~O/rx/Gx3-DTGU*o-ac>%6<ozoJ,҅u$lfofᛆMCix4PĴTa%cyjx>'?.\I"dҼ tIS4g٣4'9>,%s>T'a@6%0f`\4'"z@L~H I#y˿GRA__:3ٔ4/1S3:Gn'8'./(8m.z:Zpj{7p]$ySJa\X( X%0^{ ŽaHrDԛiuF"=TX"-ًOj"/ڋ$w3d97Q|Їϊ>Tdr|Q~[)|RZԩmn~/oV_a/^}Q8"-q.PT&K{Q𧿓~YC Dڧr-> #O9$@G#"#S|-M$PQ(($оV$0MDGM{n'e""WPPQh)g3 = ٯPQ((kWÞ탍 ByEBUWi<PZGѻ4N!JǨ#IG+}S;}fUK뼘2%UMVڳ# G8G9cHTLmbP\, b m>#Ҡ4,+9KIΔ ّD8ʕDMDe3y.Qj/\Y"xm"yi@, u^0irK=a8J]dS/Q$eH1WjSti)#+H-D)V*$iVR-SʔHR=SneHӥ%@+JY=rx^/ xA$r:+gJW% Y6dUKX9NUIbi Z V/ng[\YP~o,㙖*ݚ9/'+W)YX%4l!b-$\ћp֟a#l%r?f.$'`,>aLz0n-)GS@ |ϑᝬ6瓽{zx^tf'O3S7q xpV <^`Z8m/tosS^௄g'Ysl^cyɵpV%ΨL’ ~!gvdy2^$~Y̗һҟAgIy|gx>Fչ@Z~RGU~u꧹R F 5i;~紫iJM$s 3>QJU_V/^uN~;E5_u|g}Oq_ޘM;{s7kή. #-~]B{Q)CCx/ .$Q}b w'LI{3~ ҹB.%Ӟ4r@VdX.P,QO=b[!2]/K.i R>m)W'i4ME (J~sDZ.*zoMjz&ǤEwyQTFWN?V}x%Aڗp|xݹʙYTR3gD7#S*o!0?ASAvgQ /LN8oK'3&>ȌML 虰p7x+0ǻlJ)z3XrQmL`J@ z)1+ ΀S׀+"Ы o~g:oSi?Jx 7nO'|~;w.8>hY?F ?w`wϰQGr#Ip&^`Z:lB 1:՟ |Zq=A'2̅S_91ܺ,ga=%SJ“µnr.$3t~_L"\HvD,Vi f)DN )(ЕpDxz˄!wwV >}Jn>}{Iv{8?P~(ƒ 4]BhV|P.|U$|>C^>Usz>3W^# ? WQ _kM.qiLG-ʿ ]y^cbr^yCVxdznoQkvVX .T/W_LIMϤS"bKJ, q{$O7R뤌o6H?N=*ݑrjөWS<Ɛ*=֧ii~iCkiM+-fH/2Ap-RWƸqҫwf)tZX.ytkɅJN@g,&#@0`Zf%e t-"XB>+ ֎5I`m I`mIC  AHqShc9I??9Byu`˻3$6FS:jRmZ[UkMDi[ߨh.mNiGZM^v8,sIuEhG,NHO'F=G!N>ѓR}*i[$N>Wd8eJB%^oЛA};iةCZ~ImeDC`znhmD #6lL3fFQl,4K*Cĩ4R[n=NHxQc[mFC[j{{7c?qj-kGc l"qV _B6^5%kf~6LnjcvܜhN!<ݜs؟2Tk5S/ "kqPJLUmygX/c Zª銾ڨ6[Fՠ5ZMFdmvZ}6hA#b+ȞNYj['Rk٪m%:{vukhz?\׬~[/Gqz(9z}V2yvP+.ퟦWg iEğjv[Cb4EŠqпȿĿX_mWKk5į%z;m39ֿܷ*f!ZӶOOE#4#Ұ,WWGh[ZI~B30~.gَl)sDϱ' RZvQd/0'^ z:V^a!\moH~]go%nwWd $؍m f3<dqrmw%Z$>g_hٝ5N}Ⱦd{.s36PcY+ҭ@ Zڅ$jUSA}_++P(3r)×yk8*( T/R8XhZcf7zu1mr 8kvcVgQαI{}zE`@ܻ>p90O%AmQb'[inp"0B[zG3\d~g3L+LoqfSH<yIjY6֓ͥ"gK,j1Ye8zHku:N :zlAaNqk-ߩ8瘳J[pV=)sw;+U!{P fڃA#07ۃQ=d[NS+N NJm'8sX KdRg: ~-Zktאjt ^k271m7=ZGp>3l w˂{3`e #(Z(YJ3 ^^ %!%4&BP<ʧv44)458* ݡвPE\Zg eNm m֕P=w)ZB &gQjhgh5%z_@D(N.t2 ·`eş:CCaǧJS-)PD:̮- (~  it7p.gQtWxg OGn$LݜÕt>ް9Yzpa(._ / / /CCZHjD ^r^ѻ!\;7v*-$ ~µ-Fޢf&m̈́)˸暙:k~pO`$R ;hԆO3dmOul_Xx,ʊ…ƬL|sM'%a!"YMzS6\ ֯WDHg#c,zA덌7fE&6P+#S"#݌W'GU fkFqdCڊMH~TpNdidEdnv|Wd ͋4P Wv+WdpQluqi o4j-F=i:ȧ2J'ZL"X>(Do.Vꓢkhe!5W@ttmtSƧ)sO;6 vfd|E`n9#2 m=&EoFDZS-0L)(gRthL,z8\hG1S?i t碧gghuѫθPFyc1#ĢDvNs\(#w^;cSbccsbb ̭R{^<4":ƽ#Ǫ |ӌm[d.5Hw[m[{W-5k鮊hlWlo=;;uzmo\"v!v)6]\=q%>&xǍ!Oq49>-OeKb7,tgfH) ΋oD~ytRU*s0'^Ʒ2)2NYxU|]|c|s>ސ|:'&<"Z;g?~ ~(Nxg}}'=>wE'x^r-B|-[[["-P=Âxy~:>FMW_Jlxnyz n#.  z){73XA|/ s~x96|'UF=Sp?|~nL=l>DzE5cR=[+=Ǵ2Gnx EL+@WCk)g|khc1 3)(zfca?,tw~SaN:8e9oAr$@ra~_@͌| ѺTXgku-{p]-= \3?Vqh >OzNy:t'ɾ %d +xw.*Vh GaŴAKTe=ޛH>~ XaӘ}+a73?͗TQ A9v8ǭ2ѵzҡ tlhrs Kg\xW{ds(&$mF+2!WJ︖`?ƺnCf}]o@ 5@{IyFN2oEJd~ 4!gw*zy0Ⳙ/ ~kN|dNc]DxMy-Qc^+1 ' DTX,S](7R(lkww+hbYa{jU3㎽V|ݝ螅ْm6d,cyyMg@U;(*wJ7qu~wcF}OWxېV&4?xgbz0}-_ss,4=7=޻ƿ ݂լWCwA>]IY /ិ!=` ^?@l͵k1ءOd3^E†#< : ƭ{B|laSeY?<="7ȟE"k6"-P&][&`> Rj1<ݡ)dRh:JEو|'|[+Qj2j!bt^S ِGg&8X^lx{~)A^](y5zg'?γ_Ÿ?D$|ٽHQq`/y~X:8|Bi&ZfxȽks_4V^6^R|܆+'V3ǽ#>C%}\*>%}礅҃Ric?YZ#m/ E b\$, Ja-F߶xo ͗4LU~/{i{j_uU4'*+{'111bJ1"E"R,ES"1iDD"(e)K)K)G1e),RʺH"RDH#)K)"K!,GSɞ3/^^ |ι9s;νaq]=+fo]B>p{W?x1 ^'}.bcE7Q)=ų/b>#VxAt|VyAfQjj*ooe.aU8ZXʹ,+{V~Nhxx2cklA[^y{K}N-R[ s{D2n&,) 9v[~t>[-h+%՞3n~~1ͺ"/B^.0ַ3!4OQhx9K;hE06_@."Wh2Cg;vf;#\3Gj^RS !jELh-bBDL; }cBl 8&TcB1zEVFuAP$ɉtHHHOC֗K#H}}I:$2 4tddLI1vp0)252( M2r-Rm9̋,]~Xgl6. ( u>fxc+7"Qg>߯ _&.Q^s#[e^0Oߖ]HDϛs}qlzl`;9դ ~jiN^mӇe)/cLT$8^yק:(x/͈fEs]ݛW4ګeR݂SR_JW6\%bͶ/~9m<:4:{ibL`tT?N|]+Q^VG'k룛[;kFG%Z/-g?/ŜX4֞DzcyXa(#;/6 2&VB2er7Ac"u췩T>oltl,-61|lblJlzlVmsYJNmSU(67 8Cb+bc/60$|:.y~ 4Cu?3lmOc{cñcI)v2VLC8'A1?^7> o7$>,>2>&xWdzSnQee\x<>;>// +,2&.1%=+'/~0~$~<~*~&SdZ22s3;%q6iL8&HI䓔!)ߕiE ^?irey<\+xifHo?󔳹6-S$wS$V6Ef흑jj;iR#8%gvߙ}3/e94s8`TfCpO?*sBpIs=3e̜9?3qO@ߣ~//:syڹ7sUڤyvX>sSbN ̭;1X&6i>oỌ̡|^gQãW{a叭qj 9Z|on߭2/0m L[w5d <Ĵm[!T|ofZ-AX :ǵfo(~s4wf[+4_3A_fyޏo 57@R#!ήZhKKA]#[8\\5OA?BЦ:,г`O_' 2!W<QwJȌ]o:qm5EIC+P"Ԡb8h!Zc9ay'Qu?43|7,8a1ς4-& %@ @[ 14|6cmG 8Iբ%A@O5h|t1T^6u>? [ } DwΆ%o:{UF;6^8쬇^,=<yyN t;򿃞ސ!O7@D;|"xt' {VLsXE-:z_)ox[ut%] bX-^fM+D qXsIQGi=' sw@vdOGe"1RrcJ3n9I r6ΐ94/7ڏx_c# {yx˜癖7B>B 6?oõO-wh>zv{_D`sվdx7V'nQŊƵ؃d'vP5>T7$ܑj<_΢Ptw"q'ET@1H|V<(JCLʅVa&=k'?4bO6ٳ3u^L= 0rgWS 3,3uLvdkپloC'pHi{d{}f;*00'IMv!yf>vUkJ΍a]}`,"'tɻStq9=a M tJU}qiA ۚB:&k3$$sd] sF:c yN3>h}[rZg䵳 v <<ɱ*p݄v:9ݡЁ&-6>t!t,t_.T~1a#7 3pN#Ʋg.Pڝ5B}( x w w  'TT#͋fc4.ۇ8•LJ'gvx^xax qWgZExcxKx{xIxy<>ht O )wXhC̈́a4poclmOƽL㜀wv% AZ20?\,2.x$1;Yj=O8h8k!~%ۏ5jNDB{fs){s'pw6vH4'jGp ;q4,p{o:̈́f vUB~!!luwyKJa$ij5-dgƻI~~9jІZ=Sf֯g0\֩Vg͍հ 8Gg9{{UnV- Ψrj8_mZ 19wclUy52 *vc8ʛڒV7~85 p3fQY(u,O%j/T+ ^ j4ߧV Y^IU% \xaSS@^aoEkYTnbQIOv?s<~9^^H;6K$_]K% 0!ՖsAgWǀmOIѷ ɀ}_9h_RZi@Rm6N iPO9楑^}6co(~ZbS}J^~7^{ ?|C+mS˝jSDLW&d$CPy]90MP瓼Uט&kj@fƲF, ̟%0`%8:[<w Mv>G"8q,Jw kLHW W@hA:=WD'47`ZcaLUߔ2˲M\^.ct>"dE"XK`V5 %OJ[:}{Oj{mn ޗӤ.{ɾXP:Q"qTG 'ir&9ęOW,SE-~)Ur\O ZfMck;bjs%ѫV-S_tÃK 䯅~5ķA]cazF}K-x_QF_bQ< =w$  3yFA=3yVdԇ9өtQ ßG[EA D6{;$HvY^ډ3AW{i/{0K{J0܃nܨ`^AUbՊcO3t18k̵kux:hjǀ L-\ h '`Ź x 04 E2F U߯ LQ.:2&LPҊ=",m6CF eT3qWҫ4aǩY_E&0A_i?CrAB;:BG&R(nUlE"?)Cn:zGǧ{t;Q'*zGOǽROK2#]q ˰_FdD˘2S @y^< o7AFy(ʛMT,o[`yU<$o2OL|"P.Cy.bQ.%1a\&4O_.+ 1B+hJjEFh޾V|I$_e#_'E|U*,_+uo7W//E|S)oɷ8++|[-=rxFҳW߉;1I+__L|+j?B^ׅ.yp2M#mQBKo #yMtlZOsH簣bHl?!O[d&}Z{e8דSL5^iRT؜*3(ͩ2McFj%SPăi=IޣJuEVs)RiHM+PP~Y_+ȅCX͠YQk4x^_RA_$=[2ƺzck#G%hH~GH|hÐ2%r-= |8"hS@t[ .{J  Wc`v\ :r{]zM%%;;Ga1newiOG,ivp1W==V9toOy-jWqhz/d>Bn,]K"Fm'{.P;*-PlR ,[CGBF9-AއR=+c_%5jрK1^'il[*h{j׿Tx|y, -^V{JjjFY%pk44i=m=-4_. )1|Zͱ?{*ZhD:{o"Kf=3~7AY܅}n jЂ&m*|J N>z{:F$,i|: St1{V9~S&mFR!m=<\zTyt &چן#,QFP9E˩iӖSӦ-[NKrjڼԤ_7/:CY4#Zq8q}0Ͻܾ1iQ};rpVOaCSsK\x/-@=+by]^rMWv }^+ S2 5\ ~k6M-vuk]-ޏ Ά [.~@چ=NH:䎆Jh~ַ__1x@\+XKSRKu-p>xrxc1`1ۘg,4VkuFc`g4 NgLaZfَ 5;ͮfw^f_d6N͡psYARU4s9ǜOȬ6\\k'dn%*sYCPḲ y,NJ*[|+3ZB"g 0Z\sUbY#XMЯ,kZLZ+Kk`k[ǬJ:ieǭ:ެ ;dl1q*C_Ubws:vIm7;[e@Rv_~ ~#S~J${*la϶-BX,[f<׹KB5:{#{cۻDd+Dr+8W/Iڧ3p,'۠rr,ctv: z9}bg3؜ V8C!gSavDɭ@ok';Ӭf3ә̧:gt9rgYlro28;jg(ZgsJ~DRG Noʜ$yVϬq5KF$ep n[ =*,*q= !v=TꈒÀGCF~ګRH2 Ũ₼J`+W(v.U\͐Q"ƈCWدT<:H<㠌MjGt$YDjyzBO,""=رw%XȨ=JC5pTd,$UvTJޮ,B9h1yAԋMQb?K퓪vHkݤ#Cbx/! I`DIVՐQ]"MW~@ܑD{P_*XExQ%CA#6O5ITgU}3j{ͪ: DX51" V'W{mbM=g۵-^y16_\{BLmP^q4`ZE䞊!joZUk>Q1r*;+TǒHe*#K(Dja (-& se/J>7MhuOhby~f@S, k?|c}|Ȅw֢cw]=ju0|iUaGTg\֨pWUT_jjq5Z_G̹ĥG̽7*K_V' ={sA`Xg/a\](لwYfaG\/"4U73xA.ǿּ63^38Z^|xYͫy^\1%mqy%7QF,x߾2rSi^?7XJ+x+؞n ՠ5V~jtpd$w[Z#\ZSґK 'x32\^x;t"'Pk-';7+=d[Vp T ٜ5{~우],7Y(x䅤ߏlhkv~7+"ݍsurıXDR3r] B&`^tt}iEWc)2Z,Itˈ[TѼZ+aC4ev!y4޶-rnYz^ (ygۖmmht6ޅ 3.@[,/av }Q*i,iXث#jڍ\2k8f]6_=ZfZ᫧ߵWSkBiW߈TkZ~Y,W'B6]C\G)r]~ߦ֪]Cmg*c/&iٺƘ]GvLW"5>MXz3Zng0ʂԗ;5mJJƧ3ŕxhW+lr-89W_x9hhWZ N󍨷=qE_5%fp19D"˽o[CZ_G }t4ѢZ{-[BHiLX6B M&jS.b|{|[atdk&m.Rm_6i;^vX;Lt o85{8ry=gλh۶ڴ%!I&I6粱&6I$-]>6'iT$I$BRiIn-yfޫݵn~w=3<̜yH:N3x˜&!Dd'{è3xN$(exFuYUxՉRWku~uBZl6P:}<-U' )g<31GKOID:NʪӱD:C4f3o"T0hWgU=Ku*TeAVuV]F SxC$x?c$BhLc31#U {&dl ƽ:t=*d !O٭+m^Д UgsZX.ԨAKXuE|2y@eqQ@Cĵ4 ^= 39[̥7ԋP֒0tC <]?^fiOWQk%xڸOi%c]RV;\d=Nʑ\|+ژ%2tI@]s=d='c@# $̅7s"!K2|W_1"Asx17+SQby#G*sdq\RÑ<4 : G^b}H+Fru~MQKK%o͂/ EZ7EmpGRt[)HFl}:JZ}0~YvU>rJK{>cO;(3g Ǯ*U0A'=t%W>ؓO:!x. 4*0cK,8o{yxG`}6n6C9pCeg .ə&ⓉO{V􈜏iJ2a ++A=i%3;!xM񠐑E5 B[RLQrNNAuv^4;):KҶ"a$"/žB3kWv1S==49cFNxuF#I_rzN|XJ+їJ}}OehCivTзԜZN* wlj)]j6-*{#kfWiupR[g}5Q$F]3+4eHw=GaY%Ϫk5KcXg֕`}6Xc#X6Nf3L6[ L[ʖUl-۠S~`;K! 1θ ^'$Ӑ o;.cB*_|8|*N|JQaW(FHSƚ!(|w w0ņaD>#H4ZF}hU F\a8afChGi"T7^z}ALUGUӉYZ j3eҦ!l!qެn[Sj}YΧb:go 5a01:>/ů5wo ձoT+KXfȟBn.cxaNq?BuQ=UFB;ʃoӚGk#Pk 럣$TjwKh<({rYc su#GjNG\5c|9bh=ڐl:C"bXa~*mڍ:$R/*V4E9Huw  HEͪUTkRƖP+Vا!Tא q%@2-j-wvt_ͳJ\u>kU?pO\Ø^as٫l!g8%mq I#z𦐆``kyWw>\]:8\_wY@[`ᕷ">#ׂpH(䟤` 4%A,W BCR&n,[ -,WI;9_/A{C^tJS>'}D{ 1/h<&^ww>B:_Kho1 3}~A{&FlLFPN\Gy Wiy!lsTiGiHie,ȯ |ɦ騀 omX`O煌!fKIg-*Y88k%L[eLo"Vw w҄XK^oh,ТqJbM|O-XN,UFn rd<+#詢4E =Trq;A"<_m]*wy2K&oO?9ڭBzHװ:Gz@) JN!9RC;7@/ #LHr(p$fC-ù;j.,ժ3߇jʫ 2~FӮ4 vtsy?T \8Rws5½G\݁!Zkqw 9oEՎk5Z6H.>!,B9q막iV >̙-X_¿D2CZ, cnZPSkY9l<< PL\HCK^*p HZzLGHCSg)h,)xpâtpE z&5t qQSPUkrJл* 5JwVZ:Hj,BU.ʣpi'g(jQڙzgZscu^\R֯孶޶*l Tqސ9_6z I߿!-8:N92΢s|O$kӕe%|BPStZ!5cN5nr8QqY5x3Ǚ-(_t` K(F%Ry)C8 eoY)tS+;y\KlbܳId}wC25V3;'h{M'a$mHmTZRBb` PԆQ#r-t#M,~:2W$%uWb u4uҝd^I2pISmIWrE'KasN҃ }2\E{[RItnҗG(X +gqBr1@:[IoI2 G. =ӒHΝn|UB=olGn&IGaa2F!C7J.!5Fݤ?&Q C2D oyOGXл޼%4vCاw|¡G p|I_@8"AQB@(g HFXaCF.#ށFG]vC af~Y=,#p\={@p>‚~YeW"\p=M;v;Ax8"E&†hBa{; B8ሁwg3 p_d9"E{e.B&? Gxa-a4B8=+a-6F a!@V[vBYC8!C\n@8l!,@rڀp3@XaczBo6VCYz{"l54R:'1/$`rxQiվT))X#M]\J&́\|joGua1K1q0 r<-\$"_.ƔMಕ?VҟK˅x}$JۤIN0(O֩IIray4Ia)Z'aFM3,% Sʁ z0N}'9 z<Xt3I3/gX*KclˣyÛv+χ >/k^ȏFQhf3ckg%Y VVG5eMr|\b*toATԨt \Լ%Q6G:퍎IrI:4˙6gj2Ne6Ҕh2[ڬY,Rfnڜ%lʼ6sKU-Q+T"-[pwpgGg!¿ wߔ%}s_yO8߽p0_DfYd.edYG6/d*+ٱ6yK+mZ[ܝ6+VoRevֵy65t~Wiu0mjmSo9ᵞnRiK'js2ݡKUXW՝Us2k.]ݥPlmU?t{ ǶG X=L c2{+޺z~Vz{2hh "oѢ2,$SD/.nΊpϯ "u w"½"\-ԞD40l/R10oko'bxӽ}TN$I?ɥ1cc4 cv&MG1Iub8r SLiYM< Ci2Cf5mG;ѮOatO'@VKb wmt7=1 mx3 ǪVjaYg֍el0ư l*IdYņ6dsX.Xְ l ~vjxsy./|-I)~6@g|"^lX0jFMha1@e,&j-4 =k?Csgy\Yf ـ|ۨJI5lX~ۢVc{m4^;4^?k~xxx*xxxxxګڧگ:xx[HwHwXQ1q]ƫD% //Uxy%^^C5^^K(^7JVxyc^^[u^^/OUxy+)^* /y/o{Z{ϛ^([ϛVXVXV]M%k.إh.xxxxEi.xx]jjjjjjJx]jj[*l5~4~({j`>K`$0gt  _ B:7oG3~[b^e^m^c^k1ۚ7f'n2Ċ̑(s9g7'Ids9ݜa>g`4g9sk[R}CcSshn65?;^yįb]ğ/qܥ.wMF^u/sWݹ|7].v*w] {)ߔػc/vH>By ^7$Ÿ/7[>Zm9ط0 }mY0kuf{L7= 3`2as9לo晋6*sos,4"Yl1˲-jօlݭ^V_ǘ%a{mUx;NkFvsjZzFfjw{},]" ^qXsk>q ݦn3}}}}woooozlfACcǎw=t ]M)Oc(wM=:IsAz;.ʥOK5PV]|:%f=#3%_hjgieeZQjvR[ >@moJm v3nk;DPۏgCGEne|{{Ľҽʝn}]tW{7-o=`ñGmGm$D?ЕRFVr3v^G=i s0' sd$Ƒ 09@(p)Tm|D, 7NFC c7z{JFS ݵruW/"P_t 0@/Q0wjk8ku/ Lwa/"{0A}&`D!A8 hc>p,$HB[B*og>HjV`ؠêz"%KUтRsSHdπmۀ&4G;HMs a#JҶmR|b>cq?GBL^dxghl5`IlL [uu#bun%Z]I NrQ̼$%MH}v96v½ڽ\w"B3|!{ #v\4)']d?Y"{p^jP,x%]7TxMB/#*矒K}6vn 8퍺IÃ}=b]/o QeOy[Jc¾}'K%K*hu/ʽm&Y^,A)m wpνV FȮM}`t᪓w9V!kw@W1x"l{2IV}oWϣ})@G )MI)mH7mk+{;Rgג{-HUHԿI;ȱU)!{AHMl -y?u+K1PX:y[{ACƙ$D/>cGMi- ֦vG*5βCKLQRtݿ#Q+wEIiR- D-A.DmQGĥL4h, *DsB\%ZE+qh-mu^D;qh/n͢Et6x688#iB\($QC$DMq1pOĊJ"q|/. "QTDDѺ~4_̕R/-:O8'S$ig3řLs;83g:3Yο%g,tE2g3י,ps8%NS,vr8o:8:K+;;_8[=j#gYls~t;;o.gr *R|u>s։O F+g:;ΟNs)0u98RMn.&)?kxWƁK.+wGy/n7ǚLȹd8~LVO 3| -_0n^+10%)FP^H^L/:>G_3,Cg9t.G\G"Z@ӷ;=>~H?O39~I7t n?ҟ<zMgJE]@O'ۑdeIɒfT-"[ve op2h}Hޅ*Lq"Hzu4stu.PMm]6PRe@ˁ?*DкO5)]L.>%oFSٛí0 Fa<F;a\1}/{&HFC0? sG(QO &_Ogo nr駘PNMԦh%Zx@i5DiMBk:I,}HE_/W5.7-Kt]IWt ]KtHotNwx57P/n_K}Ͱ¿u4l_a-՟}F[ɩ瑩.)5 N&4nM+ h(?T/!Via:rT=x*(גɝ}jN_;n|JB\3v% jHehR ͪ&67lr5 ssi /YlBn,mF^ lϽ?;y~JHZmc앐R&na`_\pB*`8VNf*Mʵ?1L; (Sf 58Z?yKٚ3l<[غ)?hBֿ\ M Y1ʽ"'55O3M=?wG9B֨gV:sdQ>P>Y6Iq5Y)MD)yYr}_ԦwM<ʕ90}U=# (q5E_J ˍ㓒 đsh; Tt,"2 I%hGkHHHFBABBT̊(e_9!;{igZϳ{-e"5%(C:Gq+ʱJcXց)\ eqv&Q>7ǭٸ xt< Mw EEʦ`{HQo)#Ezg4D$+l(=lHEKP 9sQ<#L@ls"!B:?l=R{RS :Q;wEwCwG)ԓZ|>|_|?~|sHAHH0C2IrBfE+I60{!| *jLgs?S?T zuHPȆFvK%"OmґMQ݁>dRbdS%T9'T5U\C u]!Պt( GK +N吕h5dUyB?Cեӣ55FgYsښD{ FШJs0:DvE67 LېBsM"{>L#OHOgZdk+Mdow6Ogȶ{dr#98RYhO"1Cv ǘcd9Y+ YY/N'`N'EeUFqb8q9inl@6<adqqN"[ƩT![ɩ\AssۜFd9md_prّeGyqM<UU粣"5\vDWˎF;kw2Y3Y Y7Y?n07 P"2d#Qdqddfqw#qbn<.V¨jn=ƽ cusam+}ر<'ƎKId<9; dqx:L/1ȎBun2yf<+d-y6<dg\x^zxBy]E!ɋ!KmDv/6.^9}CPyȞUꑭ]F&>هV d^1d)Fy| =r|%dj|Md5Z|d>Q|TM(ґ|kPG̃Y^4D&F6"$Z k $H,u@Y$H8 끬H@yF !Y%@Q;%hV&FËfhmd{=b -; v@2 , 2={ @8q#' N@8q   @\q ;w @H#j'O1DdS!&CB$LN /"^2Ddl͒!%/Oؕ *bT2ĥdEǧBIh &J2$ Y!Ґ `KW*1=:AnoMrH&h!}qBAlbEƧ,3w6pRt nt^D{w*)Õy;QpC sNp9eH)GA!Ҧi -zYX%uK U1mt?/?: |=#htn->}QJ>~]:=Zh_od]~߲K.{P]U5i5Qâ30Y=vmYDkP6>v[gl''Xu?= ?ژ-Il!v v?QH$Uom@KQv&0T\Ԃ/!JZԶgDq:|#dSv8m:8ίǙg9?6?/}gw>μ8|g?Z?~y;egٶ'$wьGJ0(* '!Z5 YpH Yel_i<q%PΊ$n#9.au1;:lϠNB9,SçPtK:.X8\K!NM)S7RH@L$KF(8-Q!qF9JU$%.JH\hFn%6޲N+`p堧A+@π=Z z h5EKM܉WA߀}(YA P1P8HX(ٹ(IE"w`6,9IG^Hr3@ƠïW3\Ev~mV]ڦ1?6T$ɛd+Fbg,c}sX̅}_DK:2&Z]}[L8CN:3ULչ-;{{]ڿmCKJHΑ A:z+l|<30@ ïƧ@݋f{gṷD˱#gxcL%숖zvlPgP/PoPP_P?9_ljP7n{4`dc iH#'fiG:L;82L#<ysUI֐WPyO6md(1J(5JҦtEW0"Dc(*D94th.[@nt'.lݠ{@s@sA@Az o@@---=zh9i sA@/V^Z ZZz UkAo6z]{AJA~qcgԥڀڂځRA@AoPWP7PwPPϿA>~ hh0( GUMrS)=!P cNJ>mm} ڎmS⎁Nos0M)wʃedٹw-$}Fi裥2![KechZ*_g(&sG1 `LO1PGGsť-&p\(`zI)#.G㲹QQoB ++d,/(SSIIc=1}x{tP@\AEDT(WkK85\f_:w0o޼o5O~9fۗb`O#ɖ?9>ٽi5E`ɧB?)lrU{qI\6`}ōg98(&W7RkO> #npǴ{8C _tPCI-l߷H#FmyhX^7J.|PgXӴeOmSy9RL'{9jbkNx63̹),iF{f0%J',rPAȋ5ubeM+;–5}/V []|&!]׻Xx_e#3 : +rfKoz)w=j8 zlkRTQ3+ .3 G'R^ۖ}Phs78ETh;zF?ޠwC?D|xZ&ELA ..?[Xi9%7I{T~=QG~SqJ:zbY~lNmow_C3y!7<ʍ'oݛ݂m,^AR9&^k+6+ojQ[lQg%-~E҂GQ8:# D/n>@wCKMr*GHkQ+_duC?n+ ? [h_ 3Y΅Awj4$'߮0pɼ>+KZusډ6Ba^;Ey'j?-yxd|NK[OI=dG?*;O+o{m\1WKJ& 79,Xٖ7^Yzȟ.ˬ|fzLjM5T';۸MM?|mcO/^gEஇo6_崯!ނ{o=DmagzLpVmyKPrKPb V/~q}մ3nӎ"m2єR~W~󜠡V)z_B- zj#[5D=q/3>ZuǭS4Nv#eW͕yuV81Dh0 PP0r11ǘֺ^|BoG^(kE(%&#Q}E&/Y ȳӬ76œ~nْ.gi%_V)c j^ζzMOC#Dy2 򦸗o!|jxZOƭqLijUc4=3>US>YC)*Y/IԈ,{q!utׄV}0- c"h@"Bu7`Iwq: #? G DaC_& C`QȰz%} A؁\v@)=~"j;`yLM6fr)CKŕ>٣^Ъ_+v |}rL66y̮nH+U{y瀜0~n] y-Q\Ǡ< g՗is=ː}ft覾n?ЬtgɁGsLt+NWo))V[o^h2^u﯑/Gj\9u|[ƠwcG l} onMZM֩-F=?Yv!2rK*+S k/yl?M&9 ?.Gn͎^4M6G;$C3Fl]s'`4yحûz]3}҃aM}L`㥁a775J9R05SL1 Ͷs^s}}[VkSZ>ne̱^uXkIrH`8u+yQn>K;l\}6*S|bg7~O6!(q%19ac_= adh[^R7 )"MO}PEUO{f]œ9cƘv sc^flfB-Ib3K}:I$d)3\v_u\Бy:weF}UQQ&c;`X\TĜh}_#\`Ev^=mou"3oZΗ׾X쮖*H~9.eL] ;J/.}_4uYFfTORhejww ?7Y_q^M.i^tͳ3QUREv⩏=^{h'Ygxwckۍx;^_ߜ{W]oMLJ"a h㭬U.Ցzb`m>ab'JNɹ՞Q['8YZU<\翽0tkF&8V0{.=ި[Kg;E*:Il&߭sIUOf9cݸ3s?WYq뵓ѧ$4pԜ".0:2=)?X*%\ D~jNVoٲ9,Lqr }Ÿu.tPCSMP[coW??yLMih&+өGgevQ k-?͎fψJ1x1SCl|i nafTA&pYoo_|o$}I|: 1wRyI `!%Df9ǔ/Vo@eqc?\+U1ލN`PwDy`34f[wt Ul"p,'xax19škd}tNpA*QQj.\99mEԈڥtxy| shk~ar#o+M2dbI&I+k,MjYt\NHUPowilyi<|͋ V ů4kL(T1ۑrpVw%fwoy;u >ˌY徭=jfZ|zSK"eDy98'BݡhkohR&g1r] CZ( ¡aߕ7R/' Cq(.\0  *H 7Gm.awWx䟼50> stream x \ 22l0l*&n0 ڢE-X9VVV{y3+nVڢ{qio<Ə _dP\SQ6 vKBaK }`{DKYqId{MXSqoA_ո XjMI͸o8jCӂ70 i"˸XxNw|Y@۹ ! 8 0s~G-?M?|L,nEn[@\EK5 {`~KY ]slkj|m lO-h\>⾰hl˂E7a10ոӰ=9&X[w|q!+q?׊O孞?JswqUdʑwF#  v SȻר#IbJ`K ڟp\KEY8A)Q]FW1 Q&^pxw@rVX`EsM[yyCW 2cayQ*|- _ ~*aSׯMd NUO\4UAqy?g4V}sN*_o߯'s]xBOǦm#wR=]#D8y7?S28gadbܡzg'$/ON|8ϞO|S0&XG'>O|'>+3}'>O|'>Ov='>O|'>O|'>O|'>O|'>O|'>O|xg"h$s^`>,aJP -0΄6XKޏʵ,+m,XZYqZ{yeGo\#јXPcq|>f.V׳ͦl1[.cW@K?ca^uaF[/HRQ"Sb> )Mk [$;:esХ؈g鬙3OZ_窭2y *+JK Ǝ3*{d#%yg5:ZSe Z`q2<筍hhfhp[Tz|Af9k9j:j2%S-%V{wæNzWJWKi]0-,%a7kKv4cuE j &5rwcFu aݢ=ir]I)&^Aԗ[QsK-;.1$mqz[lF]bIWZw@;ZNX7 NYՔ[n3X-]'oxKEa3K&,L g닉s 1^5m35-4%F/Y5X2Լ]U05̽j%%w_7[ܢavS+gcK,Ƅq`%iX1o:wl- hp̫ 4si;RPL}Y'mLYLȂz>wH:^UKIK ש|`zߋ|Hᓋ6L܋a7LY[V!:6גjUIrTC97``F(,M2 UʗIl Ŗ.wn,Ks,Zh,]=Uή<އZSo:ni*XUmaJ2=Vvn'fjVy&5waYV|GpJV[g,<{Tߴ J*I)@)m zmddsJ6.褰Vb'B|FO x{yR> OxKwo"Ix:5 ^!LMEx" ysg ; &Ix#l%% a4! EF # YLB!&Ad0R  IDBa!`'<q't'4CF L&D" &B!F%4B0D@B@ :! *SI# '"A 0H`^B?ppp3'ҰiE'|Gp ោ^ׄ_ >X `zBr>!>#>$|@xRxRxm-›רSW ^&&"D^_ &<9YOH!b'5xzfu$ mǨuu(uah3Ca݄M 6'1 1V#1N@1ND1NA1:wP TvrUn7S&y#jp=:qZj~ a=jUTJp8q9ռp)\\<<\< q!]@5ϧ*%ok'F} uvifj7uC>~PEA.;Q@݀z;mVM7ހz=uע^jԫPTס^z9e*pNp f<<zxhu&g$'A'8(B6a$!Iy'ttJ45AEP<:js򟨽_~%~tG~>{ny-'Q@}uc+nAahyxȟCI(">q1d#!ıUE4(wDE,'Ԑק&&&& UJBPF(% `&D!NeB7#PA=3:'Q@=z{wߢC{Q?Cn]/PG}YԝϠ>a-QohW%UҶ! MلFBaa&aa:aa*PG8pE%)dB!@A' 6MJd =EG7M7PQ_E}e譨6|s/_Zqke yW4+FZ!jVWl\ Ź\7.sɖ//q-ݸĥY´;]{;v͝:܃;t{;9KWu^)cL1E;\aq:ؤkmQk(5tu8;ij\\V޶Mm] SM+=| `@!x=m ^67 ܈y֍s]sͮͮ&lW515s tT״S]:X4G˵U욲qkckګU\rWrפrV(uf|hn^} Zijڣ>:%GV>beĺQ/ׅ)\=pU*@H pq 6uD,7z^I6o_?˿_hp;K:YSutu:sN]\|8D,x9o^Tc7*J0BTo0T|?[ʁ+6;ʭ4.vjsTb7Nfn&պ֥E_QU:aCTa}{O;RӀUf.\pQ$|A-:[Wd"^h!`_^c!GTiaN мP2L//g[GȃtaجGn_?3cL plKsnj,%W?7qL// =w?,1*x'ЀAjk^B=,yo6 kyZjqM7vNX 2X+SO*ku> ǚXQ/`ۏa/S!&b{:C7J~޹[gMg7?9ian;<DZ ^{`/ɡ/IeCQZva{\=*={^wq~miy[nކx:|;䉯`Pz@y/Cϓ @̝l=#~?aQ;x`XUR3iJbje:x];D3TpRe*ȂX0,E0Q,Y V>Tb+ceP[3V7%,,dX.ZR0<,KX`6 _`9|~f﹀=i, &@`O:̌,5_lY٣ƊтZR:,>2*>LD=-?# _֍SrƸ1U:No SnաH{lܻ|xߐ]uN.--45U ĥkjL< qٓõm,b { 5W;ͮ@aPCsE"7##cKӛi/cR332MGIK :!Egր!c_2:'5QiH,Мf4ѩhd<(LhY 9nS|.NmP+":WFy!l57h؊w ,o"`$܅OHT<ͦ- zpKKKy˳Q770:!!]b5̟_Qmb}qvj{sӗ.kL>}DL$Øa*K%T=p{>]s<[AslThZ%X2'R{OTäL/Y_%h70ziΪ{).T[_j|^=, %C*du[q-آa Vy+XGؤ 6h3mhmmtBmHvʌ֚մ5u0-kزYA[1&nݢ6HD$XLCcU:\/^/a vc({8Z4K!?]KpIE_J*8 * N%ǔr{Nu؈uɟʁ-ƔީեSRbdiu@eoj5 8?@<ssY;|3S>AA#b?1ijuY8KJ^K@ݞjR;RG:sR^63zR2d$$bsGr+] @gHY©Mb9UK{\)X{h[FLx$ i8 0UXbllJa5zVdTቱ֤p+!ٞȞ+ ,_UPTpW['Mv<4*<\/e!,܃- jg+Nao}oF\tB]T]SR<3m?g4r3RY/կ^U=]7MZ5-mԬsK\NK5kF47/NTaqF]&nptCR@}t?"zѣCs{a <~B2`2a_|Cj'_Ž>%/%)/VGRmaSe]k^ YቶXK*q ?\ FW9 {\ly[UԲutʘw""Ӭ e,~)&`V(}؞e{mߑ,\ 4Gɓ㜜 ˃4gyU1U ƁBLvӌ')Ԫe cmy# kj F{$i?(iT1b2\6zŠS Qz9<"Lk2#ccFd5V.o 7ƆG+C#B !iFBƂ ÷!zljVsfԝ}ý;[UCˏ(W)EAUħrR>31tc㷭x*~q|q-ˣ1nQR:(To'xآѳ=© ,mqW;NDoҸ$:aT] !J :iTw-#5%OsyWϪZϯM66nN/K2&gEgf[b5zLk*L\iɓknjfx/(/<}JȜ3j2F'w-H,&Үm I柝IB7ňAɂ)}U O5Ȅ 2L"SqC6Y5ӂuR+~ ´ZT?;#qw"̚9O$< f=sFRD~Cxl x -yO|$!izq xʛp楣.J+K aGrؠ s?,4 c+lsLčIg<|^C'l0˓#4lN 7 >`N324|Q8O\CsCl=|_G4ұL 7؁:#hFt42xة6*Y*_&2i ) F Н 7?Z Bh:YêF*1cF͸lSHz+ YʂzVMq$Ll+C$Lh۝Fy`ŨB@؆+τsj!B6SբNTa5N3Ү7Z*2;Ö-p[ O[28<:Иn?ֱ99hKF.Ī8GOܷdeJ5&+po-eehM=B32sz_('QQ8*`T@>_k !f|7iܝ$"4C Κd蝁&wc.wN+j2h6&ʎlS=z-cĉ oZʞ[a1N"?C.C E[_#r-Az}PAz5T/tFvL?4~j~~FߕV_ /u2%}=ǫ[xKE ̕~fwzP p>f_@H>t1DE T >֑92@\W?\wѾzo&/c4KdIȒ"[@ PJ m^)P /ms0MH/r{V-BIv4}p49s9.-^Vu }nZEIY{F]wn}H RjEi#e3yڦ-r ]qqwz nyC6"v^FJ+*ܛdW Cw>Zl3H  {=Vȹ'0Q7m8ڐ6 5\1{tŵۋ4)mM2u93Na5-23+?XV.E?x/' u`CYH- w:?2uɚmjf}tnrZu-2ۨCԃS TK-dVU(8 %0l)u?)kIU W*m4Ly"ݰڐ 4W~n/HuٞJ}\jT,@Bh8PK7`Gk1S鏶yO ٭֙9}`$SK!AF"-'nf*L\Dlԋ3anazx!#+}y3E[eX)(S>vJ)X9@ ڰոke9 }+3w}+CPjS,O 4/5^x =g{!=8IiOYbNesr$UV 6f}Uku eM9F^nA~%?IfZ>gXlh"*f~ԑڇ+R;r{#Td^4Vy vj7>6-TTg7Krҵܼtute> ҩڶHײd%r۩rKl.At|\[ yMGk?xkJ@@M}OUTYUQ~t\;yCh'phvaF)rKRb1\%BPr Qߊl/kG1kKsXŵuC  < 9E^mu֒+v AV̆=FOcm}Iۋ\AjQ?l/t\?40_=]6?Ic-^n'V{{BWZ*}-Y+ʖWeI~y $!eeBgkS()-?F톛f8->1)Oν+*֐b0dfH,+J//-J5U2NBxWթ\hA#WSoI)@U`YCD_ݜeo#]Q]{GJԖgO'gOV/Y}ܮ6ҥ<ɇ}WTtoi/ZY_iJM~Ukq|E򊒎M-m/ߔiT$3s32*m-5jA[`0\sfvZz}\0wLqi GIqA9H2 _}~PŢ>ݡ(~Y[rNV@W(B%G;G uYUx|E]yI0WR\є/[k ϼh)9;/+LS2M!rKququU.i>/LfU<4?\EH}#%KvC>F \27Jzɷx|h([jZlnX٘_WZUve#\6)KJoʢŠšdmRƲͫbalꈞg>v'TOH|·9W!q_lEQ~W'qەV "4~c:EiκHįb.ϯ8mVuPMU0ʖBw@XS`6(U?*ۊ*ڋqe{܋r?FW6~tU hGҨt)6R(dkr41_ύj tf'&Mo2i*mF7d27SŴd4^ (䕏U*r$’I-2hҊs͚L}E,9y\S28h6ܷma[ZI&d~"I$~ԒVȭkH#c$@ o6sΊ`Kj{ttɻMw_WSSW;ӧʽܵ;vjogo6Tdž ʕ*:톕V wMFGH)v*8pqhӃ\|7t_zץKN55nc}c} ͷ6kl$J{uM %\}SS= 95w)^ZPWXK> 7jڡ&^UPyvIS]*p&ˋJkRM::4ED0 ӕOq?O/T%tOd'sdUcFBSۣ'EFO'e:e)򢒶(ki)-WkݫI)ɊTo&$oꓒ׏K2ײ3tEù'U_{DF$mF7W/(|^O.*bE-;WYk,H+巬(STXn;TF5`T&H"h<4c΀zI8q|8u <= lFYc!}MA9TmQfsL`F3?{0kr6apH"8*YQ@"Ph[FjѶyccCcE7ٙ%e,1^Kh<3+HW7,̢e"QoKRp| ڀŨA_GvyڃYƋ2FPˋ={ 2rIniD\dZ,րei R65Lb3|>l4w&6~~_zε`\Al\,0]Bʕnč󂚲s.*"2X} On\ۼbna|(ceqwixvBiV7`:H ڂqbM=<)x-ۃfMl%|h!҉̤kO\Lx#(G\&%̇8K|Qy0.ݪ+<2~Y1KL'.ӏj0'NfOnD:f.[vD.YwҊlAg)/!2g6iX*,\|5"뼀GCQ~fˍi}n;@zj#l6l.h킖r6:d1~ބ9xM>&Wm){{HG{tBz5xЋ!z5I: BTÅR−d]E~T~:~rF3 m]@7Pg&m?.(*}6w|}PbZv&fNx)5pwWمEQm*T'jCJm@p:Yv~g-7Wx5w-/Q7b$v# 5FHF/^N6@$l' MyV3L Ax6Ɉ y]+ \(ѷVpw\۠um`/'a:7,BjrqD B80ry*3&nOH{uB=˅#x&F[X@t9ã?b'A޳ `Ya(B6ScEp{Ab` w]@w'F"ndBIQ:|!ܓ>qkJcjЉ{a\, A0N$L^`E AS&Lm Bw!0 Od-٥kArI-rh+ Ǖ(3"Òtkis\YpK}^S66bjh;J=h$( G& F1J@ZP A2n6(g]gllkpq (F{76x69;Ovt Gn6G5HcSsBdjjaG^m^Cs<Րx4x4>lx4{4ş{GGGGy1u   d@ȹLr+Y9@^>*}X d9v^*_*}RK.>9g.>%_*No2ȑ^?I"e4.qI w Y"-Mdrw} g!O~u,Y <NB/)K<-x693/kF Jef}n4mQlnKlN|aF%WP A®2brTNNT-zA5ϩHCdZ~SQJ<J%Qfۉ7{񅂋W#k7]E{zj9Q+ĉjxNDGi#5N~gP(Z%UKߩRr*5 xf ފ\sZyT9RzaGRbBF&gTrN%j1GJTcKപt\T9m^9T4~rꞫ;Et%;6?9ڜى({ǎ-RGs8uT*NIY26 xR4L RwRBT6өgH*P%%j;vz4Nw|&S1@+SSq瞞߉wZ"^sz+6%jꂼAZA96_j潹3*VRW~z+*GFNr*TW{G>?79V7vȑnXQs]97V}s/J圁 x5EC!ߵRM-QIi詙gftKL[󆘶T`•NZ>wcbf n 9G,-4!EX lC F~D^"8N)RjHlW6q?M`}V_r%c{&QW`f4%ߌQr yK$oys:yR+] auӈQTD5b2b鋨īoD<q/>p2C S+vHGBa͈[`aчBA܅x3w 7G^hį#B|qq'\&(&D-9OG,ABClA\؃؏ZQd?bq⍈"F܋yB.Ň^m=>l^6 Hj\?D/-2/(R2Yee{*؏agN }çXҵTO'sg8oߠox `ߺ +,pRx.X]ڻ$t5\1,8 W^epFߠƉ_i8z8|e79&8|N@T)3h.=88)R̿^FDBNjCC@*JZ”¼|?a]PdMp˯9REOxUxޕFHˮe`#Dx/<)!ΉniI)w%8M>A "w9RC>=yrOڻ1IH¿(&]݈Q1qD/Vm> D?b11F N"N!N# "@q'w!ހx#MF͈ ފxG?x;w#~q'@quf ޅYĻ̲,6x/}J~wf~/?ʟ_ߑefYI%eͲddGe'e] tE֮{]* d{I1`dĈ,#`D"&b !M6M@ְo¾Czfƙ?3'k}UЄӺitmP۠huC%Jzm=QZ: dYVcY۝i FQ(gT3-Ncq8<&o| g<\4Nfy-؛*h)&yb8,. h0=`a/r`N^8MPנAiAVm.0o  (S`E[L.u1!!B4"$+$'$7 m=tphFhfMY9afXTXlX\X|Xa22m 7ãcÛ'w8|SxVxNxn$"){̈""r"r}/|}}Lb&_/ǗiFFEFEG6L982#23rqȬȜ(3***6*.*>ITRTQQQ6EeEDFQѱqMGΈΌ^):+:':Y(PlB[n$@9x5qBэx2v^e?.c*9gǗ0sT?p}Yd;8x|rɎ3$'V*pܣg: ʭ/c?Ǘ=*ncUU*WS|_l5ת <:U~&:xԚkˣa^攍!#n+ė [W-@: AQ|p\X]-~ݏI~[H}X: ;(\z)\OVxݏ cB]?E.cd?6Rot Vo<3||uܿ] ;pǡ<U@Q 5Pk`R yh)Z] :kj* ~8VaK ^VlCaB 2tQzGGjT+vRwR)nO٭I5 R.(d1YSWa;7QYJy ]Lj]kBӂ 4Ǐݔnl󷟥*̳ 9GQ0EQQ̓["uj$Ǟj^C[ϕ\MV_Š6=PiЮ!n?~TgC?՟*L8|g>Piـ\y|Gݯ Lwp,+Tw*8XĈM7e.w79x̡.Co;QR+U<6Vwm8n UQQ@>TDP%T F P"Rg|s;F~U }c_=dMu)ڏ!~=“~4c&q:YorN0ED?NS>mzGc33>bP 3U f TnT1bWp6{Q8GyJͼ~n|S,b?&W: [qQ졺|sME*z.R\hʕN?D[hKYKw[Rv4>3d[yԱQ[5?.S|>?.O eە*[%nAi:Q5)l5 {}eoWޠAAE ~ܨ7rYҮoM*nVi;[Oڪrﲽ80ioUs]*c1LvO{{d`f}j|Q6ܫ^՞5Mr>2R?T*9:ݏ'^5>ԴKJ=> \>/ڡN3m*wmNc>V{*W0Y?ǸbRO$c禘VU?b-N?ƺB_Į cx\{(f~3umT`w+`w]}4T3gFSlaVvT0WkBbԘ'$wlRNTُ?O&(?i! l9-o 9xʿ.C8qv=!|mC/eyvJy{zkv2;7yrv^џMuG vQ ;^6ʿb_ [!=O|;|mog)v^3+lH6{9v>$οw8{i|v/WoN]t_;<4_[dno;'8 U܂Г;5_&[r;g#k! 8C^A'ZbYS˄|.2&W$κ &wM.yULP=i+p_'$Ĭa&IadM'wX{E{LD4Y 4-\U+:ŬYle-M(klDI 5 `׈]u0PU5( $jIYG!^uf] yM[]-喝GZT'C{XV4^NocP_~8 =;dopKJua {h8qALbI Bi$$Dt$y"%H Aʐzh4I&R҅tAH7 -'=HO%}*2 @02 !ߓZ2F먗 K(V=Z„1ՒXVz+.OOpEwM=|13Wɧ;2ێ\&nED O@x4X%hxϊgi(-JPQVa(OEQF"Jq"Fʢ2UDZHTN &-"fh)Z'EkњmDH|D=}Zti,:BKOŧKs9}Vh)1P 1CZV|#DHωab-/Fy&h._DȠ1 Ɖq &D1Ɖb2}ILSie1]L/LIb*~?j }Esiu1_̧_ůX$RrZK+imZuZƋb=}]li]Ylob+'~bA?M[ bK~Ph#qNEq-.4Q\W;⺸AU]÷= $[-z¢(&QRĊRxNmCNRhW~=i/ڛ~N/(u.Kot]o%]EW5t-x7Mty9;*g5d~_D9sJ iO#($Z4 1ak.inkՄj,O4sVZU* "d:,l2c* Ȥpt3##mrT䡍Q`#c2o_%>}0 ^~UF 47!goPhQD'΄h6s<4fuZ7 -JŮFkZǮGF mF[V h'BCQ:C0:c8:NS(FgYY.K2k:n[6r]Aä>i@$ -Ґ4|mH!MHS#ޅ=҂OZVU|F[Ҏ|HGc̣#GdO.9JH69Mΐ$9O9@.K2Bk 7-r!.#`J(DmjvL;NjlvF;hvI]Ѯj״ vKrZvO*^a٫{dXmVųY]Mb Y#֘; kʚwYskއVe؇,}>fY֑ubd֙.+uzsև}~?/ ̆7l(06`߳46Q,fcX6gl"e 6b?6e|El1[–2`+*ak:m`&ma[6;vf{^gY;;ʎ;NlvagY;γ ".\v{nl̦lήn]OngFwe6>7_}~F{?}/K>!k (G1|, >O>O'>|6so|_W|_ |#̷|o;N#?O,/+*Ư&o;<{&2ILjjncqy-}[;ʛ;;;;;n\KErh:#=V #DtC7p=PeZR9Iʰ\Wb 0FbL2~#az&)'WZu2z{^UAQC<#HjZ ;cqaD ^S4XC j guP֗OuE=!Q!QE(CD癲\ nʽ|=&}7^Yr#?f~ʭuֹ"L{Wn@ZP\n [ %\n[|Siٱ&zZg< f-Ykֆ}ŊB<>De l ϊ|OF'=FB{GoA$9ī W +Y-S܁m&|b,d6/E=&fl0 !ffό4hY,b54OͧY򱑴cC?Q3"@G"Zuc#n{~~kE_w"\D?ymq׼ybC`1 _5MP n[gnۢCzPEGq:x+jA:dԃ7E>Gd|I'@#ޞ!cj`4dJK)4FiYZ-|ș.mу _ׯ~ms(ח!8;\5ܕvFg\c]qiWk~5ϵWwsmovvf]!]u~Vx$^u+eeZww]]opWqW&w w ]] oqǻVw;os7r7¿݉x]x-ど8k0VFe3a#Hg!ks s _3.7q'xSލg5^!tReF`9C7ŭՖyX.TֻMN .+pO ,*=C%-vtGz! ^D/?ӟҋO1z ?Kez99]x7ރ}x?A|GQ| 'I| g >s4i:Ao[6Cs]G+4a=ł.(JA,**m*{ߣ6_`#(*c`%u$'q _x(x^x\1DvZѪ>X!V%RT ImKA1d 6_Cc14v>ce2G1n7̖'G-prN "i^KU@ ԬY"ԭ߬ c1˘mb1lu=edFq8o\5Gq$奊ZzfUIiA.;"dP5k[ϟћ3UY4 ǕeaST@T׌#qH֩tD=b1H#$)i O+!W%vD^mm$`$ÌQ( (P1c3 qɸZA>;u@C܋FC@ _! A -EО'bhSh i, "9 "%]b m~YbK\Eb+\Ubk\]b[\Cb#=~o[=Bm.qaܦn%n!q;@]w4>+_| _,~Gq~g3<enc&7Mk 3|ƌ55K2fYY|ެ`Ŭh`V2_4̗fY|Ŭn*LB)n"RDhhqւ3:ۑ$$zy{Bȵ@4#LFYkk> qp@  VPaq PY>|%DW^|?ߏ^qo8_O27qMdK27q1σQ=dT-B :?Ӣ\ [~ ҚHZ#,)XL*V* חd>ȿޢW_*;{_c])Ihsq¹zpZ#z#uNנ6Lc<qj=ӂ>\27q'ހˠ?4!Z"w.uuPAUCܪYrD;>|>|cuc0-&ƾd߳/$uv%I*$! d-I)uK]nWy}3){>9?9,ofM3ݬe6ך Ffclf^off7:&S AUgpUӮ-033X-3eL?-`4e)`2Ss9ih2[[2o3o'ۼÜH9ɜD*nm΢"*o.f{=:|,3iٚ*mͶTdHf7VUs9Rm%:4iܥ]LW}]W>m>ϿO{_aotڠ54:sA\: :[فйWT"O|U3dk+Q&~ԊjJ -afh<2_}jD%7؇*3y:Ǜ?q'Nm.>gn]sZYJjGK\Z+ ¹,r jqt%&OS[;wCSzu@8HH?Q&,./tex^uxe]gjrifs~jkՋ_Jѕ+7'<~`grN47o̻W85>Pt$>7:@w+LNak%V:kۮ_g2UQ**kVFi>NuKb>XKo;}@K g0L6#ͨmdFj6Ìc1јbL3fuY2fIfY˚8,g簼Y fE+==f%3d32*V1rXL0լa5Lc;{ 5̚49L7W3,6pX0ìa]k80Ӭa} k9d/UۘCmgᰱل&fSrNzs͹xec|זöf';9lv )y#)Ns59rc pJuX{Rsh1Xl0[cq8l17Nx"S“I4dy]sIo o=o#ow7;;;;;ϻػ»ֻŻӻǻ{{{/+}%|I_ _=_#_o/77777Ϸط·ַŷӷǷwww?/%I =#??????cZm_V}aowJEv'Nڝzhwiv1ڝ&hwGN,jv 9}3e/e%_/e _LN=}|-}X6Ȳ?d1,&r:[j.پ,f·ڷzv|}X~V}߳wO,O}֊;,X&+SYV`Y۟oIJ[(Α6N,;pf? 9q~8nOb9??<"RK+Yoa˝Wo|ݿ;Y~5#XB", DG;P4Д4SC3BZr~hqh9˥CkYm mc%#2]=,by0QsC_euO,Q\qq&"q*.W"\B\8qRҹM[V)ቚ V&e@ʀ$$$) RH9r AʃRHE A*T R2He* U@T R$$$H5j i i i ATRHM 5AAAAjR6Hm: u@ddd RH=z ׀\r H&H&H&H} A4ir-ȵ ׂ4i:@iHc A4i)HSf @\r= A4i 5H[ mA:t3Hg. ]@r#ȍ @t;HO =Az7Ho> }@?H @ 2d A @  2d(Pa @ 2d$H AFfAƀr - r+ȭ rx Anv;@d"D @&L 2d2ȝ w 2d  SA r7 @L{@Lr/Ƚ 2>@ 2d& 2 d, Af2d.\ < 0-%VZmvh/هǴz4ca<1o6oQxv=4 ݃;xp )d=rHaRYRQ҃y"링Ǭ= ;A8x|?8^G#|g3W"\p55u8^p7lϒljf[Ak(w{ .!"tY+uqE6|tN')wM-gR'+͑a折. bk\Imz]˝e,`ޕU׷˹mh4sk[cށOh/uzCtg^B,s@kv^>7wq~MsRsA熃^`kGcJ4yغΰ@~K-/Kqm~ibխA35\v*\r-+b5t1Xmhny%[DןSvComq8Z?[Y u<[36ok_ڑm뮏!v>܋âH?:H`=l>b.>j0/z]tuZri>a.5MX:jS,M."gT|:]w9?^&tIseK~\r3wNgeΕs:W^&Ig˶~.s1v }7$۟*r+4 $YsY6~_bӿ]3Xnz C9ŬكQZs_lu| WWQbOa+VWCu;=gox`^dh׹chAn>#|KxJ.uZ6Xu?o4 +e㍌ͨ%4fVC$E1 $JYۃ3=xM}1WItMTc5u6ͧ||.싉ah8q3{}U+i[t0 +g@ qwk#tښDhGJ%A痷w74uGtFA[9&q('<;x5 lu;t^? $rs[sQ#BxgKûjn[ݭtZnmb)"Rb orlV>;9 kxjn[MvSn*=nֵCE[UmV3zR='C01\#(1Z䈛^lųb,b.ϋS(vbxEzOe@eH,$ "4eX )Lee9Y^Ve%,SdeYEV:H6MdSL^/2K [V2[md[NȱV9N&y(A-Kr|^/ȝEK$__/?Z~#UU>WujSTcD5Uj jUkFUT'5L W#H5JV9gMRVP-RqD=r_jڮv>_PowԻzORԇ#D}[V1uUº*iVUJZVU٪bմܝKܷܷ9g} o\~ī]--Yj!ee?)t#Q/L~rKCt xګ4CuV=>luej=Uh-=+ -zZ}~VE"a%[)UJMrw;C77=wq MBH<&X*IB<%ψbX-ֈbF|+%ߋQ8&O$$iH,ȡr.Gȑr-s9]+gLP.YIn[VMnCX~"?gsy\')CUVUTU4U]P5Uj:*CU5*SW TG5@ T7AjuR5W=G|ZV5jg ZVeZaKXReVr,תnpsww{]=+ 9Nq \\NG.g "˭C#㐛"CB={y׼xM4q.3}b_Cb#抇3BC|))ײ%{>'rIwɿʩn9M>"GJkZNF'm|WCQ'RTqu*V%U)JDUF%**JV)zުV5Nݦƫ^5Cݧf,zP=ƩQS~R u"˰r{'5x1"/]Qj_uXGz|'dA{7M>gZO߭/Z_[Xm}ohNr>o8].bma+۲m;b%v);.c' vE]NvM;=D7p﹇ݏ܏O0/x`ϯS"Y)^׿+ZyϚ,CyLƞyaqFs4ΎtϡlLCyn;FQA:z誘/5G4\"RU_Ncd?O)>Ac0 9!v ;E s%lD؆UUNI#៑w2NeQNM'ݨvUz5F5sQݹidt:ZFBR?Ϗ[Nԓ_tꩠN=֩N=:ԓSO%t꩔N=֩2:TVSEzJ֩z:|W]nڊX鱄)E1Q\$2"UDmQWdh!ZV'b~(bH8GzWVcςس8Ls7W^zzM+{?x,(X_ΦK˗iZX^Z=FYc[oz3@)2::EF'G8DpJ]RN)ݝT'Twj=ZN-d}Li44;&ٸ}}e qv1/h W2/|6k]eMYR_֋ڰ." $6ip3D-oVʧ} <==FFKbg$fGQycnjZuj!mli©Q/%Ub/oq9s׳nasY\2}T`mb iz3:aQy.D? SB,\= 0yz隼S3O=86YYi֍bQkAjVb(oك!P{=aGٷ${}=}=;Ǿ׾Ϟioϲgsa3l]B*_M)Y^9\إbK@l ى=>=Sٱǭ;^٣O76/‹'nh=Om4/n؊ȫ GB*[1λb9+j2{pنR]mCM븕P;ui`'V3jA;H/}mל-vz}}t]L/8cU>Il0c^mhOy3Y/r&UQ񹔩V|j^^j~|ãAn=ﻡiy~ kj= ܲGD]n_8^?8 +?ODʼB嬗(zUy: E׸8's(y|kb|k$j|qҰIJ`^rɈsGcǝtq#v!|||o_1J^M6{ȕe .W |mxĘci+ӛh=f=Fǭ)9m_FNuXSؑO?f^1.ou4[K{1A7 `zxNX\߆sQϭ P;B\H5ZPC!tNRMtۙjaTtOhvY/Y{"1"ވ?))))1#ለ$DJG#e"IV֑N#]#"#="=##}"""#C"##"##"#91=_zRݏ~|K~NQ^Aݪ&R_!)&ܿL(su5Z+fmUچkuڎGlI [o|-jf smM3b|6uo]oٲIwڦ1jk'l[㸶qCڲ۶'6`+x GD~ajj^tq_s_tգ|Ow=O *Kj1x~N9:[i<:tpjo}%3;~7#.rM^;͍'?z,+RP)$*ߍGo]J26Vjnu:P k!e^|VF̼oV>boW^!*&Qa!JRZs[jKv3?;fϲck zO>v6y82 w~6f?+~֏1xd^.jsl׎abe>jhs͉it[rm8݋8s/9v=ܾnecNbS~FJw 5Jի#lǸ~}v]VL3cK}v6w*mGRV@6N&mtkDu D_b>SƸH8)r4r4oLeҤFm 㵒x6.Fm?u%pM \S9l\״s?bx/a]X*1\V˱ho+5oEA5h4b ^~`04 ^^o [։>奵_rnrAQ++9"T97sn;{Or}H];V,ϳ0u1ϥr#݀yM~4܅u%sKP//<_RV6r}JZQyGaQt;3 y=rzr|+JGcK(gN.S O#"5N* oLS\|w3f6}sԉ78 s9g_^++ML$IBd-1nC4%r^In$T qIB$~k}Ϛ wgs{gݟ:JQ (, eb9FA ]Tsų .΋ݣ'(72*}5:lU,c'5fK!S+SJb_;{&ށ4M,8hh>Kq9c!̬5-oŻ n%:A<60dˡsť+D> BvBRmU.g F"^o"dm'ǘZv>ڛ'芠7\V5/3 <.^Ii[ sI[E3%!nM[f5[%Tx ~O$Z*S_9-/7:ot(222^ъRݕc1D1f^bg`DJc #b'G~&!?-?|~XTkhK@ }qH_җwd3FW%35'2pPJce6L*fa5}!:0)gN q c_=h=1eM>C=9F*j׫C^hW1f嫸;s#d.eVɼ26˜Z{?l6W6Y[i'Aփ&փz0k2XCރ5d?4.쟮O'QO ly|#1V>A2HȯF2X<1,_x7e<)wMD:Gs%jf9ajc (tx޸8lyپc&GEq[W)|0քoMކQͰYƬJ$VsA/rMq+tgߟHܴz2 қOr>1V]ۢ6C*hm.'YF+ hJJ^B/&َӌb,-H79[g򱤧]CIG4YcJl˜%B]CiG6+-]S+\;:8w.mft2:1/L6&4ck IXA 2.Mf!ͻ̻fc mͶ$ m32⣫-;'>VrZ[PEQP=(ہoe݁L.u'.a4zx{3tD_Dk9'I.̏qn,_Y+xyL専VXe3 E^č9އJLX\OoKj"VxYUdYG&[N=5䂢)OJ1S**J ROi4%@oG l vl# MhA7YGqvccܵ' +D_3"SS߂? ~+_mσCg^G ^ n? >~"%]R]߃®'K: ^V8 fDqu^&ƹ,F8#1vQa4KF!W7?p\:7B->Vx'7;88Idg3yyy˙,r8^!oG[u1vPWWY I^r|e ҚfXZ߃4u X: v OA+d91jKe5w1V;*$e~ՑuY+_a1a62iy`; 3M2SX*`a hXmXmrY_j- y Y*n׆X!>s9q~u;TfdPO%ux?ERav {a>7s~s:=E!>K1n1-91Ov+ҫ| ~Q߷}JF*oWvCnmx;NWWA烼;6W=< }]x~G#cG1.Y,g>V+p϶ӂ y텣ߠewם3$i)z?B:Jtͤ3,_:A7\Gt!]Dߦ. }s9a.1+UuX/]auyuB|i_S}Ey+u{beZos)PS \5))xG97 :z"U?r7G{=6gy<[T#pm0HU>?IјTqR-ȣ&׽ΐ<^.%a1oIg9uHlasJ[֝/ZN LKMFdj76;<7Y=/lN\&WD`Hc% ع%dKJeF3{:[S-նjvWpu:^RKՕuQݢf{}az֥ tvutźʻ*jZں]4W`p8Wkkkkk3׮,qi9M h>ԢZ VVU֪j5:ZZR46P^&iӵ)Y9U=S>x<))TT44It{{zyƠ,҂YYYYY99E#̈舢%"JEQ=vD"#FҝK4}VD'0 _H9S5I5و4>'fFzb~}NFIk>Y@{d)<:_;le;%vm";mQYg 0؁( `pq+#p 08* , g,B3}q}D"\0 (RA8H) ER!8)E"RA8H'h$o8 88WU qwCp!nϻKgy>.(> kC;)@{'8_``Od ;G~Uvt$khԛ"H)Roԛ!fH.!@z3z3z3z3z3:Y[9`g(搡"puO㺧q] g&E0-yd["$C_䯱$qݭݭ!CƯDݭݭ%DNN.1 gk 6H Rh 6&ggGGE <. F{'E]u^u{Ye]G],q#xp#]+&E2xw;^Hm -# qmMGPm1쵚Bz@9dyƻmd/9JN+\V|QJ(JyRS4RZ*J*,'X~]ZMu:pq2EtϥH$@IGK:=^翞qqCȐa\I$(hIpzH XIG=HU_^__^__^_?t}}\?=zП  ebHH4 @$@IH$Q8HFh RIR `PH(H"R$BDH(dӠ"R$BD)E4$pbKL$M& 1%!$$dpdyw2Nɸ;w'dywh:%AAq#8QAxH'tBZtB)AR0 3HAR "g9HMD b:p +PSz*.!@zL=U*SOE=E =Q] C7] iz^ٽ+ =4nR醐 6~uƂ5nR鎻˻#$C_䯉˻{@K-=#z  ZJm? )!4ҐB~Q@BԃҤNG] u.:]utYRꍸ{#FWL{˸{˸{˸{˸{K=(Aj< RIƓ(Ceh"B{H=(/Ӄ2҃2҃2CzPԃ2)LeJ=(=hԃfR҃fR)R)RRzPԃ2҃2$d_C9ꂖhҮ.U8~Y֟=Y{ d`6 e/a%6`#(6ưl{Ƴ-cga{ Vܖ(˄J;MQ^ ebȺ'ݜxcYemʽss 8HcTwL3P6L'o a=Η狗h\s)p/{.Oze|E~~' O/w9. c61ORZ78Q| CXyrmi3fwg/333sg/33CbfgB<3 g_f7?_N=vkY:_Z# zΙ$r!|]!@&vD/'JaRIAB+,ptV8:9˘& v'=&پ ElŸ%=+*E^j񼬛 ;=?R(}|tX.c1R*=*ʔ|A 2%SW2#H2!,Ы''q'`0 ^N5OߕR"IKd_d RvaR`i +?#u)G$BrnI|~]SRd2B0PڼR:D1EQ=;2)K涋%S3xKYی/hASцhUf;j^5x)[UcvDnMZӟ'Cpӹ4s* Z]V7JzZg6|L773́2*owE)U 9HZ^.t~&ߛDŰEl<*LCu~=qhWTK dxΏ-NOVNAʯ7W'{œtzH8Lh۩IrJU%GRRoSp=~ޝNrwspoo߮ߡߩ zE^YWի5z;=^O;.z>XGcq+x}>IOէ,}>GoKe }YVNߡҏ|F9U~SݪWSK\usǻ]izQ^\/cRz^FGWO_@PHX?П zG=EOջiz/_Cap}>V>QOg3oo"}T_Wk:3}Aߨoҷ[,~D?&‡[w r+-b4`S$wzSIVD=V|TPzLMw$e{ l5>6Rvj8/?#%Q!$SQ-Q˖{Dy\y<<\॔hv~$_Hὐ:XXC/(/bޭ_DQW筡ZjuZĭUZOG"ԧԧHڔT[-H^mOjR]MM"=_d?rs9&5R8rFbR1's4ss%rBtB"WE~L F\qEz_/7>=nOHk }rĎ(ÄF r|GK!U\ҷr2לl}_qX߽||*5wnwcV|X،cSeyG5 N|IkJ"+Õ1xeQ(KeA٤lSv+I嬜Q1QUQ^ZW;]^j?5CTǩ`7W].WWkByԣ)\R !FIKquwF^qMrMwvs-vZصz;]{%,.h4[+JjZ9VEiZ;-YKҴ>m6\ o5oI:>'wҾ$ך'| dR׉Tuu!}|þgHU_o_o򨯯YRoyܗ O:aqIxtܗ{$]2g, X X Xx7,`9+V> |X0*:` ǀk[[[&Id`G`'`g`* 0  7/Ys @ `0KQccは''''_NNNfgg |8&p.-<|B"%ewW/O??'A!aP1q`{`1V=j'J5Y%&+"׿KFW77¶o JAV=ĪYUVUFYk/Zʪ ,N.n={_7n~ pp3p [VA`eC*UՀxxxxx xxx@W`7`w``'`:7p0pp@X X Xx7Px, |爿G5GЮēlj(XMJ-*ϪjRy~[)ӂ-"faUE0KP]s|(4^q3\^+Z^HK̶9k4ֆ6KEo%*wvI$!NIw]MZ{$Aҽ(>IKz@ҟ$=(!IKzDң'$=)ϒW\L+Xl}e79{YE%D}RJ[o* UF3U,P+uFe[9WΪ:9F-VTś2r7KNe(|( ;~L[+0<IGJ:MRS7_% K0RR]қ%ݔ~ R;JRGҒVI+I'iI[HRv%*̿-oOtJQRٲmrdIgJ:O%cI4أ`e:g.XVlvٚ==UЎ@2mKb;N◟B36eoڷciO¼:kn=ɲ} XXXXXb7'VA' %v;íf`oRİX[ @k5b ^Y/YíHk5m#[pb@}W׀$¹R SUuS;KrO5Aզ:hZ/[hpCkn6Z_ YȬeJRZg}p=i/ Miڗ9:>O3$;i)Zһhz7-K轴DЇiUZVQZ>FkimC_ :Ct}#H:OlnGcqxw9̿ۯ9x[Eߧt ~J? uWk D7-[~G4;l/`?l;;ʎ;~f/ﴽ4֐\>DeI⥐#y!O ޗܯ= Ⳃ{{u+Nh`9yVֹs {wGweXeYlwS#B,2x9a-!U]˲8BXE,Be!peq,˲,X%{N:慿USMWS>Z5V뗯﷾m[ |]!+CV :ɷ ^ׯS-p]~ if~ }9~```?USpCx\_Gx[pTp% B~?A)~O! 2ZAE@. Fカi,kMMm]꽮'+@KR[hmC"T TP E)ԊP;@^ԏ0Ach'h Z֣ M-@v D5څ_'AO3r% _C ~eL0M4 4L0M4 4L0M4 4L0M4 4L0M4 4L0M4 4L0M4 4L0M4 4L0M4 4L0M4 4L0M4 4L0M4 4L0M4 4L0M4 4L0M4 4L0M4 4L0M4 4L0M4 4L0M4/54 L304 L304 L304 L304 L304 L304 L304 L304 L304 L304 L304 L304 L304 L304 L304 L304 L304 L304Wt0,Lga: Yt0,Lga: Yt0,Lga: Yt0,Lga: Yt0,Lga: Yt0,Lga: Yt0,Lga: Yt0,Lga: Yt0,Lga: Yt0`i9`i9`i9`i9`i9`i9`i9`i9`i9`i9`i9`i9`i9`i9`i9`i9`i9`i9`i;u~Fɵ-Bo%7oeh9!Z sh*FITJQ@5&ԌZP+jGuԏFchMih5OZGڀڈs C#ch$[(a0{,EqoId2ef`if`if`if`if`if`if`if`if`if`if`if`if`if`if`if`if`if`if`4 ,L04 ,L04 ,L04 ,L04 ,L04 ,L04 ,L04 ,L04 ,L04 ,L04 ,L04 ,L04 ,L04 ,L04 ,L04 ,L04 ,L04 ,L04 ,Lz?BZŢGG'Lo}8-(qT"6 <i on巍w]FeLlϕ;TVz;ۊT5wDŽ/6=/}|?AlsD9tG>/+M6_|KA ||t~sL]ndWLKlļX5~mø|$T~z-?<7*~?F)U8~lR!$bD]Dч.FpJ玗7QWg9!]jb$kܹj>Oqt1q~ q~ c c c c Kȍ{SB#"h$Zv<~+O;UI~hn?ʯGYpgMVLt|.,!+淳ܑ6Uoog+[lg`kήa;kxȝD9tG>/+)Fk>Q~>:?vv-]vv 5~;c`kW\6GOSٵ#W\og5lgQ~xe@{t1Uϊ2<-x{YN0O, ʡ?͢]Gy1 {aG?GYCsk:̯k:ĚCk:Ě/Kk%WʅʟVχYlK . .InTt|Egf8'6*o7+o_ Yn i< KY.\n "? ՄϮC8&*1M}&gq^sƄ毽C/Y"|K3Qy\yL+O*8WBeB'q*o8O :; ʡC(f1' >éܭ>íN!A:zmzpF7~ Q]~ؿ?&{WG-W;MJ$|P@ %8EwGt ?eS6?-Վ59tͭSYGhn 5k`?nepYpX8")9y|i4%i~o <7w#ܧ׷/x}߿Xc:Vc:V+_` >ܯ(4<|nUoOwws|GПCQg蟢G?ϝ#uZ5{DnyO?. R$Oe_q-Vskwq{scܘ&?~ټ߫%b5Is99AS3fsǤ(ڃ~eaFP)喕{-O??Α#[X˲ʍl$W'Z g>}SQtbx-xS2M77KJ_|kl/EaOX$dVuW}gFD |JFVuVQ肨_4(,M&98ѢhE.mDOE7w1!.\O5qM)/{J<#ϋī -x_\JV|$>%d1YF :xB<)ŜxQ"^ow{K; IEd)?rRKH##d!f$^"9Dcr!yr\%7-rO>$s<"O%IL"X$.I@#r";=G>%ȗy"!$ERID$K!I"F iI:%ݒ^EɐdX2&"H$%ɪdCrCrK#/y(y,ٗ<INiL*RZ.i@fFi]%!${K;ɉIKRT.JMR'HSiY&vK{CatJ:#K -t_\JVz$= dŲ2PFʔ2JfdYLe-vYG']eWeDJe\dOd5YM).ʆdò1ٔlF6'-Ve[}CcپHv*ȋer+"w<#7[.yO> $˯ʧrV _77:IyJ^#o7ny|H>,_Ogsy|U!!%ߑߗ??˟_ʏ XQ*HRA), ")2ZEEѮR(KŸbZ1` eŚbSqSq[qWxxxxA)mNEWqQ1V)(39żbIPPR(+*+oGS@Y,S RKPƔeQ٢lWv){}%r\yU9UrMU>R>Q>SPV*gBUS+ǔWSr^\Un(o(o)wWʷ#J*V*RTQ*ʥ bVըjQT=>ՀjD5VͪXՂjYTTVU^^UǪ3uD]RKjAmS{!NZUmnnvTUUUW#թZ.VjRTSjڥcꌺVݨnQ=>zD=VϪYzYTTVU__3MDSH5jAcx4!MBS4iZ5Dz_\JV}>4Ś2PCjJcѸ4MLj5-vMGӧ\Ҍh5W5ӚY Y,k4ۚ]#3 k͡Xs-Ԗh˵UZV5hmZ6Mh&mC{^{Aۯ^֎j'DT+k˴B-Uj)E1mF[mԶh۵]mv@{I;^NkgvA]njojokjwOϴ/c홮PW+U:Π<.ty]nPwY7Mhu[ԭu[DYt.]@etF]]ץtt#qUݴnVt˺5ݦnWHDLBZw;֝QT UNUQRJM(BT&S~jLR$ES)ZVujڦP: Fj.Q#8uf)Z5jIݦR# zAcL_/їRZo}HWMV}_?O'/W-~OT?1"C)QяzV_֯77wG'gCPh(1 R`0 CȐ0T MVCႡ0hl5L& ẁ3,V -öap`xixcxg81"c(2ʍZ0:Âaٰf4465^^ dž3cXn2Jjh3z!cXm76[ ~q8a4Fθh\1;{=SDL $7iM&3EL)Slj3uu]#3 kxf*4MU&Im2l&)dJM&Stto4]6&L&tęM+uӖittgzj:0413 s\afdv}9e17mNs|ܪ5kiZ/Z1u:g.YW[}Cc>Qg6Y[ ~u:aVκh][;{=SF؊l6~&im&El)[lkuںm!۰mv6emKUۆmvضo{n{e{k;b6hlM&m-Vl-۶mv`{i{c{g;"{Z{^co7n{}>l_Ogsy}վaae߱߷??۟_ڏQ:HA9,Qg}˾mcg`߳?_OQwrar8>Gđr8͎6Gr ;WSǜcޱXul8n8n9vW#ǩS,v9NҩtRN 8cΌlqu{=SǁI8 )wj&sF)glsv:΋!sy9q9KUsyع|||<Ş2Czc<O̓z=-vO\x=W=ӞYY,{<۞]#Si4{>{{_yz>WHG,>/2Z_|K߸o7c} eߚowww׷{{{{{;/}KU߆owط{{{;b_'J?]?k/Gi/kMMm]? J偪4' $Ձ@SoGӀ P( d@+@m1htz}H`|! _'“a:|=̅+Vx;|'|/ Gԅ3pc% Kxjx:<f Zx3|3|;|7~~~~~> "Hy*"#-≄"Hu>itDG.D#ˑDd2BGGbd%يlGDED"O#7w(AE"Kxjd:2a# Zd3r3r;r7yyyyy9G΢ђhy**-ꉆhu>mvDG/DDt2JGGbt%݊nGDEDOї7wѓ+*bq!џL\N&& :q=%+Vb;q'q/ x8HLIK$dQ4Y%ImҔt$}H2I6$mdw7y19N%$3ɹ|rKV%IuҐ%=P2N'Ɏdr0y99HN&$\L$ד[^i 2&.y"RETEJ)Sʑ"T&ՐjN:SݩPj85JͤRjj#u#u+zHԥT})՚HO]HSSdN]OqJj=NIK=HR/SoRR'i"].MWEiyZ6i_:Nk t[3ݝM_Lc+Lz.=^J77ҷ;QK_HӗӣdN_OsJz=NIK?H寧/o'"S)TdDyF1e_&Iej2 L[3ӝ\ e3c+Lf.3Yʬf6272}#^8q1UOOOOݞ~x=uDH  $H+mu%u͊  A$ nus<^V^W,z~FC6[Nb/q8J$,YJ$$4" >1gzb36>O&eI%+hK$L2KfMdG;ٛO&#xr29K.$ɕZr#N$ɣI,yJR婪TMH)cʖrJSHCr=||M'y2R)4T)}J)&Nե2Tk#՝MSéhj<5NͥRKJj-JmvR{Q$uH]etU&Mɴ1mKlK't[3ݓKq4uL#teMciUZtIuL)ݚHw{pz$=OOsRz9^Ko^ }>I/WY[!'L&n&*J1+ ?&3QMϙ@D i?K J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J h!zG?aƖϰe9xx@i?b3,60[ _wlتe\_}_ϾbīpcWj\kq=n?a?W/eor%!rkZ \p׉ ĮğK2W理+QK) ԕdJJZK:JKzKKKKFJFKK&KKJJJKVJJ6JJKvJJJJNJJ.Jd2YJV##d(2VzYM)dC{1cٔlF6/{"{*{.{){%{-{#{'V?"͏pM@~@ wԢFԈ`u!8A} nrhp noXmA{; B8]" ?I !o@V@VBY#O(d /7!1HTB Ր$R4B!NHB ,d2 AF!ӐF&C@ml3d?BvBdgȞb y W+kȿ@ K eAB~/dL`<4y0̓iL`<4y0̓iL`<4y0̓iL`<4y0̓iL`<4y0̓iL`<4y0̓iL`<4y0̓iL`<4y0̓iL`<4y0̓iL`ӼdWMtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtLtL$ӿj: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `: `:+Uy0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y0y......................................Hմ0-iL `Z0-iL `Z0-iL `Z0-iL `Z0-iL `Z0-iL `Z0-iL `Z0-iL `Z0-iL `Z0-3ҋ\Lﺾ(zY[oU/o4\1.W*~[UU#nOe?ͣ ޟkqUU{qs)~/xFͭ7wn?Ƨ|?ş/Wk ?/Wk ZBAh 3 D)h!ډ.qC%G@," D A$a$l` HD3Ft=D1@ "fy xN$^7;D|&_oĵT^!r,wȽ<&O-vy|Bg|QLB*_o# rN˛mNyO> ߓ?˧3ySsK+k;G'gW7TQV* ¬p("H)-vEbB+fbQLBXWl**+vCűTqD}ŐbLX1Q+(*+^*^)^+()>(>*>)>+(*) eVPjfCU1eJ٨lQ+wwJ^9gUrSV^W*s Q*U*JGSZUPUjU VeV9T^UPSTUKuKu[uGuWu_PH5U*AzzZU6UoUU}աXu:W]uR-~Tz5Ռ:SgMHZ]PWk VmV;^uPSԍuK}K}[}G}W}_PH=ճjA~~^U7oջ}X}>W_YFVlREII udl"[%AriPVQUS_dYM֒ RKI%dLd Nv.y|H>"'H%r|F Wur|K'w}<&OsRh4ˆFk( a4aM&iҴj:4ݚ^MfP3ьj5i͜fiTkj5 Vc84^MPӤ4MKsKs[sGsWs_PH35AyyYլk65o55}͡Xs9\jmRj1JRZZh:mFۤmvh~vX;Վk'9vI]Ѯi7[mAƴ)mEۮ>>NhyV.ji_hWM[{v_{=֞jϵ:DWԉ_Du*^Gh t]Uסua݈nT7Mt %ݲnEmu;=݁Hw;] [ۺ;G  E3 ݪn]{{uǺSݹRz ^)=ga}>oҷ;^}~P?яi~A_֯-~G?Og Af(7Tj Dz^?gU~SV^s1* 3 ze !l3d MVCk7  #Qøa0m3, ˆÚaðe6 #Épa2ʌ*c0FftY#gLêaݰixkxo5 džSù҈ˌ/0ʨ7RF:cdl5v~q8b5'9qɸl\17[mqx`<2ό+Tn2՘i2l&5qlj3uzL}`<4OKb*3UPfR&DSTgʘLSo4 FLqӤi4gZ0-M+5ӆi˴m1LGәteU3a&F6fΜ0כmNs<`23?03y\iF͘Ye֛)3mfas9cn2;^sy0Og Ef)TYj,-6Z8KRoiY:-=>ˀer2fylX-O,O--/-,-o c [,KaZ-aˈe2nL[, %˲eŲfٰlY-;=ˁrb9\X(UNUQ5AQn8*ASTIP}5DݣPccj'S9zEPGB}EnajƩIj%jZ֨ jڦv=:N3ꂺʬ*kVfu[Y+gMX6kgYYXǬSVjUjm :nN[ %uźfݰnY;=zb=^Xl2[Vc#lh6z[ilC{1c۔m6o{b{j{n{i{e{m{c{g`hdlbjf+Z®)b[mضl۶۞vd;.lWv^evnn;k {f!=}>c???_;JjGC::bhwt9n9n; ~f_9drGA8Hass$fGs 8cǎ)njcq,uV8NS4;N39SFg||pYYr8 '4:mNur΄lsv:{}s9q;8:;_:_9_;89?8?:?9?;8:9RkiʹA:FFn[m}O?4OH?_Ы:4n9:AtI}=Dߣccz'S9~EGB׮RWUR.򺂮+jt]][ۮ;G u E3 תkݵzzu]ǮSq\C{1cהk5zzzzzzzzv+Z­ut)wrrvquw?t?rOy[p/_WM[{{}>vݗS-Fc){})Tx=G1{'yRFOyyYYx>z>y>{xzy o֫jf1om{ww^;gUw޻zs*}|z}/e|MV_G__߼׾R_WS>/k}][۾;G  E3 ߪoݷ{{}ǾS߹A2AQ1zbhaLaVfz~ffFQfd`ZFh3`L1)iaڙ.se3G3,2Ϙ*l2o.2)s\ҏ1ʯS~:ow~?'9ɿ_71oww~?gU޿s%el%b,,Æ:66l ;̎8;Ns.+nG ]-6{g ggY]d/Uvd߲]v=dS @e `U@t uL)tzp`$0LsR`9X lہ^ p8 .WAY0gz`36>e +h L0 fM`G;#xp28 .Zp#I,x B塪PM!cr4_Wnp?x<σ!$T !, CT1p. 5ZCPo?4FCth.Z -VBkVh; B'E*, 5a"La[f\87p Cǡy2•a4Ua} a&ׅ3pk# hx<<υKJx- ow{Q$|_EdHU&BDȈ1b#l$"H[3 D"""cǑ)!D"4ET}&E2Hk#G#Ñhd<2E"KJd-يlGv"{Q$r\q2j8#9#gq\皹6n=Ƹ7sOs% i(.qk:nanƹIn%n[ָ nv=;N3ʢѪhMQcuG(MDѶhg'EEDǢSљ|IiyeUuM]CcS3mvD`t8:G'ѹBt)]E7[Nt/z=DϢѫ,VĈ3l1wqD>kuzb}P^Al,86ǞĞƞ^^^>>>>ǾľƾŮx5c\l![bvl';NbgU\/WkD㶸;ƹx"^o;=@|(~/ >OO/o__uuuuu:mQ " Y߅8?z;y'rpv2D'H)RJ)^빔RJ)uY̲e1bbb 1 1 1 Ny;?~BχW '^__^[?X?Zfz.]ݻw}ͽA;{w---mmc3V;7{o{^އK_տ]M[swӿo~~qLeؿ?ڿg%U7fwp01xp 0ip`np]{  V V6v}``fpՃkn< n>spA>868983o 3xs;w |8^^z:ә^z: ӹt~t~t>^z:Wίukӹt~t~tnl/=i/=϶{|{^z:_h/=?h/=;KOKOGsg{q{^z:^z:_j/=/sO{Y{|ttm/=o/=I{ogggٱ3{Q{陝^zfKD{陝l/= &8h &8h &8h &8h &8h &8h &8h &8h &8h &8h &8h &8h &8h &8h &8h &8h &8h'8vحcW}qKc_cV0ul؁cq;1vzc_طǾ;`c?ͻhK.shG]59קs]3?ӺV>3?; >?Fݤ}m>oy][޶yg_{@\}?rͻyo{kޙ?/|Ưnomo|׏o9ox/Ǐ?;W=7;w?42Ot&įL|f&>;ћ&8񥉯Le+'Ll:{8QO8=ՉO|sߝ'~0ÉMxy3L^69;yՓN^?y͓['os{'N.\>jr{'N'M<3oL~k;oN5;N7SSO]:uSWM]3u S7M257uSwM3uԢS+VO1}z_;O`?3fff.lfvʙg~ƙg3>s3,Y2|fڙ3g9:99sfk3ߘwfޜykwfޝyo?6?v.?Oߟr7-cW{7vCݙUcwu?أݛ_Խcg?1ndgZgcz~\Z/џKg? |W/'J%JY?U_3zޠ7כw?f]EO?6]ޡ_?;.~Y?{+zo{hgO:jvkvSj6k6k6k6k6k6k6k6k6k6k6k_תMڄMڄMڄMڄMڄMڄMڄMڄځ.ОuCS{ҵ']{ҵ']{ҵ']{ҵ']{ҵ']{ҵ']{ҵ']{ҵ']{ҵ']{ҵ'/_PE.ևt>K]r}LWRU֧t>kugt>un-Uvݡ;u=W}_zP_C#zy&4ըZh1}IzB_ѓg =v5i;qG9(帶Ӌ[b[b[b[b[b/f+f+f+f+f+f+f+f+f+f+f+f^?'F6?F %lQF %lQF %lQF %lQF %lQF %lQF %lQF %lQF %lQF %lQF %lQF %lQF %lQF %lQF %lQF %lQF %lQF %lQF %lQF %lQF 䂍6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6J(a6:?u>A]}X#Lu>I]O}Z:]}V7&ݬ[tnCw.ݭ{t>tE=GASiZiӗ'=)}MOzFг(a䂍6J(a6J(a6J(a6J(a6J(a6J(a6J(a#ϓ6J(hd6 l(Q`F6 l(Q`F6 l(Q`F6 l(Q`F6 l(Q`F6 l(Q`F6 l(Q`F6 l(Q`F6 l(Q`F6 l(Q`FopF6 l(Q`F6 l(Q`F6 l(Q`F6 l(Q`F6 l(Q`F6 l(Q`F6 l(Q`F6 l(Q`F6 l(Q`F6 l(Q`FO~]"}PCD֥.Gu>+q]O*}RWSFֵN3AՍI7ݪtНKwݫ>ݯy=/!}Q=F4BKFKz\_Wu=oYmm(\Q`F6 l(Q`F6 l(Q`F6 l(Q`FA]}X#Lu>I]O}Z:]}V7&ݬ[tnCw.ݭ{t>tE=G&iZiӗ'=)}MOzFг(eR6J(eR6J(eR6J(eR6J(eR6J(eR6J(eR6J(e#ϐR6J(hd"E6l(QdF"E6l(QdF"E6l(QdF"E6l(QdF"E6l(QdF"E6l(QdF"E6l(QdF"E6l(QdF"E6l(QdF"E6l(QdF"oxF"E6l(QdF"E6l(QdF"E6l(QdF"E6l(QdF"E6l(QdF"E6l(QdF"E6l(QdF"E6l(QdF"E6l(QdF"E6l(QdFO~]"}PCD֥.Gu>+q]O*}RWSFֵN3AՍI7ݪtНKwݫ>ݯy=/!}Q=Ms4BKFKz\_Wu=oYmm(^QdF"E6l(QdF"E6l(QdF"E6l(QdF<=6l(l4GFelQFelQFelQFelQFelQFelQFelQFelQFelQFelQFelQFelQFelQFelQFelQFelQFelQFelQFelQFelQF삍26(c26(c26(c26(c26(c26(c26(c26(c26(c26(c26(c26(c26(c26(c26(c26(c26(c26(c26(c26(c26:?u>A]}X#Lu>I]O}Z:]}V7&ݬ[tnCw.ݭ{t>tE=G&4ըvZiӗ'=)}MOzFг(c삍26(c26(c26(c26(c26(c26(c26(c#ύ26(kmkv:ksyZ:__?3ymY7&ly;tݺG>v}?r#;mǜsv1gǜsv1gǜsv1gǜsv1gǜsv1gǜsv1gǜsv1gǜsv1gǜsv1gǜsv1gǜsv1gǜsv1gǜsv1gǜsv1gǜsv1gǜsv1gǜsv1gǜsv1gǜsv1gǜsv1gǜN~9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;PE.ևt>K]r}LWRU֧t>kugt>un-Uvݡ;u=W}_zP_C#zT jL?BKFKz\_Wu=oYm혳c~?ϿOwP9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ9;옳cΎ;옳c>s>6*ب` 6*ب` 6*ب` 6*ب` 6*ب` 6*ب` 6*ب` 6*ب` 6*ب` 6*ب` 6*ب` 6*ب` 6*ب` 6*ب` 6*ب` 6*ب` 6*ب` 6*ب` 6*ب` 6*ب` 6*ب}_lTQFlTQFlTQFlTQFlTQFlTQFlTQFlTQFlTQFlTQFlTQFlTQFlTQFlTQFlTQFlTQFlTQFlTQFlTQFlTQFlT߯ ]b}HúTe.t>+ ]Oj}JӺVz}F7賺Q7fݢ[unSwnݣ{9ݧ>=/a=G5ѠF4OJkme=I}UOkzZ_3FlTQFlTQFlTQFlTQFlTQFlTQFlTQFyVlTQFF#}lTQF%lTQF%lTQF%lTQF%lTQF%lTQF%lTQF%lTQF%lTQF%lTQF%lTQF%lTQF%lTQF%lTQF%lTQF%lTQF%lTQF%lTQF%lTQF%lTQF%lTQ./بdJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨d_H.чu>Q] }\WJѧungunͺE6ݮ;tݺGsO}^ zH_zDjASi1}IzB_ѓg =J6*/بdJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6*٨dJ6بdʑF6بb*6بb*6بb*6بb*6بb*6بb*6بb*6بb*6بb*6بb*6بb*6بb*6بb*6بb*6بb*6بb*6بb*6بb*6بb*6بb*6بb]]QFUlTQFUlTQFUlTQFUlTQFUlTQFUlTQFUlTQFUlTQFUlTQFUlTQFUlTQFUlTQFUlTQFUlTQFUlTQFUlTQFUlTQFUlTQFUlTQFUlTQF'~.t>!]R}D飺\'t>)]OZ]ݠFݤunm]wNݥutD5\ -jme=I}UOkzZ_3FUlTQFUlTQFUlTQFUlTQFUlTQFUlTQFUlTQFy>lTQFF#}lTQF5lTQF5lTQF5lTQF5lTQF5lTQF5lTQF5lTQF5lTQF5lTQF5lTQF5lTQF5lTQF5lTQF5lTQF5lTQF5lTQF5lTQF5lTQF5lTQF5lTQv/بfj6٨fj6٨fj6٨fj6٨fj6٨fj6٨fj6٨fj6٨fj6٨fj6٨fj6٨fj6٨fj6٨fj6٨fj6٨fj6٨fj6٨fj6٨fj6٨fj6٨f_H.чu>Q] }\WJѧungunͺE6ݮ;tݺGsO}^ zH_zDjASiZY4zL_W5=}Cjk 6٨fj6٨fj6٨fj6٨fj6٨fj6٨fj6٨f<6٨fzd>6jبa6jبa6jبa6jبa6jبa6jبa6jبa6jبa6jبa6jبa6jبa6jبa6jبa6jبa6jبa6jبa6jبa6jبa6jبa6jبa6jب}/7l԰QF 5l԰QF 5l԰QF 5l԰QF 5l԰QF 5l԰QF 5l԰QF 5l԰QF 5l԰QF 5l԰QF 5l԰QF 5l԰QF 5l԰QF 5l԰QF 5l԰QF 5l԰QF 5J?3 w3 0 Hd'S$2 *QX$"$C4s\#K2#3G]555u}}5#5s5_324ss:sog{Ϲ{<F~YngF~YngF~YngF~YngF~3>a 0˰ΰ/2\ >ɰS +.dXi>ðb5 0\Y>p9_2\y+p_1\E _b _aaWc _gX p#÷nbhf[nekve w20]Yn繑F~YngF~YngF~YngF~YngF~YngF~YngF~YnƄF~Yng=b- E P/Ů%Ι\Ozlq- XME|DOpMwX>s=hDY6yƵU[Yz@y<˞9| R=|Fx^.D"ᏅB+V[Ď7#$#/hTngŰ;*0};׈|oq+Ww_߃~BȱE"o!6C k'D#wG3~ ~"Inr7H7 ԁ*yu~i&}Q:\ Crbx_ȋ!ޏ)N89c /_,.F? # ]XC"RRh<affD[O7*+1 rUiCXE*̖J;:kci?G!- 'j?Y m S_-N'u Ӛ Oç!3"G8FDh䁩`p Y1g_ѝ{6v"i|@#|{ _{U q8xD';?%,>xI'=?D$!OUBYٟ䩅,OO*ѣmpѣeԳ-ѳ,D!E2,c ^! E 1Gņ[eZ۴yEh' QgE fN/F aq_v,6rĄXwX>>0 6$ Po4E!ȋr߆P"C/hԍE=] ;2zl,=J(SQ'ԃ+AݹpO,V;9n݁ \Ya({.t'r#@VV&=zd,J`,[Q8z>](H(ţ^\YR3?>beósg: G1,bdxa3Ë [^cT`hc͛V<f0czgx vp5M 0<:o9- o(J 5^q &3Lc8pُ?GW,*OJM{Sŕ}Zb`?>qqPq'`p0Cl,O$)LOO{wX=`%HuCi?ih:LfAN9AsQ!Уh>b?/ *c q;,l_SG7؁E}h0Gh8z@#(4"bQZY򿔎r+Dv ? @ 29! !vx fz!6 @XXQq:CX4Q-_@#h2rSm,?`+ƣED0\ Ac;ae8 y g2g8a 0˰454#4'4?4&6UX9M.Oy,%olϲWT22 UVG+nj̱Q,w^ K 612lEغma{ÎrR]]zWB^^^1!1)9-xw;Ýwkܵwn"95#"#"#Z=z2<9|OOi"ݑ񑩑95#"#"#[!q{㽩 o7[z7z&o5JrGGFeDDGFDFmjjjjjI>/ޗ}_ok5Zhwt|tjtFtNt~titMtmf ?y rFg37n2E@#\ Y`=D0X/ˏ2b +%'IC^swF&ogI Я\yGpaZ8Xo. >j{<1|ɰP)D5hEF 5AM4jFOێesy+C(qaC8Wq?ęur.߶܃s{88!MhU" Bz@~tC'Yt`vb/É8!x8oMl >Ùd780Iq>l)^ G dG̙fm#s9m5Iyp^s6WeCle`ձZ_{8nnGn9|+ ~YUgR Kfyp:ߺ9&s>iJqw|c:ڳo8WUjFuhڊv=:SX2va<xp!./ǫqހx>>/+L\G:ù's:_|ߠm;c16ސPc&`C)Β1IJ`ymȒ '>+LXwDq6-q44" [cX$|n?HT=N{73"68'9w+و3.^wq`|5'񻛿ݼJ#Š}KoI`"/ $)^{7v;وoL:}s6"':"dP̹3~F#iK|8u<߫v6`/2|5 dEI2AZ@=p o&`3KQHHی>B7Ǥ/|̄o|6U2l#E?g՝kD22qNPW6 ܳI'50DL`ij- :;91L+kRXfzGZj k lkﶀ6յ ,gdyy ~xyu>mpӢ9;8.|Vt LEh>*CUh)Z֠hڎv} ⣮NgTj|4fZ-F-;:x}oϙ϶wN^w6dOƎas"΋87pkş*漞=.B8}kblu4r; y?:o0QٛW>f-:eҩ&tPy<h>]Ǻ .;3 B: qyH(j{9o_+]9O]7sn__Ik;΍A9 M{v Uz`=iQ~.XO3cz`=3ͤYWu`=s;9X[ L|{uiAP~N, 5a|ϳwK?+ゲ\4 ֋3MѤ<8?SL,]\mMzIYk|&nsLzI7`tI2~% ~\ӤT1&},x^ JE6֟~1- _^gLzI7>sj`KItI_ nEI5!&=¤sSM1L:ŤtI8ߞ ֫65uIWj7&ϤYn /L:ƤaғLФ+LzIיVc҇MI_4zդ&٤MzI2ixc&NHo-=!DB|WP">?bjkߵ- PayyžgC޳//'X1rMSIڝ]GR{='j/79PC!35]M' 5|fY'_Q会fj6SǑ/5\Ts\?Du"NR'drYN%_ES7jOjV!jZHEjWb\WKZjZFB mjZIZVQ.RQVՔ5j ԥR*eTR_T_%%jU_V_!jZGm:u U׫멬֫ԮnP7PEݨnID5u:m6TiCA]Nu' WVwh[M=uT{WݧF# kkT&j"M,vBjnͮi7MT]shC =ZN-"HEiQv@;@SFjivH;DhôvD;BiG4M;q:@kҚ@vNj')N3:D;Cs95ktv^;O3 zvQH3K%vYL;@tHpXV:as(hPhF8'v.:v8^8|}㈡w ..t#> l߮fi=փ5SV4> I=tKJH&I`Ó%O)`){5,Uد0Gډ`'\?pkKV9̎#fiӛ]<,QW 68?`FzpzzD]]5)kNVY1S-AqsK3v;a\&XPo7f=?ˬ2g=9#PCP~ć>#7lzeW edCvN;)) 3θ8uĢMEnrэ.*9SҲ sA v,سq2R*K-\6,,luYD8Y27>)uc9N:ˆ.+1AJ=M3uNkey\3UϳZ6~xdksXF5y`,/38,6G>8 do5]Z{1=kډ3p lkBi^KB'[ihGPZh3zF{A{BMh:>G/~pj1;#h<OēWx Z4]ſku X ׁb?ތNDq/BTFpDP %A<$#q:Ca$L0y?H)x#3H2£lRH1)9,g/\<2.#oq9y /%&Mx-9A>[y%~|E.ߓrG#IEJAjv|ԉJ]ԅ?nMN;ӻ' ?hw|ChO?)4Ah|E:Ɨ:Ei:LGk:+t"t<. "$VJ"ZmtQNhqwIЏI4=K$]h+m#=QPH%$a@a (K2wQa[ DŽɛy+D(29&j|(~(4333rVlgyx4-b (~+^%#~'~G.ߋߓI"i,B4ITrJT+T[.X>/$2$Rx#$*'l 6& o٦ڦ l᷶۶y"amm`+ m.[mmmm#)sPp#ЕbL {źB[7e"-.b&ǥr|BzX>)*M!_okR|]!?ؑ؉Te=n-=k=J^;Kxi}}TgھXzվKW&ZieүkkmWKaKکEUJԨD)ar]Ix_:m+"i.Riqt/ g;uy/inۇ(mikEZTt'3P1x.cZϑuUuUkc]Z_âPʧ@=PJXBmOE?k{C(~el;A/,^ f !*C*4;PA3>A%Ы_> S' .oz>{.=2&i.p\ł ZP/mr""DwrP.\$VۢnJK6ʹҦiItIV6w3;ruk֬Y~sqn&G7ㇸ6܎;p'KT D+"T/ +Ed|ahz>y!.H^/Ó7E|",|OaM4r-֡iMMw0/,-aiՄUGZuaCշpĜ[ TѦ6UmNz꣣IDž&| h 4 <M^ly  kp1D&FSѤrumyoS+T vj;S@RmsTzTlF?h+> ;PN5tGv?7K婘I MX&*bzl@[x+lCۑQFC,{쾡awgy/_=|>.K/ &| ݷm5k`{#n+P}~`>C?jgG1nF?xT=W]ǐ{w#˻;}Qq.W/Ƣd4/zM%i*ߐ\-<}ViViViViVigoTiUn[ViUnUS1EST1ESח?ßUMZդUMZդUMZդUMZդUMZդUMZդ9YdE.\kiUTSinnn樚hEbi*.wʨ'*kO'CoD&6e}n.{OnͰN)d:N)d:N)O:Z9Z9EnԳF=۫gwzvݡgwXOlѳ=zG۴=/OӜ>ݮOsɯE$ˣу)kgڙv)kgڙv)kgڙv)أ{b^ܨv蹍znƥq)[J-emWzo)QoTF߫{hkT=j~ߡ{)_85#l/Uy֮FSQƏ}@OK+ֱ &pO-qmEJU;-rguf379[Vrt*ߗjStor;S>?W~[RE_wY• ոwDET돹JO/;$ڢ%:ͻb;]qrrvЛ_r1E{\Z]y4:6{9 `ViMTMTMTMTM]`{atEʔ+SL2ʔ+SL2ʔ+SS]9͕lte+]FW6ѕlteg_YzG9c꫒/ƨOs_—|5 n7&z8I+)k.YG[uSÖp4ޏcp,>A|pS0 |S4>4| |g,/qxq<'~ъa~_`!a1/+<<~F)_z+^Xk!]XN}b%Var/k+ex сXi5X!=a?!Lc䰥<hPxU-U?/ǗؾBjTÖw`Cha8G8>L5{?>i>S6mFkaKM*TQ:ԣ{{cw!k0Sp k_#p8{qyo8}8IB%.l\91z{?w/BoBaıaĊ?Q1qx"ZT5Zԡ{l>B aL)*=a{80#^aYsq p>a 0NI8Gq c8>O4>O3,Np:q&s`ŗe|_Ź;r܈&܌܊WGŽa>ǃx?63cxOI`&O y8_sqN.Mfy|g?_ٚ/nfPlqҭ^Y]p=np힧M|̓#1XEXX&FapbET;Z}Wh'Z&NrL'NAH{]v]_~/;ov_PJXhBp^__`$NI!a]⌰4q&]EEvFXZ; ڿ ܉p7܋#܏0!6?N|9qGlnbf̥_ jz\{. -[,Xnbr-[,Xnbr-[,Xnbr-[,Xnχug,/8_ 𤰞CeC[o}'m-:hQ5"r_,r_,wȽCr{GǍahW:!quC\N@3Ŗ@TPAHEҟM&*4b5:qz4E3e?[ǏǍǍ.nj^j^Lj̤Lj̤Lj̤F5D&j4QMhF5D&j4QMhF5D&j4QMhF5D&j4Q31313131MQZ((_'2OWh2MiPߏy?/%.wɿK]G8%.qtK]ze6M|I0fsq"trY7̸>,~+:\p#~p3~[`6֙ufcXg6֙ufcXg6֙ubXg.֙ubXg.֙{MD-̼_JzGѭ=׆ۣw{n{,Xcb={,Xcb={,Xcb={,Xcb={ifoS{ޙYގɨ7(r7AN)2Sje;U]*r(VYʲUle,[e*VYʲUle,[e*VYʲUle,[e*VYʲUle,[e*2iJެL̎J\r:`LA29Z&h̓s[ɻ[ɻ[)YȪEV-jUZd"YȪEV-jUZd"YȪEV-jUZd"YȪEV-jUZd"}<'b,~3ǖ+Duo\;䵟ͳO|:!*1*a0q>/]C1wFG9cgZZW'n&&nuwăމ$;x!8"\K \ٸ  Sv%LbnK6@'w0keقÚ ?ѻ?$q޽7q~pX.u ,JL@QEрЈŻ~p&c  hXahXaaM)>S)|gq>q.ŸM\o \m\A3kтQL>*& /dgtb.PIV' %晘-:`آufCyͣNuGZ8'ꂬ.lYw=^>|{}G?Ǐ>~}G?Ǐ>~}G?Ǐ>~Q0GsQ0Gs,uCV7duCV7duCV7duCV7duCV7duCV7duCV7duCV7d!á 2p(á 2p(á 2p(á 2p(á 2p(á 25~[w&wIhg\q K19f;w,WU~o0B=TRC{y)|y)|y)|y)|y)|y)|y7TߐR}CoH !Όpf3#gF83™Όpf3#gF83™Όpf3#gF83RRn)D;:iڦ7Ŀ!k߾͉:w<&|oJ{}$ ut]jKkC"隦ki隦ki隦ki隦ki隦ki隦kiԐRSCjjHM !55>@}t>HA}t >HA}t >HA}t`Yhhċ*=,M.kĎpGbWx#džm/'wyє?E^[{E/*'53Wy]n4V+~'<- ըӳ9> a8yJRro|ҖԨ7o;7 _qcw9v7{W=Gk(/tg\V<~ >d+.y޲6=lΰ!8/  7Wíaa>X>?fzRTRu=UG멙f9J(d;Xb Qp3Sp=7Sp=Rp3)K^ R0KL^ Rp=7D Xb(UTRCQ*GrQ*GrQjR)K *P*Xf'^ Pj *juvCb0,PٳqxYeRgdؐ &mJOG%nUJ~ |j\[H˒uA[Ti>=uOʋU9wu)zh/q]U\Uꏢxzxkr;dܡ;j(gěk9W͞h+76jSn5䪼JUIh*UѠgPEhPU A1"bX5 !0FU¨JU U*`c֨?,G&?*]K䗸䬹(&G]P]e6)ڝݷ;}^ʸ9Os];(':6_9(mƆ_TAk9PT6iMMZSx/|~u?a ќ2E]z.C]WEoÛ0(1Oe;xsmI_-TXU&75Dᕆ aqCqGⲰ^;Cx?Ob+r{9}cuG{Q}g\I^wFyr5\?ęQQsT2oMsh׭F'53Sq4?6X{~ombc5ɶ[V?#F_oC=1(hLZkbgM]Mݎ%]]JsRM_U$]K6{cT8URT,k3)䁾;G<0VgG>L 3Tf5J-"-R瘓/'OtI89GqJhMN>YO?5ܠ3.1O7= 0;.~vXS%{鐛t^d*J6܎;pWݘ{?߱ym?Yx*Zx 3t +[ \y/xZB^r-]?8Vr]X'^wl%V˽uzn@[^VV;K]15X3P ^0GPװ~ j^͙ 4uא *m'8Vj<l ~#v|w9 Y+| m~8g2@w;`C=0LX蚆>h^7 w.5L& j)ȴ}pϧݿa~n*I\jJ`*txd"$xK߮gtm6ֱӱ[uz.|Nug謋u:N٬K%鷪M:y@$ XZ_ Ӣ*M3=K\ vkhZڭ^B/52"_UZD5o7[EѼy5{W ͂!+Kky{qh[[yGh@.-w%S}I~?|~cm[Xj:c=鵞ی5WfWr\3jmZֶ۪ʨjkyu;›pjjncX>2ck4**L=Q-CVejዦZӼ4ŗRkFMD.z-e(ۥ6 Xg3שijd)cum&kڦfVoMu&2qՇ>D!p \f.3Qv[f-3閙hMS[nbm&r  Ӫt1zLөtj3L7LSTj3Lhi;]&Ze-8el2]6 LEi25֚ k9Sk8TdNk9եe:~_e:Mޣ{t{n._|._w7; a,.uTܪkvu_un5<]:"1/ZyѪJoʭ*>VU|U>ajΖ~jΪjΖ}Kd-{;Tva$*HުNVuw rȅ˙fVsYVwXu;% #E߼m3;Mc=yƲ賍.۸6۸M /E1(9hr#|>'7\T!B4I|׹vs/?w.Qfgvd7%\*֣c/zA<砨P@-/ T@k,J@C krI @.L |g)^wgv>YrUN?G9}(}vhvhhv6ʤ| 1T|MfZl?FFV_WiկM9c)EAo@6Iiyc$;Aɵ5JX)YjSuXkZxSjsaeIo/c)3S11]uP(JԠX:w.;X=}=_3wĥ;V/%y#gܫgz\G].%a\Kr V.%Xp -%X떰Sf3fXOgVt{z]e> x%PTm2##7>eʸIcp' T>`q (fz?=GWѪ׸چ"MVW|rŢ 3u+QB6#n:ĞOPC.F\LjNd$ ֝K/Z> Ů/|"\E+شjiOnkibش b&)x>Q>fԿpppm,ՌGSr,? ?>u -V_o\hz4W=UOF_գЧ9ztN=^y0zw"ZV5]m;},e>Qߋ_5~;_96܎ a36Ɔp;6lƆk6܎ a56Ɔ۱vlX s6leذVcjv`XmJb$. ,$Hk$Fk$Fk$FK$ I I8ccq&5""o7Se/ X0}80*P092O n;`~MY2&Dz=@z8 L.5p|wL8 A> p.~)\ gp \ p\ #$X7k:=X }3 |Y/Y|XށX4h=3N/vЋٺ4 :C 9S PY}{^_ KC%z]I~z: ȇp^nz a'wA9pT~Mz}Ұ pB~ _0; BĀ&p^>na}kШK3+^'7Kf\GȆNip\ p\ W~/a^]]}\ Fqz)y)y)y)yv'I`UX3`&̂< +ƚ/s|Xrחi' &ax%psvB!@W2}`v`v, l/`;np z 3g 3g 3g 3qf!b̠{=l4S4<@o^|P`3ǰPJG^B(O'bJZհA 3YuСҢN:-괼Ҡu1m(־b+ֺb+ֹ(s# .h L֛F )lXBo] Aav`-g-g-g-gJcR5W̚[X @AX+6d @Bx!s9^/c| | | | |7xTġBqGWqGWqGWqGWqGW!i]]]]]{$'0HaC. HzNH.Acި1oa[@&38]"1sd(Ur ]loVOu3'1@r0`,0&$xŔo-f f f |Mz>fJpt_ /S-2!)e >eJ\GBG!Q(??懘Kq\:]R]{ſBbaa8Ϟ={k.[j?k'wA90X9E"V*V*U+US sk}޾^ϱ=Q?b?ucnl֍ͺY7o`̄Yxix90s< "Ǟ ,5sLI <#0Li0'I ̀0 x\I!]lȔō )&'Ǜf1Y oÛf1Y oÛf1Y D$QI@D$QI@D$QI<_/%B P)@ %B P)@ %B P)d^/Y C5`$ ï>~GMMMMMm76ƛxSojMmMܭ$Vw+Jn%q[Iܭ$Vw+yxOh>Oh>Oh>Oh>Oh>Oh>Oh>Oh>Oh>a\%9~!9D"H"C$rD!9D"H"C$rD!9D"H"C$rD!9qrbrbrbrbrbr8D\"N.'(6Q,F";DXhh6h6܏f7pwOwLd6=% s~\I[%QsjnobD9("6]N+j{vQ˽'A\(#ňr1\(#ňr1\(#ňr1t %BIP)t %BIP)t %BIP)tʚ]k<C!/KLLL'wʼn6Q&DQ(jEmM6Q&DQ3]ttљ.:EgL3]ttљըk&hCp@ y2y2g% _/A$KH%D%SH)$D } '"`"z!L^k7$`@LcdI2$E"IcdI2deO<}?גe$QQYl#HbdI2$G#I$H P(CA?QPXjJ>@I8( 'ء7$'&,clg[ 'Ľ$M'rpPp\8N.\L.\qȇɇɉ.yK^.yZZn5f'j$)u _S}*\rE(%p'\ |%pQAQA6*(E MF .Kn[.BBBBvS|ףB5jZjZZZZZZZ r~\?A O' r~\?A O' TrP]Au9.堺TrP]Au9.堺Trl8O-}p)BsPhN!W).סQ'2DrPpNcĶKmB:^G ob]c{GaP|1_ CP|1_ CP|1_ CP|1_ CP|1_ CP|1_ CP|1_ CP|/9If苍r1 n[*c L~!?0י!f\UzYKцn *R{ɷ&)3URw:/l{"U~_$&YѴC+6\H+ie|Vi\v0ߣeZ_@-+iZi}9Jt(QBTo0?V"6JDۇCJ#v:^@iD"J_G-I\1Yz{ϗ!z\N$ nգ @#h6LwR|67CQ{ #IfdYͨ' zb(C޷!QȂ};8_;rLe < Tqxz$ ! 6dBq_bK |/1%wa; |0UWk`ma<L)(<Sa< 0 9CݛܙUjJ 9&woJg6lP:iNGү-y4<34u ߳B:RNZ-;2+δϢ\^l1p?<ca 0&жBZh[ mkm-жBZh[ mkm-жZԥ JxޅUP a kalӭRV  B$`^2 P!NAp6\O{Z> 1 1{ނ Jx{>`C a+lB\ pB#4R1hޠrtp:\a /Lmçĸ=p%·q~8̻rX(7F ",ZVڛ7?Ca$V\Rj* $ c~x8`"L%\>====<;;|}Vbw.UZB+Qu@`Nƞ-9$}~/vJ> IH;]cзsd9⺚;}*J-<9:_b%+hLfw]]GK-Eia-8M3 t[J.C#נgʖX(CJPҥDt (J>oq [w=MPAn#W^"vMMMMMMMMy-cZ sWyyv\7Q0[ Xho3v.elAo̶v˩-(ZkѥPۧoA?~dQ5I>cezOnnKWfҗ2W+r=pXhpLQ0?[uv\kc{+ۻd1z9;9>F}{Yƚ&9g[mAK`9W7PB]PSs &AϚ@z3f++ۘ3L+X&Ellȧt2K_yvr=b.vyhLhG;:2lNpQj:˭>lٺBPkr65:w1f Qr,utzZi!+uYVx GrW6j ٨Kk,TGi5.HZZ^[nN}oCP:sHPn6cClc?Tr1tZ IS[Ao +Pa/j˩ѳALs?e9j+~)lƺ__艶_s}i|S3e3OboWYl [V75=QVOΝ~˹~;SVg^lz6yG`uL7וf_ꑐ_j_TF@:s t\d u?ꅞp*P/mdQKz# Z9M̶ZSa\ε^vZ]comߦZrrǽwlg⍕{كvOX.ezrez{6ix:>|vB?G=>dӇ, ]usz㽎sU1{_sX' HokP['#_+ѷ3_ ODo:ohj) _8cGҫjͣxt 7, +# L3gE-x5`, DH^E:YҕVJʥ\OLo8ryCGӘ5dj1rMU}6*7U}nQ*bVy/qw@ ]_:ހS}gq<.d۽C.Sz!7}=C/I?[z^^5+zW[٦/]MiRz=?};y-x~i0>^WIj!?z?_ׅ:5Wu͗ZVXVx=o;u F]tsPGqbmv嵔.j+yVٲ;I/Qp~XOeoNmi{~ѻܩ`ۙOPO_k6,6 OgX>P`^z/me}zlV͑u$mG{~'?jw"wTz״moNsnyoxs{2ʾtf^&{Kx=5WW@HG1ү8jhߴݶkWm׾mҺoX߷pƮ֟_ӓbuc߹zW^]'*.H{CK=Dߥm+%Oc#s~& Ce< ,,?HY)$_V}Y+[TR!P~CWKA2&0 grdUl߳ZkٳYw2d-I]ih=^HpM&Ɖ-0@Ō.bFMlX*ʷb2Āeg!KY],K]z~ww"_1Яwb% 5}G ;ɜww͆fC>NfѮ*.Ӊ 49tμ%'se: ˼ %1v5h82{!a0A\fEyh&m 6 [1I9Q(mAb7-)nL'32ti4//1aN7b:.#tb:Lb7\jmx-xrq=,cǀ]5r r BPPfI2NRN~6I$$Gk/YF[w0 E90EY؊)ʺi(8!?QD #G$GGG6_tZ33P~&ء gmj6Ou#iw!yۻT"37%eV3ۑ>S P3d"37].gfnOTzNy{u?V%sePWԙo/>sM\gɪ47nxOϚSs}]{al+ͽ뛽>*~'L8S/~ow%lO'wƧHsg 、4RUغIQAF$pW;.w7yGp Ycgw~k[ɜv\.#]_mpU[J{)ر͍9ʽ%Khj2}hD̍?#`5ia N*FT?_h? m[#_#NrJri9K,i)}&{≣֡ęq{E[[R6Q|uΑdb7F֋~ M1./~tփSYsR `;,j) ~;k7 S&ƘM:ΣKT-JI\L}OB7_BaZ籇G9³Cl=Z ](nGz}{cW|M(1떸E<<b9ϗx ,a=Μ .$\ b+_G5vS] d7hߤܕgM\^vR{n|/ak<)lcc@ްg~3vWzz=5FڡY1/+Ԫ=?R<BwMvl,_sƏcgk=[TkrwjԿhsZפu+1WKcqQ?\? )E?/| m\cOcd7:~6~d߁;Ju{7k!#] SJw_hݯZh@g{H_虭+;*e:~ y 'E8c:p}sd\VOc^ll&%xS]s]j ]A{Wq|~o_R7(E݇`1ep/l/Vb9'zK}A1gc<d=>QL_;Kw]wǏWf}V9܏1뿗7Wڹ>KAOإnˬ71gzr3>p99]_?]9K3\.ö}#M)Vkh.d>r]WF9gf)θ43Z|.==.TRs!qdQq`:ǬB_쓥hyci'N_KEj;8]{ o-ïMb///UK)ۧϢ,J߅8}b:YI3Ӭ>aS-8go=+2/6чTM]+K|~~ɞDg~3i.~ Cwl>=[7chF7o=Qh#>y֚#حJћhu&degOWA+N{T[< YsX46S:F(l/K(Sa[Mhc=k=:s%Q/w X٣BO|c ћ'~87:풇Kk73A/2.>uVO,c~#V׿-4-Vg]P^6]q<[kUXvڱZ{6VO=ugl6Jjiϱ%m {GMeKW]m)[Ϋl/z^ċFހ7`xޔ}Ư׳yOG6>?Ͷ|&_sW|!_ľow|)_Cv?fu_Ɏ|#;7G]ne'T=z=SczPiÚG $^KsEzP+7՛jZQS޽OhEeZ{?j 1!.FQFj}F_6cJ{c{ƷAmq8 5~0NhÌhEHѦH~mlqJ{WjDkqC 6!bvROjxJ<Ź's]L!&)\ibooUb<"6-*B]Wŷ8$N&39onf_oFB~Yd-eVYV oZ|neV Z+‡ZyV>fUV * (jZSV#g5ZVK%`ZV[f>'ʧXXV/kӭV>h 35_Wx>ǚh=_^^9:l}߲~~qɜp:;NiNl]g3/ss93^\m]jW'W'5O{36[2vIwMq¤ez id$;#/>T'eoG#ʾ8Or>Ecr|F)'irϗ3M\#w]J. Z_- zIn?}*w_]WAnph}{i ag#{RY_8+ + %KܚaZ 1ENǪh|W* L#ެ l wCV#6\6GU3Om6&aV%J [ **YSm>>au`ޫy9xWz9,o}ĿĿYW泙᯳ F#K}9^?`}>8ZLKL%YE=C`z(ֆ fy`(0OZnVIq7jEbG(Ǒ޳kL5wӻuM}F1c11]8uLe/:^b4\[,쿈Us,v,c51L1RX]QUU#`ӍόXal1 ېrۙi0v0idȁ2߰dc`i~;_V8hdՈs`*Gjq :nGO~4~ VdlO ]8X04C& % p1HILRHVA]-<ƒ2X2ƪr*ʣn@LRWв_Q7(aF\EEV^|WCTUDU_MTC:Z!jL(@ݚ&sq-j#(BbQꊆ5(L4cV\>7s7;D'Ϣ3rvb]<GxC<*Tx 'g AbZ,!b*01 clfjlfU06c5x1UW#4K= G',]<+ϋY1ELu&_Y51C@yha|Ms\}Cc |&. QwXb J#r5#c1Jk`">ASY/֣'Fj ,6L[ԂV@b;Z!vk؇ߊoQe18Ҕ`ա'ܰ=fV,kcf tj>3BmDY3ϬȚf%V۬lVFNڬnVG 5(Y`LM&/2pb%u_ϬwH5ZX5ZP-@ T jBtZXR-@T lVGT CjQ T +PՄj]jha=2P0 |(h D;A[5@͠SS5Z4:4DLpwYalsbš*a=@*J hԜKS9P<@l Gg3@cuTVYY] j83,ә̂uzTUԖy\\p-[`mLy5q\r 2PN(cxOd~b7a~b\' vy;˖w;X(;2SBĂL=.(UvE{(ye=P쉣^M>ȇ2,KY@Q(9D'3JAPo8x9|e&Id9<+|)_/ͩr*(_d9MNcyJ(4L/&YUسl# FҸ^R V/!-KZ6?@*XY_ h|P}ȧ(8y|7r_U,Ń**Da~"D)n3ʼnaha *fDbF$= 9UH1 \s+=K"_*ztsU=\ts5=_χ]Y' ]@C׆]G*WCIW!%]] %]Eo7@JIW! }i6o" ݆s͓ːV@Z9r-Bh嫡WbLJ)F , d!)E EhIZ)E3RuH7MRn&i nc7tk(}\ tqpRfnB l5ImBLеe5IV ʵ ѬMH&BQD-T ՘65IA! zm4h*iA+M'.FQPhVHZ"1QLDҗ/닩b*kLʲPL,"eAʲXY˹Q5b@,@-) IS\oCYfEʲX| VŇ(啲 eYe1)Fb؀Oe1z/_/pT)Ӛr8,kCʲ8%N"ҔE))`+5Yd}3h)lK!) ےlD 2ìm*٘d#mx+oERIVQ-(ފAV gWQW ")J3BQWZRԕ4FQW bPHuERHFQW ")ꊑuŠ+u%QHuŠ++E]1uEQW$E]1(J˄+E]uŠ+uŠ+u)E]iFQWR(Js҂\OQWZRԕ4bPԕfuE]iuŠ+iuŀ ş꓾o`E(+cEV%eUB(ȯnUB/jYuhd[h̺ܺn@VV+ [Z"_;;ѓVgŦRB#xp-ɝr'Ϋ'T_Ih-yOq>9*Q@a(Ha(H)@QG'?UD|iK(1@H~IYnmV))"=d䫨Iaw9w9Iw3qTEPʧJaJ!7ᨊ8Jrwsw<\xD'X(+/V&̪T~l)L(S>cPZ*>ldv~s9AW*`ƨ>W/"Ei"s5+t-zܣ}Lc|399Ha;ڃ0qSy%{>%筀E !!UE*D*Bj %Rې:"ݍԍqoJۛC {8gC4 5s/FZ2a&6#mCڅMu $羲H%{S|a|KbRݘr_x~xjO#uB=^'g>H# A4+;1H EZ$~`BZi v "d#Y%Ā@ UF*]w}ӄ-b&HE^}^H}%G!/sx>&lyWY{~PNuNZ~|4~Iܿ6žV {eze5,kxY3f-.kPښ3kOYdzNy^7[% yު@u[mmmm1{as~1gygU׼󽋽˼+k뽛ۀxUO>|W֗¾|_u_-_]_c_sV}]|݁=}}G't+%||k|[|}|}G}'o=T`?P~&aeF-%^8pX=?8?8?8ϿooNr.`B]!ۛˮMأVE enTm-Gv~ك c>= 8+5e+^\e&@, ,,H@~zVnq9a]=SK{gO >N \{U -݁}@U`hd' ``N>[;;F8{|p2pjp&pvppap)Pz?:.)53'?xxWAv8!ý} أこS3ó KWUM=SӘ"Lɭ>ڕ^˭[HXTb7m\2)Mm%1n`s&^b}\4׀sZkrnݖ+GrH`YtB$at4?R=R+RؘP#""#"]" {c< D+%""k#"[#"G#'#k:9:5:3:;:/4>put]tSt+pgtOt?(*-sV9}UF5,fy-kw[^Ǽvy>c4E!?$&@i1H" bi!R \Ls"҈@"P!M#ED) FDJpzwp}>묽kZ̅_  V͆; 50tN.>5rZ3\+*(R^,%dIC^)|tyUyMӇWו-_PX2•זۀ_Q5 "$4™93xNgV95 ViFii.>1>qLMGM'o66+n0]0^3gYg2,01,}\j6=x'1q2\Sfo0O0O.񘧛s ̍%e故k-mQmnO:̝aFs^0_1_7[$Kf K%%Rd[g [XXYj--S,3,-X,MfrjzF&-߰lGF1e9e9k9o̳`j얔U)$lͷVFcIi֙9zBbR -r'-KnZ77Z柰v׆u_&A>Q kzzɚ6+c˲؆ lč6}M6-HΟfNQ>in|6׶h[B̶m^Xof mo;4,vlXc;c]*خخ]v.3 ܢ=^dvgsiOkSϰ϶ϻ/Źdo/2pjzF&žECv}='GLJeٻg2*_G 8ފ++*_E"J0e*VTk9px$Bbf9 9kX \ZbVlh\hZ$UOZ+O[_ w-NfNqgԈ-γΉڹl8/kW78p]k鮁\]_._.rHu"pwMrMst!^ZZZZZãsmp6k;ݵյr>:::vvs.\\7݂[r縇 ܥ7#=#xݣ XuVqONNֱFn.21JFkGdָ[mwY]½x3STpq K+QP^HZaZdto3axO |>^}qh_U_ooVJtFtK}K||+}k}-||Z&;;z}|W|}~ɟE~w}Z:|?J (T1`%+@  T&iJ̒92C`a`q`i`E`M`VZ[;8   *@7t\V/+v5%pR(T+̪)>_9j^+K+4/UƵHrZ9X^UTN\Y>XW9rAr UTV.\YVX+[mm%B1M +W<Օ=gJIN+׵8XY\e?cPfT9R T9R4A`8$Gbu%88e`C.l.\\]fn,ZRVhnwGHeq vOWGoS  &'4!W(FR=?4>4)4-434'TZZZPZZjJcDShGh_`hD;t:t.t!ºp}2<$][a:FÜ= pU&n;[b+XK<OkS3 xs|ypg|>>pS|K|{|g|O(G]SoS %1 10180$ W"&F:cՉIiĜȍD}babqbibPbMb^͉]}eG }0ѝ88gO\Hkk.!)7& Ic^e$xrt*YKM.H6&:(JɕZ՟\lI%ۓے$wsܟZ if#?DVQ_@(Aw@=ch[ ~{/,/IpJ}=>r O%;ϷϪcM>wT~ ߪ/bѝB^\JhN #jppZmŏ^@ xS!߁< :!R~xVq"4?=tnu]'' x`g:P@,CtBy'{:̝z:yX)=I*VaWC Z%6`E:@?ZM?ODN]!Twg&c0?2*FMH2$H$~ĻS2GQ)/FVΫNf,D CJQftYG4s,ճqةGzU<OŸ?tx,ѽ<],NʰKXaG@sC^#>փQZ5\(/a.Ѷmo82Sq님;q&aMW?|AS =F<ƃ^HrMLi4}!B{ 1"F`kTS3RzkĹV"'m3-ީ6Mvԡc'qhE?;7@ X [NJxtʠS9YPջa߅bX-i YVl3b/{+yq̮[Xٲx Oo!s+C;Ԃy#"OZlۂd#-@6"Ђd#-X@ZM'N5 f~=VdܧCgXk暄{$j傅ϹX?jbi";XED"4(]۽cɌR ,&2ʻHJtT?*]9jQ(F_FH!VxGzQ$2|p Zg[Nv 6X+4h#{6(NXF4];[(M$>ÎY֔E? xᘋ*Bh;YuS3(2YS\ $2$v88o1Lx#dkLEw/~3 j(a] c"v/{ ~N,'i)&Ĺ1(9ag&A`g*8w*<Ì̂,?ߏ1_:ΎS~gjՅ3Wb:|Q|^:Ϥɖg'k1TQEZ6_k10Zcc {-WsEj<8=ag\zI_~$1GGl&"oVF9 K1Fq~gGkotva~3CN I=j/sFG x?x?,at(%PyJ&4PfdxCxCdMj1qC9U )!F a)$NF^F0g$ +U̱ƦGdcjqw z?5$c9|~mO+GO/ s/-u/=]pKiYZ;q51q=HFpK9Ζ%{sIXo+fk)cVx FD3# wa |9~*ʘ1#ɩjރ#sac2}2 xԊQ*:GA#գm$zM q㰣 yc:3X >_Zy!I-T7bo4IH \#s;%y]>TTS Ȓ{!TpLu%+#UO١!KanԂ-xOuO@s45sYxm-vY؍/ \5b]"v^p , ݯ*B_a}u38 &Sl{^rN"}9a-ē!AtuDNmgKdQ0ySO_i r:+O\9}k~T\ UK2JucmLu =_f |RF2!8(_0);nhf޸ՅE?QE]q^$@JWg1Uּ*Uc*G"܉ŽڽD}2Jur$FŷpS)pF9ɏ^f]%⼴><!䷏߅Qom3, ؽawgqҜzxN@AӁp5Xrҗq+m"Q$(/B6|h$hmi":C|5^<?{fUۡl)i(N}JA'#syΫ~QS`(MͭtcYϐ Pt ߻oQg s}rVZն.5xg'gwT?~5c:46a.-/ 8Z M1FdR>~ 9ϙ湻Շ_Sȯ: .Fʅ^AUUG*Ɲ:乨U=ε-AT 5Č@9jßuPª~95c.64},>]hJh_2*EYE~~+ijxGn " }p/T v9y&>η嘖a"P#!?޲㐬GuDt59kZ98q~ͩ0c/tFы6u-xnx؈q|:}5_ d~JOeƍUdn Jm½ IlH~l~DkՕ9tcT3Aعv~ ~afDOIz9yKw 'V"=I87' ^ThaJ } ȣԸvmv{ ?ϳW mCQ#TAֺ?/Ch;M*snPqtNj*nVܶDTWYxQyfo$!b_IH_/ˑ b:*h?D}9݆>/L?]=n.C.砹V!Ùp㶶Q=\;X_̕77$; D w;灳B1A^ Ys3o#Jca#|x,M֊ 5CR0 p l le:9vݽ*{%^H~UW#}'}0=6|o{(<C^$No[|yZUw>nR]yO+^H{1i9{c])QKu"`a*uߩrv';,SDu}g:{y=*3Ѷp- C-,n%d}]>$X bow Od oGnnXXq7Ϗg+rz)mBeokFOGiD_= I2S!)Տ܆Z ~ ۷lobFq+U>M)_[MhU?Cq5Mj mʬFL>݌mX|oVx\n~uzDAŤ+x/%5:@2GIxXG}:[Eusj| |.$2nIf~ &nmާeiU+9iᛈݗ^ yeX Vr`$a?@_ lGC)K9?z0k<X< ?GbSxr*]sa-I Z HegS? _T¿Hig|?@74ҍFbH;Zu yZ [ yQ7I HJ3I3J3kQz ٗ հCon>7,nSc:\B\HobOތVh_6?Ңq\tb%1<-KZ o?1n|zgi-0҅"sJ__s9kqmdצW W41>>sWps+s!m,F#HfBd&$c¼יGbg8O/߬t;.)x>W}mͿ !~3+śi`?;-iY]=%HJ+}/,ʲ:9vW\e{rPQ@u\oAƯ^NOk˄ZEhڅmB[/ BpF. WB(b+E^4G׿Ծ++ʯ~-7 ^/aĮU>ot,'p]UadQ}OHW"j/H4ʵN>mҿ~eLkw5Z)k0#gI("o.aIY !(0Rx@xXxD L 3yBH)f4oo {? B7? W/—BBQub8@[G(@RHsS,qL$dq8]|B(XEbq,._&.Wĝ.q_|K<$"#>S/7LkfE#ӕ g̜XTu~J>N;r= 4>-)J\ ߲yy"""E> H1""iĔ cHiĘ"R>MY||i2-` )2LĈ4"˷G\gw}=g}Υw8*8EU\j|N!k9Я%b5VVheu#xj,bmvY{ց`+Q I p.,sպVp w$# O OX4\ Tkp}xaEtS%!95#n}0|8|,|"| @oFDx"v${Tdl0Jbrdjdr3"#"08$Y9#k#r1:$ltD #@g4p6raH\\ Q=ZQgH(@It:03:hutQ.4<66GG7[ۣ{WGoDOނ3s;z\^*lv;r0{=f =ޞ4$LK2{=׮|ʮkzCB4@G ajv}0, ) y}oT51OՎQ[OMb3nؼXelAlalqlIוՃ[[k b;ccnCG-8;98+uNg|PlBH1QOJb6/qt'dOإ4P`{wF9E{vJ8%tg3)w;"Y닳Y|~6^#5N3%zgr8+Q $|;=s9t;?;Wq%ӹ/0q荏OOsxM6^__>>7Z[M^h:p-7?Nv#z3k\ ]6ǏOOŻ3 y;xoFBMxff^"Ekv ^_sb]N ub^3kqD6pH ``}̬ˌȬkeY'%Zkɑ -sS.3$&'f$+kqo]b#mH+H,%GF63x'_4Y'K.m~2WȲ2t < *8ٜ\ϙܔܒܞܕܓ|YWGo`BvDzɓ3cо#y.ٍU SJʝ RR#YojLjaރuAԎT[j/,M>gkOd^mru~.{mYf{x%]쳸T2O2s+u,uSE+yJ]Nn䫌|Oo_?9*0-Fy_XWΩ76 Nߙ:K)ؙ <2'bj89XPP0'bg+>gcsxɀT8{MA3.|.6)ys66ۣ<O泱Of=ayd˳Ϲ*k]sqR6]Ͼew|#NdOf>1;.ɓOw=={8^q6symWSW{k94fٻgN1Ϝ%ONI>3|lw3vp^vٞes??$ ?9$AݸupsK{i?ȫݘ.g9.=Agg.pb_Lk%hg䓐L e !p>uA]uupvAnVwђϋϵV0NhhFλy#zpꡳ:Kq+UA=GВ#hpz><ʎCqoB 2]=A5_2/C7A::?'B~"? B擐$? :tp pЃwbLJa֫QυzX=݋31XwT;/g3ywEbD#t.z^'@O>|烞ztBO'賠Ϣ((hȫBy/hg4gT*\{={{Yςz#`4UTѓEui%] Ϡ34z_5Hνй@ t6hg.)П vvnwC{7;75D 3QC_i_NxECx_Kc|5o]yX9w@븆u\{{' {'hZa-hx]^WG?gsPa{:lOE?1u1~ݣG uiKI+<&e?ALJ`T6)]OaOaO%R*KN?w/f*S>~Z(!ro_+ .=Z;}֋ٯM7~EUޭZ[}=F. \#(*I]%2tq滪]\uԒU5fzjv.~W\G]otuu꺮*[ 0u:$uZeRjZ#SZ.#h' rtR=?4c90Ȧ|#RfnWJ6_ɹqs}8WUU$ҺvCy_UM|௫Vp.(|Qf3\j ?/ȘUTh\|۵Ck+hC3iE\|ou_?.~ |WT~E*kksPv*f+o~@)XL+rA\=;ͼҬ+Ĭ9iGiv=I3k;ͪ0xNefү4{,71c0c0c2䇮Zߺ{ۿxUzEFp\c)/䤸u}|>ڸ+P`i_} ˙vaCBf$I?~ H^eOs..;,)o6_˷m4s'(9+|N7W+$f^Z|xbJjj"_ooyɷ[/&}rk||{|f|>|xiDNB̖;=n%UU}uiw?=OKe YԾ&\_WͿ?H-Vvcmww,M'D˞e^Ji. DM ؁cɁD L  Tl#8$+Ijun>@fͼiY xUtokJ@:}A{6 #W|Vp4q>_A crb ) NvН`yp~:(X . U5^3\[)킍%`NFs{Kd=-VSa;5f s9c3'yvS"7f9WG0璝zhƥ bbʬ5ki/V'V 1k6Yl2[ fsWbn\W*6JM,l%OE!,XJQ1vNgyHΤLj'S.yѼl7'T!OVlT(4( Y]ތVH&y.'bߵww[C- Nͦ4/TZ=ZZLia H'yJC+BкFPkh[hghoth_ !]C*"[%tk5*7YjAk\pZdYܩZ=*kMk4OSJ|'6_j]s+n|+]ݶ5:\9௳)Kj5+7I/WxWK_l7[w59jٯûV}&g B{>ak!ek:hiwse1uHݒ~tg?G] pT]4GtAgwU7>%:geW׃C8[Eu}ܭA٥}xP-6o=ktoxLw ^|qg)<2UξS,zF~!ƋwVN9R LP{i YgYt.3^mAs لy~=' BhG%Ř/XF%;O !Ӏ[vIi^2އ: =_V;χ&ϵ}r~fAfڰQ?&:~z>d|V# sW 2oNJJΕ#t3|w`*8=@D~ Fc BXl +]˓Qi?bce|Lj⃧}{m0!!Jj"FpS?\a><ᵦsuWͯ*[%֗#x&Z#b- &# %ҷFfZ9rbj 2HҺ5.J[:\zٿ?,Mr еE{Q*%5pQv=ĺxm::rw㿣Eiz=)er| \7 9k \_zZ'֭kH Yg]FiMvK8zU+(۶"J1o턘O\6eS=vfndA//K?7ؓY8pn W"t)K|iͶIMkM]! D`krw?263XwNu\_ّ#s)G۵bz6+lS؍>˦{*aw,kނ,Y'ȟ[m=M|M^vQ6+\KOOHRc.ٴW{e>8qP SeL?OkzxGJs0k e/Xorul=]fٛ]nZܵF'=T,ey伊~*6JXhh&10V{͓+F{ͭkbKoc^&Fs,%Zxh)`QYP#:vDYNd{w|f3zb"֔|OأC>Сߡ!hϡ)ߡ=S"1]9Cw;RXH}:}C{̺ZZ#NZ:Z#v;g1=CkC-wܻ$hn7c_qE=NW< Fϥ˵2Ncu%^*]t|g8JZW|4"FUQ0Se\*WQ<1"0"TčQ%*C?8P*c?EV"So2 /ETķ"RZ(K_)"+eL%Z((%c' %Eё".RFDE"QD;"HD8FՈxFɈFE(be"EdIш2QD "PDHCc( E\N_XBA9(cE E Q"PFn"OF>C͇8>'bDt"ADމ@vEDx:as"nNDX9D8DƉ8 H8&d"DteQl"~MD5&DMQi2 Qf"LD2M&DQc"^LD1&D,_"KD{8/#橘"nKDlX-{""%bD4ܗW"V2 )DԳBKDS"fJFK8)DH(%#`"I=Ɉ':('߄H%ӄh&$"v ^B+H%($$#y$cD\3F-QE""HDɸ!D X!%!"dL1;"3TDx#b|Dt="GD#<uD9?#"qD q7"F Q6"FDֈM#hDQ3-"RFVe\A(""_D̋vq."Eƶ ^KDbMQv~ZZQ*v*ϊSiT խxTP|STSjb#w+u>VVVL7ǔ9ܜi͇ͅZKG(h6_W>a>i<`lPVG(Kf/ߖ=(0Hx$”kf*UB-gm(zUbN8H8L8F8!:E"Ϲ^2pCQ BÓs5 6!%j '"%&\ffIJBbBa%a5a-aa#'(>B8S^OK2Jz^zL_7Mz Aߌ;6}/ЮH vJz~P a(cQhL6ӌlcQi,0{Xi6댍Fi&Cq8ntǸ\3n-q#ܣh^$Sqb]"tJ39/=PR{{9__Wg@.=Qf?s!dtTBHNQK8жBR͹1'4msW6@<| V$hC@34=!9S(^b{S+z"4?!Pꃠ1`nlf͏3̏3͏4瘟02Ofi|\`>b.25r+*kffCǂBD"!1,f5F,7^ғ$HЊv.A*lg^MߵZ/,FjJnr] ҭ1&+76*R,F}/m,sьUA?VYC烼]}} E@$l6hۅ?wOj7/<{}t͟%+fɛ{mX{1艁2{Q~51n>^'LUhm.4)(%.ӵAJG\'uZ֣G1hoTfTӻLUiZO+FQ¥j Y[A廸Hel9Y-Ԓ\i^{ʚk=lU[ Zbs7`}Za}Ze}jn=noXߴkm;izb}i}e=gY[[{Z/ZKVuWuH)(b߹sֲv+}O=e +ݷfȴ@Ϸq[? m?|7C~/#?W\|UFSRаsn큾*^>{_'Eq[9LN  ""A$"TK@D 1(" t4H "1"\B }ĠAcv="^ԯΜSN:]sj(pQ o'G8.ɄN')#s %GK),"5 |p5abkhYBng~8I٧1l<ᄌ^yX_&r~"%AgOb_OBL,f_!i)o_܋KG४"W{ ]kH N8iJOk\i$ Ji>05 { oepGa_n'>pxho^w?.l(P%rZq!w%prK s>J8)E$J+9!j2 ѿq4g¡?1jv+ -ZVw=6,Q`Zu>i, e:GIH[o9 -]X\UmC+ Wo1 PW+Jy2]y!MKlJǑH*wfkJ*%VDRStX>)?)9I呲p5BOU2]!.#TEjuUO\WJK_\EER04W課p~n)GSJsBȺaiR^QE}!\/6HQ`k0pw Du5E7h{y5Z$XO[>`Z?jl/9D6@گG P 7hXˆXCD$7["j 1R#^^WXcDXr@HӺN%ʻaXwzHֽT|u=ȳG A+A~χgNRA,XKmFs9d55!ߣEg YZI%YIB}\y̝,MAXғ`Mb"nń~C` ;WWr/pPwJ[0wwK](!h>K~Qh~h 2:Lc2FAJXC[{/t}4a0gX[O02_ rV 5#J(ӵ(z3չBuT]Rתw-G. k&x%FZRk:i]Z̔Pm6.}}VMfhyZH{V{^[je:-mUۮ}}juUX ^7֛Vz[Y V}>AOfi} _Wk{Q߬ow;+}4#~نeZ88ha6鍵Fg 2n6Fcc1% >cxX_e>Vghg56_kkl1t]שI]7B7mfi4+ld61-mf|7=>s9iK6'Etuiw*==Üeq1EZܤe!Ys/SK)BFa'L 2-Lm,uۚ a9S[xC!Yc EzS~MH/b!LWY$W0%#C9A/1A^O5֑8ҋ)΢c+az :#F O:UQHr:SS~nG8PVzK I)Ӄ{L0aC T?e =.Kǔ)o }?f T?r.rp4W2*KoCW/]̲?b:}`>ӹV w0%ݬaebSn+mQgi1!c$V|!Wx xp ~Jy3:_JGTȚN : v>NdJjdJjdJjh*MGFu5<^q+[~!ƝBKG8 m6NmzqɥI)s5J[:%tZs ˵ZXZͬ[a]`.:XY 65rbp<:7ei թnO(wVtuץb(LDnCmkZm FjsۇJ 0.oAP*'5KkvEmt)%ޔoJ2Vb uEXXWRC?1;O^Ɔo[ĉ5TmrvW.9uH@}{m\CQY [@Y0X Q@᎜vqMP y];vAj͖dʷַͽZ^I-rO<{zK+;*&|{7G -F+BӞ-]uljud mU+ƕ6•W\i-y\i]\i 6J{:|+ьo%.Bȓfq=q:z)4">b}\q]} >w__#w0FLkd41-kot2= 0CM2 Y"Y灭T(3!ln|U?`1MՌ ̸Qd:f+-b`+iv3{ 1o5G'"Ζi%/+5 47"nFfn4;̝nį3ވm&#aF\c[RYix7 ""0FHHG.WWwHHȠ͑cMDS"`E[# #,T#/Efe-uU#]j}i׈ќ )=FM'Ds+Oj4EfcD-OiN2rE9\{mуg )Or, 6ΔI|-0A60V)Y&dMΚ`Ϛuez0 fFOs_K_Y/Sk753OڌMJAӶ3"+Hy&f"28fz[ ?w,T^)(N# _x@_*3}x'fx wR+O{Pyn3TBRۘy]{x57|- Y hWNV5bN ժL׹B  ' &~0\ {?4NJ*wzhܥz~WbYUynNi`LIZk'Py7J>oUڤswƚe OC"gWij$qqR~ǫ.-8/7*5)Yyϫ}`и'{s'ӃGE,pG\ .5DuF $*sŝ**?<4QfT]OzsUcx)<'8(<?f/#K<<)د:s {J1k $k2 GBvH\Ԧ*2ܹ$V,,T9RlR9JEI~|P%NUm'!iNؓڹ/W M,E}(oJRuʪRJ vQq^J(L xB6!O2~O>ǫy=9 @a.\y<`N[`Ww`{.O&Ԟj UR>mN NGɤm'#Iq-bG]ժ7t=moX>!UH߲mC&^!G.ȻZLǤq?bP'[C؝*&:O>O|jeJK]KI.Dgk}UD ')Μg4Z}Eskd|JN4d/ʱ$R۴0I”:$ EKSΕk05QֻJSu\.gck4WuxfRiKԬe.e\Zb)lV*JłZXKb%!Z CF6rt؊^զ~{eRSO|πQbXuROOlw {x_T=0~2Ff+jQ-=O~ľʬ*>>i$fS͓ǤBz6kXsRU Hi;eU_Do B8mK\E3e"Iy edeF33*}Xzo }U.X+6hx]O`e`]ɣ JN*mPriLt UC#$}ֵTe锼t_~MoC3k|RL7O B&@VשY\eȺSEOy\VĢZ7gBrwC}-%MCP+}JJ;*=<Eu=T쉆X1"uN)ak3%-em)uζUn7J.Izlkzgq4Y2vL,Z9N¨Gyz*]Je2XT)"e2CSEʳ ˔u[&e]XL٣UUq@m6UԶjMuVu:ANUWe|uD]TרՍfuCݩVR):$eK5KsY-EZvNF5uLѮuѺk~tk$Ҏ(qƱDm)RZ(2DB~qv?4&&5~t-9sfћKpړyxVXp26wFї:8NX<<{GHVG(QZBъNCy\ kE<*CJWRZ3I:% <0iX*ˢ>c ?g <+)#fjl])XSLD=H*R<-8.WFG {z:zQxRsGW$Tx,~3(!WF8tJ=hq/au~hunQ:T@l]iuzsgʓOJZ#ˈwJUK4J T9(I/ZIxBͰuoiY\B]F-OzW[%^ʻW :rusN]/=wY|)sٜ#k:E;INxbмS x:' +=RZ ݀UnvE(WB6Q +/ԑb`1 8]@G;L|Ngvޑ'圉Iεrz+WB YN?gIr\W>OƒO95g>$O sg9J9;ډoGz8ĥDZAo7mD>VWrxnO@ynO4yn 7VQzzKw>WP.'TK7xFȨ6*T4}.(`X|eNNA!Hy⮴8y i^-'JJz~܀ ɝec{wNI8WAڧh:ӌ\p}89ߙǞrzL/f9\I$U%yeGjԹ򴳮W'\*H}yqo{XIo=NN9vqۄ3:K \նyGq(uij~(vm2?52p3Y7gm^yoo=ʞ$bNpbc}X3Yo"nqz:N s"gs׹(MQ<(^{m6Z*,yւ4QE(C(O5-\\"T ho̧(Y/&wX~.)CX| a?75ff&gE~Qf~܏ydQԟYw&1-۔^J;M a}* 3鞎,٬5Нa ~a1B8F}@ OXV+ 3B^ ]((EZRe9Sc)Tt0vdn=[^GkB0ȴp,וBHB؀rF9QEvBhA `QI p5@+Y3Y$z'`ę>3}(9vQ"a.>b;Z x%Sٞ g= V z:M'(Azaz*鐺Ah^ɇ] 8J(y8*O xO^ԼR#*Јj^i:hw=p=p=pm{o#AWN<=PՊ] 'O>[.^clȉ#/h}"'`nx?,C3^H|v|.cqP.Tdǟ/\_j|5o^8ZGx9 Ԏ8w/sN{=R:8;:;931s8]9q |3H\%L63G;qvg` ֍yNXRej u|g8["^^&"n'4]vw`/ZB:noto,vW染N8?xgt'򋅖doE4E/ +M&lHo&\X! /n]Q/) f--[[ZK|@N5W ۳<[y="zz+Y^?5/ >y(oRZV{P 97zM yx[H.ާ.RD  ]Y)L>;#r;1 2FOHUW @"ȼ[܌ d^˥<<ȼD+??2,w?z{#@tINb̼r"DI+췦t%--tPa6égnC]Jgcg=8'ÞN=lOa{*S؞S RPu":28999stkxxlJM&âU-UݫlŏWjC)iH a|jZbKygH|,Xр~vCRBemAU2j;۟Q ;bYOXGooo#~|V'h+H̃̕B`6*,6@jokk1`6)NsT?֐6ΫWXX 5&5* WW'Vcf%ʀzu+g '0mZ7L{g##g۳ρգsHyj?f?\Z@ǁ?a?.K PIIH+I^\ԟg(lGٴ}heSʦ gss`7΅?*,/_@}?"Oy<)9`$TG;pD( ֡޵he>ʦ}M(Q6lGٴAr7c)Ar@8^O:6ܘ.XB⪢5]Ffv![) Hu-y <ƀ|_;_kp;r9l.ͽ½4J ܫwuCn(u{5Ruf׸nu/t ~l7Czw݁H`?F&7ݡPW 77׹oo_Žp\s=z,6`.m\ڀsiFh̥ K0_m<ڀsi̥M/_6zzC.[aK-8{{w=v'Nz".XsWBkk|&|s"q*"G#C`qHKCZ&FH{mtFX"A`7/=#CYp%#w0wb_lH&鱟f`Ǟ-l_wB}>;!w>gi~+b0ww?,| m Muoο \!n}3e?}c6FsFq Fo>yA`pXࣼ۽9isɥBNEcMb߫-UJFi~vibH(r?\Q*big$g" t}}ȳ϶m*³//LR8`_&g_ewWyvGvo{8d!JyBiD4J7i)w{G^e:Bn5HXs3-EԮ3NiaUv)M[F*; [b- PᛒlI>KZHa!9E-֛8;- Vs??/ė$Wb߉DS<3z^}/׋y%ӼޙY^a)F$E"wY+aGkɮ=;'w !O-69?HY޹|[r~rrR-#}lr|/CdΤܐ\+~|dr~W,Fu s-"V8K bΈ)-X9bc-b-ӳйN>'sJ_9U?g|?Q2ZbUbu,:K7r j Xht;ؙHik 9ϋ<[ۭ3;)_9|yFlP@'z iRz"9ė"9oȆ\S3J83e=%ߜ8|Vc&gq&Z||<ϮjVxhkCl_!7>6'"'"3Qa}[0ib* u4aS\$$$&|OtLTpd35w9+# 8$K"E!e Z/BSo/RBIO K܃MxA8Jxb-~"H kY·5i.tUP2n F:%2!mYޅ^;6\ e佒PJJռW2o0^{MyVH*rݰaoJSb9H(r#'r"Ɣb1H1Ҕ"R1E99H)r1iiRDJR")"E1 cs  oO[YkZkf֚= DwM ^\џ#מ%#/^ѽѽJ0revEK K 0O l>"5HNݑCqRP>yc}kRYPRF_kNeuX`Lɷte^&ga,%?HW> C9g%-a~8k˛Tcui9WCuZnȻT~ڮr%Mغ:]81Oyn{njn+ax_`v]jǞc;^UkqI;q9Ğ7wh`Q$838;87 \ ,g|ep5µF`Kp[ l 2~`K5Rmm!  łd(|@( !Hۂp8CC'hl M JCBT`Pyuh u&-F=hxQ%CÝeԭV!mkfZZ]^p8'ilv.p2}䃁ab|,0g0\%ᙀ %rWW3l oc>>v#@0nh閷5Q+nXgEօ`Hd8q`*01R Ffϋ,DXTCX4;M=~ãNʹo.j@dkԉ>@? pHciw4`:3pss7ED+k u@# wðBĪ1NR4qŌXF,X_뇑S]?bccI~+%~p&36`.+FF[b;ձݱ}#@Ó3[V`_-ĭxabˉy_Lŧ0>5^̰]^<>/WWƫa]e|k|BC|g|84ďƏe94qq/x\lw; dc sn0cz@hw>.q1\Kh:*k| Ժu|`r1뇻h:k|= sOݳ{MK0NK]/П|`bpbXbTb, |Bb5ȿ E`&0(L̥N QZp1#V&V_|mbcb 6>#OKDx$є8 II lMe*Dke&sȇdg8:s‰I\g W{f^hV,gq\B::u&2LAy< +2+VeV#\ܔ؞ِ̣l&g^llvz ; ‡#al Hɽ zO3|.(}X,Vt5ܻw`/p8 NYRtHf$#d_?00a>ۨX`Brx>",,g5ྫ` _jHB -9O.H.F(iGKq/5S@gkhr&i8Яxrur-l8ɍ-m`7HL[&~|Ҝ-е&R `X* 5r!p`4lqԔ`Kjjh@8ؖ* թYԼFk'L!,{䟠\ S~*c5(Լ4)ϥf:<|g1Q@ [ֱu4)\hV6x:7 zA g)?IXIWgSSj}ǟhgI.ޗ%7t̊ZyZFJPgmiѤSJ͛2-JcӔ)wPaf],3RMf`>gw 8;-͚L^Nٛ)20wu..i,+{RkFf;/hsQ萞3d=][)gGx&HE/PM}ΝniĖ3 YgEʵ| %Js;ͦEJQܬR= E˔?O9r~%gyVҺ)?2 2*i^$}\)c\tѿKʤO2FY\>SB8JC}KxXWgEv9룔߄|5%niIɋ>kb3A0RYR.IE5J)ߡ{ 7CYI)cQ ?n-u ѺGiE!)W(gehQKyCM!k15Ka5D4z mԔ!@zˡf.gY:K3~+㑳/;qUq-g\^ِƽG8"Ӄ` .*>%79HRS K"?r7ݺsEy7eexe?9Ex.YR8xsqJ=!%=3 ѳIwQS!3u sԟX0j 6P[J 'S3fgg3hr'7kG1?FGSɋ ga1W)g|.VWdG5NVt]tí~NפN ;=N /a3WixL0w}brY s0KW c|//6&3Ŵ_UWLу C>?X12`XMl=Gm.‹bñcigb,pİaE, ~-.M.!ln2d}}}dж|[pc|0HF|p$~kÀQХ= GґGDQ<03x_@_?|LB(fgI@>P%g____oo;⻁}#xK5*ݘd(r9w;Nt)T-ug\ޣ*sڑ5-+E_n~F 瘟eZϑD\PvqL(/ij UeUYЭ'eҬy} 5> oKxցsG aDo s(׎,ߧ]_q4u5\ג'pY_z+Nq55׸W^0:=~RVBq閴x?a\|(]`i[Q.pV(7eoJJUeeCU Y ;м{y%Jݢb9 YW񬵤!kYz<"-_*;zKoɞ )ҵG\,m)w]c;J ҵ;F6++l\*~tw:me5H^@9qʻ('^^+V\ƽ2oO;e)on2w˺)qO{eWvURVˮv_CyR`?+Wv+])(\ reo ryy&{eD\ssKcqe]/A:j*G5ێj#l!znX?gST.U.*:4ZBZo_ck{ide5.{1_cj&i@{1ʼxY7{:y^jEɵVٗ$^\vyIi "LSv'RH0{{R,IݥnONo޾Rf.і(F%1Av{i-~Ž'FfH\5m]h՗W_Qd]JߦJ>ߥ$ȹkMiyJڥyzYVoxǃo?Rx26l|i=RII.%A'f 2W.%C*G¦G;-VHJCyd ѨOGyj￲ W"9斎҂?#;urar^>Ij ٟ^-At㏒RU^Us}C1^P4?.d7͘$>| yZ1rG_μEjErԤGਅ9Oja~DjaNZ.\hNZ$i^O?z8)D-LWjanZ̖ZX/Z1rk^ ]^mw0hJ"v,p,KnO&woV/C~=._~ݝ{^'R$*]F_3Gگo,)Js)!~CI6XjAϔ M%iEex5P{eܐwש"On4_n`|?QװnQW^c}^$o֎=v׶cI;^E9FIr~6XQKuڨPM24WjCm6U+ʴybmV6k۵^֤km;zR҇c\}^J_׷.}~D?7z1m 1F<Иn2JcQcl2q8eL f?3f1'4Ԝm7+*sŬ3wqyl,+bX8kU`[39BkZcmjku:jZmΰ];hGT.ًevlow{C)Ev0XN9l{rlhV=nk}=,mG>X9bW g۹8r=M=_v9J= tCˁeױ($;v]z̴ghKe lͪ[x<͚aXS;l ʃ[Qt<9=N,XrdXYl rv l"rO17+6m򃕢f`e;*A;s1]9|{rJ^hW-W lgu#:{u=r]ͮGp:F{nio{=l}{WgzyA}#}dCr7Zw}кo=6yMAj6zZeG'V4]oͷ1qk_Y&$g7[,1}Ɩ4|>m_,vRv{@Pbo-%d[Jچ핗V^λHmȍ@ iI d"LX m4\EIa@`Aؓ(0y bŹo*pfM $Yi>~o` 6 cNeZGӺc֪]`;0`V)uLƙjVZFyҪKvD锵@Z1mekX;F<7KK_ZSx"`m }c,Y۱X؆m ;ٯ_f˜wxcf27fF_<~e0O#fn=CX0k 8{}zi =j~Qv= C+}'ΑWξؽIئzEߺO$F[^.{;/?ϯ+@; 7WŜ3CΑ9żrd?n~W_sdJՏ}2h dyΪvxڊgd.O>;U@O͆%Qkz)zlQt'cT)MEK͕lIc zߣ.uݛϋ?ķ2+E(JJ&wpUay6c3SQ ?Uԛś5xRQOuɊfgDJ+\Ŝ on}4;${ O~FAOE֪%ײ_c]ln=Yg2Ofn,_zHv^3[Wh|o5p̗{o SoRJ_D^7/0}?`{a 5cD# ݾ3nx0q5w|kUWJFuAW;;.A?/lT?'ri z=q ב?F1`̄X*{K xo-U%.ayn>1&%v3w&r^i+m˳ZZA!7ץ(k d/\p㬤4!ҿ3q ;F4_/g|5}/U]޹ɷtͯyל'o/J5q.so (ܴ|f*oW I?џ͆UO"{T/˪ LƜRZ65;qyH^mrnfLYI=SS.f=S"#yzy3kULhK()ku#e !#凵Vѝϋ5}{Vw>)#IiUe(҆Uh:Q(iiZ2Z@)(ϷWnZ?ZsWMF3%2GdgidNrBWd\QX%;37Kk[챿+1T܉(Z@RT?/>%?;u5Ww v?~Ɲv>~])+%nNܚ蟸 ￰$f%x8hb~16|?z?*z(WG&zFmQ[6M>b>%,`ϯ!>}1N^u/GW؅R`w< }T@P |k+[p v^U=>8Cg_~9;E;m#:?B+#Vcʝ4G}.S6񞸉y9r7ׄyiIyoX޷FU]k9™33gD@HbD1j"ƈFD"JH)\~J#MibHHRJiRRDJbJ)Rʥosf2I&Ђ{~k}c+l-,1.ou?|C fk)sg+0c^@dFNwDFJu;E^Eڏi*fbbX.Vb;^qHT8'Ӥ%Qv=dOAr&G1r,9]ΒsY*R\kFEVr+hmưMwmH)qɸ='Įsy\f~}0.OI9w>щnęNp:?=v<ٙλ ADλt׽{Ɍn"0OLi:Zߟ4c'qf0k2]o16ΣM0Gc5&z)'iѴa|H<V%k,&5S x63«WYq%V[$]>mV %) +{ǘ>X76G`)lu /xJ~ZC%{s#%Zf_hCW+\õJġ+#R{%? ͖K9zӺxEF 9_}@|>'^˩jIôIb.j$;IKn%LH͚JoI#=I÷R74́WI?4;)mz/$|`!9rȀ9|We/IôiU%u>!ua GVP^{ymFRB%]J .n 7lbz#Rv&FX;).꿁,1BAGoo>7wg 9D_$#h|W6L"`2`zd ўqm N~1Lp.٧  +!퓀qR0/IQ$iv4fȘIbLS9 =Bs5QY sY0b laD!SyygO#Nꦾ]Z8 Ld}cs׼p"{ ԥzl07\-D7c&qf*n-2WG!jAkhj,lGuぴĜ)NG[.<,U֡׋{^/gH!̨̭fA1!u77N3d3Lajd$6*P/B9;OF߼ZT+] TcLDmVY~zUz>jFPxc1٘0Øm3J^dLkSPF+rl/UQp2HWyaGhcpOpEn( <Uµ(Q@2 LopnQ*Ck }bPJtYF`QמF:݇|3u: 9j\#ڠ6(Flz*SeFMsmRժL(}PjfV \E{a5ZF }B⿋h agrncT0Zo&.pݨ(CWyşz|eЫUz<7#e^T_y!(ު/\ J$K*>C 1Ps}Ўm)\'TN`׼:PCTPb:\Y+@g68` :֘W I s'i˺[T΄*dQJKRūam24iN7׼Oe?'\ְv5g E^ٚJt.{IO^k6tGrMcW:&m+2ɥDKAB}˗d\j{t=q/q|Bg{iw3t|6+oV?dI@.PiݐmL'3fnY;y% 4rޛ7s(vR!dߛwd'9C+ikR!SYJt'q5*d xe&{kO\Xo#ѳ&KsPfS_2Zod03N&n4/S5cJ_ H5^gEʊF3๢BlF_uR #GAO/J_V骇Ũ2EJbz.Л0!8eZcQm*3Ybs z2i>yRm7O{g}r 紱VW>LTezq\F샶փ1 4خ\0F) ؠgD\Get:.zHu44Lct4iN@cB:0p:F:A. ]/SmSی,ۢ0ڃc1j5\"RN(̮b`VUÈo'b ̥{bTolU; JmQU jcg!aʃz<6\JV!JU\:r\3J5(bA-%ڑ%j"Q.XNц"Ʉ]/Gr4(.pNe:$ssv]K?M{0$Få!8RAB"u4\|2 JBɓbyuh1y8J\rM_Wx-RNzv$%[xUz[?N]Kt1UЛH_%W|~iўm~;iq=TtmU2@6f5idI3 8G}$+U q{i= ҉dN<֤8_h5j4x8ANeeOh5 ݷ"HR56\u;QGpދƍ^*Hl2@y+'tNG{HN,g~1osgNd׏Lj~'XS'Mo7b٥2E"0`2`zbd#3̬fLvar_qy0E cTP\8',r\#c-TDUCx5Suj: Qg|l=&] ؊tt>iW_2}]ч|@>ODi$g2`> cz2\Q Ga::L'E `2Ee G)Lip٣N0+Z7FUjNU @oT.WFUe0L3U\QZZҥj"bzj8^Te@/gDGZгhEUk1IJ'3$FT qy\Or8\qr܍QuU&iFQt1_# ar=&U.8T'>ٺ9 Cl.uo`1pʔ4FcT`Ηꉑ14%E;W0Ue\e%Ey\h[ZG > uagj+zӝp.EAv!vaN.oĭ,aL䵘qp0tUb|&A1"wc#ih2 _/¹SM*"FiEG,3Lt5yB8't=k7!]WZ[iF.O.ɣh-?bC5i4gZQO: Gp*U|JY1z9@HtoH5Kɿ];Fz *ܝ)5i=vǜXye'?56OAgH9S|j+*SY3Gr}kIJq<_qOt+|l,ߎ9/e0{QƜR)1l՗vo'P=2u,,NT5rGߦ;b jgY2˶r+dEDk hg]eu +C8V/Z,ٺ [D7},>e}"ZwO[V i< 9h&b A<_-3|[ 1s3ww.0eĎP B#OR|R*zq;ܺ9Fii,e,oX oZ%sVZg8C+W;v J}fge=͞n/Koۋۛ؛M[sCw >|0X!!3J ]jJ  Yៅ *~v46Kf4jDd{eҤ>7rE(4|##(''gsz8= ޴_:tRom޵YYGq?J^굳k[៣m_}6l[/KĒQ/Ho].Rͷ %3bpWڄxYFo.>AGA'iXNqNg\snt89έNg3ʹ?r9i{i+Zx%taitI .Ci}Rioͷ.o[U]n{֋%Z)Z"Zg!7E^h]f+DG}FtDƮ"p\h-ڊa7p]9`5peu;k>jh\ϟg%e|\G/|Wy^K.=2bkzZ"/sv #`R:-\ X@ pa7p}xd^1k?u6]9ʜ.`N [ Hfc/_)㣳?e5zzʢSC98:95a6)p+ne9|3/(ղzZzZf}ZnzÎXǭ֟S?/??EdO_/v?o4-4s}}ehof-ԭ"{gX! ;w%WդZb\&N~!81Cj4CPPΡO ] ])t{(7tGh`賡BFFF=z,Tz<4!16Hhn=D&9gW9ȊRZvN8gsNmXu~yiѿecZ[C=V=_֍N؁WHස AَDtp̰nt нV u9;Og+gwXWΧv]+J̇IBW: jA}6A:$HGsH!Myy4Wr"F?s Rĥ㺯a9N2k^o =:D+}% |Vh d؇k嫱Q'hH^zӯ_DkZۗOwsL}s|6虯A/~=k<˯^:Ҟͥ``Ǽw<3u7?}(BաwC}:<بvi;k\s7ҭ_wpt84":]R :wB\:1f<ƻZۡpZ;[&5!F~0gǮsc>aRz#ZIMLTP\zZq<8IcѤ1~Rw8dϤ!.%R%\bK6іzp=,q2=6A+rFRFDRzq=;QD=>gᾈ!ꃨZX۠}&zwQýK|&VYO\lhh~?ծIB)/5 chTl2nE{ uAa ny LJ\l Dm:tJ|:i4a34t4ݰFE@ AgT} _:1w8S-CJVt;H ![vKaqT9M7o)naa|\x)@yZwo/ jq̺%Y܌o&Nau-WF|ODip2NN t1:Q(d Kf|N6}b㘫@By5lCh~j/HPȫa*; (D-w\`*u~ffFR\O#IX| ?d֫ۉB$GZ8A:|[ŅujbW Nx)cmGf;vF|gs.JtqN/qss(ps,ysxn;9G;QHM DZg#i?{6b7>3s=~b鄇 ?\~ \~(px\pQpqxBxbS)|<dpWQ-TɌdHx5j Q-iZAF[J˛-ƻU ߨNj)kzKN ) ""׽[Qؓk`o}5p \p 50k}\Gr 5A\r 5p<"\'p |k,hcfg`x,~W٭7\f3qoD$272wwK:9ir&`/pe+Y) r|T[} ʧҔp](4Qu~jnSPMo{ =FaSXmDe\UT-{*5 kF:jR x bAςSJm_{V 9t*njv5~y,yE8 ~Y{|8M[I;AObSMXV Ӂ5L?ɘ)g4h;776:,)f^Ѝ3\WE$?V <0( ~,|Fx%rn^rb\(A<{.$nI>Pk|BCȩ65Ly>&v\TŮ,yG"J޳ԫ;׺7ߗF/|50V 5LNjO||]az!0ѢJgEb1LXX,6JJCA~8g[ViŲwD뿢N/g1ܝ^m]]BMI_={>o"Ɠp .jy /j#gc>Tsqp"w\k]s=i?%轃6zXޛg:bMPgsNfYg0@RD/]:v%>%OwmNBQ5q=+=w۷n yѾf 55 wujQK=Hz}Mi@XW@E{ǚѾk}^9{ǡ`xl)pyl@|w)A`;#b/}׷e/N^Kj,i~Ž)Kl3BĿ?;|&ƃwu:xab_vø\&)WE>MCD~hwasf]xw{L }}K`R^7)7JO^~?T> kۑj2j:'SGJa?$q9!!'-A{D ۝A2lDRlOI˱JœLZ9iY6s*iivjߤ8%8_fx2vCL0 oœm7e̢}~sBEKe6]oj>X矁NZrzy_} a)c];W[Q[ko}i_r)j75# I\;Z}fGd8wj߉C6wS#뛎kzMzOAwE4_Ѽ(_ Wy)x)6k0ͪ7jj5\tW_@+##]"WEFE2"=##"7D"#"7Gnɍ |.2$rgdhݑ={###GFGF<).o{WF witҹJH!np͈dS"2)Z^?_Oo{Wűgv"z ; E Fl#XQh4QATƂw,[-*`731%cΜ H{/w{8{f̙)T%!oՈ#!AB^f/C6f 6eM3ܱ%kIPV%kC-eJ߉u"ᠿ;N\Y$ێϫfb3(+s4E +)y9Efff(?/-g0cjP~^5k e} e91OXRޣk((>OIQ=#IJRrR9 K+P/WqHӣ߼=5q;`wz,lu>NbW.(7༠ĥ{:ށ$Ǹ,0vCN^HJܖ*}僧$9BfI?9G׏-;Vr;L2ʋqx[U.<8\)Vcs%1'鯞 Gs;pī^:[]y%͍HΫ/?hbs$#3IobTzO~b_cA|tI+[T 3[Y9e!.+_`m7[^ڳDFxWHU2;i߫%U(!㥴YFvNvw+'*5|Yrg3ل.Cg;Qf/d!wvk2גٴ\l}ssT"N9`fPjߢ4W_jw "}BC?ձy;݄[ML{|GNVf7ʕVʶ\瓧L^jwAW;xlK(gޞ9|dY|3yenҿ}`kOS{F;]P 3֥?=⫻'Cw^pHjG~!/mgxwx˛s7nY7$ȏv5; l(6زlq`\e߲3[m"l 'e.#gGIRΓ"HoKf7HCv##4a),4u]4$ĥK򥋳3iRԥ(iAr)R<< &}þ!† \JDbX a# ǶQĎfI>6!l,KqP(DRMbHA6M&l Bd6M%4(9X,%z6&6!Nl.-(ƾEl첄aKRƖeĝ-gIQ JxUld߳Iq&^l [CJl-)ֱu'fFooe[@ʲml;v3E|n=l)PC>Rgɧ;@* `!RfI%#ee# ;ʎ;O$3Iuv!,αs$%$@yA-AmAA2]gI]v0Q1Q110!F.@F0"1" ")"# aVEl!dp QAذal cd#++l<Ș&28VdG!ćc3 @L6QRQ>82[l1 ^jqאZmW]bFk@o[w;!{(yžJg9)bb߭p_r=BrCOn+%[&&HCPBr'"arWb#w#CIro(Y$"y(q1$Gy<'ɱM'/%ğ"S T̴2-oew2CBwKa0^*ZqKaoIi僴&~"E/[@1H+b{)F0q4.qRU[ھWpl+w$I,9^RaC*)'TIL%՗Xk]j#ZHmRW-4XƪvU; &K3yXYFZ(-X&i2!tZJ~Y,H?' U%RC"46 s ?*7QR Hkd?sڢd88U$ x()H?ŒڠJԼ=DNSsC 巐~w2SE6+bT0Nԉ{k4C-/^ǻ`Zq>Ri#iJ!kB-,)ZXD%X 1uHU ` O" F=G1Nc,F>i~N%?FJ(T4(y/g!Ek#Ր"qg88퐢eh/U h2ҧ.Rѥٌc~&D %#ŘϐDmO|?R_^o޼k +3HjG R=eԝzQoGh u-5mOHFӁxԹ#?8HdL>8CK]ս@J,֥Dht$RlWwH"ZY+_A~ }oU"|<d%q(M@y#G~Hg|6S9!?+P.9I䝐)AUȻc7Y(lm/h+e3?advOڨ570@h:NDZD,=wpLw4t1ĝU㑨1$q;UDZ!r~#Xu釒Hye( VAƏI9AOT]D|J "U QD,~z RĄ(*gԽ~T]UWx* $J(AHyH"EH#By0p?j3^ ?`ڟ`%B?H ԕ4Qmߣтꊟ'ԵI[uLEX)xuMl$O"鋳mg @qb.DB%ᚈ*"z w s"IaVHZiI_q/SD˟\I+l">Gs\ +(' "ߩL3(lz8_33|w \qeβ>[[UHײzRqQ} kgFwYlY6h|s6v^8s^1  G>sEuw#7#8jy[ [Hu(Q\5[H4 kIsJ%x T"bw+oTF[rss TFX|Gr|eYYHSQzLudA՜8myn?+ : ٟ:P=pgsO~]9xzxyN;>ver|DBS vv#6B۟t.HBj뚓aYLN: MHC%o3!pC720ܰjff۔`:B..W;s*#ߩX^a.nڞ^>ھpƠ+ #Bwq局3` ATId!|1q~7 /Di1Z s}%Lk8w~@w(P_B |m6 ^7"R~2 %{b(c0_Hg8}}p13>5>%gg$ N1hT?j5iLdk#dODS~S~bo*`*@t&G#њt&)`2 q69d4]LAfr#zSQS1h4y`HJu V_ߦ*c߻oa8U))k, [afVue>vMÀ-bjnhGêI6i-\ĒXr KXr,%LMʼn{JwRsb>]ĘWG^#BqZhnϮO54+`ȿo@>L΂%_J0އRAۄk.KTLzCr'q)%ZhaOej@ML>nchQ-Yhk0z%T9Zr ꎉ[1n3 EU9]riG?dqq:i.*$5[1Lܩ wy*J5RJ%^H9/*ǩ$'*Hoe+Ox`<],$t&QTPE~Cj;%vZO;m~;lݽ$ jłnԙ_uW)/Ǝk&׫R_:zVڹYi>Dbt&~b{gœhvv9̇hjji9.B@)0٩ۥKҝ]]]%^Ra63f.Phds;g00:FU>p4i 36"7ƶ $#_߇ۏzk/K@qp(qy\&r!:ᎄ3f֞,0ø۱X*eXcv%$kj/Fd.s7Hc˓f gz g[LLQ^.f~i,>ɼir!pGBx+"50{70#e `]iܭʈ+Zqk*oZXSf^.}|KrydLre#3?"6}7ufP3:.yߏu=k%h_]GVu5ϋr[N=OQdь`9;r ܭy4JԞ ´p,I}?D?(%O Uw;w Г*|?e'V@mg0t J4\O& Gz)JYv/{lpdƹ4cx)~BL%M@3'~|uOjGp2{MF^XJbnac STokvmFWܠ_~ݠS,4Gu<%}J)rxtX3sёN^3/''3WF5Rvn69z:Wrԕ?~vsD1Kza߾`f^|u86Vp'57XF/F,wy_aȧ*ݖBx ̞Z塭 Nd%S6e׷#l+;4m9g2WN^:?}. :.XqW۟JɃc? [NWSDkjts%o󂀞UT}|{Cfەn~rc~|tcؐY2{llmKWR9"-nxֺsxWQJEª.a^4z7LWﮭ=Ss=,~?O9'Q,+Ѥ_I:бUwp[~#7N]W/9Fnndž"7s!ISm- KտG=M6yyHIGҟRM/7h<M{I"=yWN7ݤhzKձ#OVhs9&<himsͷ{J3}Jw0/ߩ] (PS2vnW޿s7\`Ȏ׃5gbwPֈG3P=z`߶1W(c@63hi^0[Dxu*`&o5g1F/'x4Zܸ{SN> &֜;ts[j[(>MMݕywf۪zC̹ 7AU˜~ii paŎ'.ȫ?XW,a.(u\`䈅~wl.k vw@/R5W ~R7?ngh|W*v]tlؒ=Zw{wMjO,b_dpK*Ƈ'ϛy>=:rpOV_o1W7aZgTѧ_$ίf~I xRyOzݴ+ZCJ Cr[6:_wGdƶKkt;Ɲݦ>Zp%U|HD#6ݵ$~ЩK8>UV6 =Bm ha {1~nΡzԾg潍n0Gc&;Zl65?e:̣c ?֕6exgZV?}'Tms4]?t"I\K)q1t W;vN]~{ݩ}^f}d-kF7j!Y~uTs-_IVC'mkdKͩ ꐺ;*I畳 j,yYT:5n͵mͣCeB/ҿo^iϚ}uMgL^vyyZEu.[[w':N`S  ^pGʱCk:y9jZs< g?Z [ F螭"tO4eY)k {ig׾ܹżW]5;?pneǵ=S5 \{p7'u=7llʎVʳXԫ?_'S]Ɔ'w5kqae7.x}jNs&Wf^׷j^nGUUF.o7wNz|6KMmګ;wj݊: &^yZeG˔řy8XA!3c e>e$F1!aH=kŒ5doo yZKDH:/Nuy깮纞~~<ù^ پ)eƃIM\ddوB.]{HN!:SiTei{}]wkj*M;sa9kmB9>KaT|n5pihSEf)j  (/#.y]*&MB_VvcnZ3/K,, =N>/.*fQb%(С7{̺.E.3􉁄tzvG|96hY xu] dV?Qؿm@xe)F7AAn:$*(@I4כH` #;k3\*~a5N;7²^TXwB8<; YPidT}Ĵ =Er=6億wEʴ#%{˃Wv[kT)[K==X1Q2R`!c߀֥۸#e)|{wjLJt"WG ?֨u|c)H?:x`_@ zUuE0;S$d*5ȝ+;Ygrn3 $+ WP=LUrmY=.85ҰWk)0Alq>f4v Lvz_ 't$"B&޸Y#lg;6 & U?CGjaz%Ph\/.I+hݑwZ I n..bF@ ajERRkp'4`k ;"hSϪƔnwZ$* _˛di&6EWcV3Wэ";?.n͚_F+#sJ'&Aٮ endstream endobj 911 0 obj <<95574F645FC6714F98DD49B5E551C27D>] /Filter/FlateDecode/Length 1831>> stream x59D# )^ğ !+{GFEVVwdєU!tsu?y<;>55ŋS٠f U۶Fw,.4м7lN* Vn#/9Ҡ6cXTh4BK u(4? }Rhi-lQ+ m^5H2¼KramB ݷ~#*{s }aG`">dLTL瘆/0_K|13-fa6?b~O_~x%<AgI)iW`fbwG W1O_ b ih52Q\:܉b|bd0(F#&Gƨa1jmFqhc1m6Fƨa1jmFƨa1](F"Hd܀ƶc?yLzʔ%ԙث0i|aJԛ|v~ F~_SzPa+fͮ?p endstream endobj xref 0 912 0000000067 65535 f 0000000017 00000 n 0000000125 00000 n 0000000273 00000 n 0000000564 00000 n 0000006742 00000 n 0000006911 00000 n 0000007151 00000 n 0000007282 00000 n 0000007310 00000 n 0000007470 00000 n 0000007544 00000 n 0000007785 00000 n 0000040411 00000 n 0000040573 00000 n 0000040798 00000 n 0000040965 00000 n 0000041195 00000 n 0000041518 00000 n 0000070006 00000 n 0000070135 00000 n 0000070165 00000 n 0000070322 00000 n 0000070396 00000 n 0000070644 00000 n 0000070814 00000 n 0000071048 00000 n 0000071224 00000 n 0000071470 00000 n 0000071813 00000 n 0000074878 00000 n 0000074932 00000 n 0000076755 00000 n 0000077077 00000 n 0000077316 00000 n 0000077662 00000 n 0000077910 00000 n 0000077964 00000 n 0000078258 00000 n 0000081602 00000 n 0000081920 00000 n 0000084241 00000 n 0000121981 00000 n 0000122299 00000 n 0000128250 00000 n 0000144123 00000 n 0000144417 00000 n 0000147388 00000 n 0000147691 00000 n 0000151824 00000 n 0000152153 00000 n 0000155716 00000 n 0000156029 00000 n 0000160372 00000 n 0000160496 00000 n 0000160526 00000 n 0000160678 00000 n 0000160752 00000 n 0000160995 00000 n 0000161308 00000 n 0000164816 00000 n 0000165119 00000 n 0000169014 00000 n 0000169308 00000 n 0000173064 00000 n 0000173358 00000 n 0000175753 00000 n 0000000068 65535 f 0000000069 65535 f 0000000070 65535 f 0000000071 65535 f 0000000072 65535 f 0000000073 65535 f 0000000074 65535 f 0000000075 65535 f 0000000076 65535 f 0000000077 65535 f 0000000078 65535 f 0000000079 65535 f 0000000080 65535 f 0000000081 65535 f 0000000082 65535 f 0000000083 65535 f 0000000084 65535 f 0000000085 65535 f 0000000086 65535 f 0000000087 65535 f 0000000088 65535 f 0000000089 65535 f 0000000090 65535 f 0000000091 65535 f 0000000092 65535 f 0000000093 65535 f 0000000094 65535 f 0000000095 65535 f 0000000096 65535 f 0000000097 65535 f 0000000098 65535 f 0000000099 65535 f 0000000100 65535 f 0000000101 65535 f 0000000102 65535 f 0000000103 65535 f 0000000104 65535 f 0000000105 65535 f 0000000106 65535 f 0000000107 65535 f 0000000108 65535 f 0000000109 65535 f 0000000110 65535 f 0000000111 65535 f 0000000112 65535 f 0000000113 65535 f 0000000114 65535 f 0000000115 65535 f 0000000116 65535 f 0000000117 65535 f 0000000118 65535 f 0000000119 65535 f 0000000120 65535 f 0000000121 65535 f 0000000122 65535 f 0000000123 65535 f 0000000124 65535 f 0000000125 65535 f 0000000126 65535 f 0000000127 65535 f 0000000128 65535 f 0000000129 65535 f 0000000130 65535 f 0000000131 65535 f 0000000132 65535 f 0000000133 65535 f 0000000134 65535 f 0000000135 65535 f 0000000136 65535 f 0000000137 65535 f 0000000138 65535 f 0000000139 65535 f 0000000140 65535 f 0000000141 65535 f 0000000142 65535 f 0000000143 65535 f 0000000144 65535 f 0000000145 65535 f 0000000146 65535 f 0000000147 65535 f 0000000148 65535 f 0000000149 65535 f 0000000150 65535 f 0000000151 65535 f 0000000152 65535 f 0000000153 65535 f 0000000154 65535 f 0000000155 65535 f 0000000156 65535 f 0000000157 65535 f 0000000158 65535 f 0000000159 65535 f 0000000160 65535 f 0000000161 65535 f 0000000162 65535 f 0000000163 65535 f 0000000164 65535 f 0000000165 65535 f 0000000166 65535 f 0000000167 65535 f 0000000168 65535 f 0000000169 65535 f 0000000170 65535 f 0000000171 65535 f 0000000172 65535 f 0000000173 65535 f 0000000174 65535 f 0000000175 65535 f 0000000176 65535 f 0000000177 65535 f 0000000178 65535 f 0000000179 65535 f 0000000180 65535 f 0000000181 65535 f 0000000182 65535 f 0000000183 65535 f 0000000184 65535 f 0000000185 65535 f 0000000186 65535 f 0000000187 65535 f 0000000188 65535 f 0000000189 65535 f 0000000190 65535 f 0000000191 65535 f 0000000192 65535 f 0000000193 65535 f 0000000194 65535 f 0000000195 65535 f 0000000196 65535 f 0000000197 65535 f 0000000198 65535 f 0000000199 65535 f 0000000200 65535 f 0000000201 65535 f 0000000202 65535 f 0000000203 65535 f 0000000204 65535 f 0000000205 65535 f 0000000206 65535 f 0000000207 65535 f 0000000208 65535 f 0000000209 65535 f 0000000210 65535 f 0000000211 65535 f 0000000212 65535 f 0000000213 65535 f 0000000214 65535 f 0000000215 65535 f 0000000216 65535 f 0000000217 65535 f 0000000218 65535 f 0000000219 65535 f 0000000220 65535 f 0000000221 65535 f 0000000222 65535 f 0000000223 65535 f 0000000224 65535 f 0000000225 65535 f 0000000226 65535 f 0000000227 65535 f 0000000228 65535 f 0000000229 65535 f 0000000230 65535 f 0000000231 65535 f 0000000232 65535 f 0000000233 65535 f 0000000234 65535 f 0000000235 65535 f 0000000236 65535 f 0000000237 65535 f 0000000238 65535 f 0000000239 65535 f 0000000240 65535 f 0000000241 65535 f 0000000242 65535 f 0000000243 65535 f 0000000244 65535 f 0000000245 65535 f 0000000246 65535 f 0000000247 65535 f 0000000248 65535 f 0000000249 65535 f 0000000250 65535 f 0000000251 65535 f 0000000252 65535 f 0000000253 65535 f 0000000254 65535 f 0000000255 65535 f 0000000256 65535 f 0000000257 65535 f 0000000258 65535 f 0000000259 65535 f 0000000260 65535 f 0000000261 65535 f 0000000262 65535 f 0000000263 65535 f 0000000264 65535 f 0000000265 65535 f 0000000266 65535 f 0000000267 65535 f 0000000268 65535 f 0000000269 65535 f 0000000270 65535 f 0000000271 65535 f 0000000272 65535 f 0000000273 65535 f 0000000274 65535 f 0000000275 65535 f 0000000276 65535 f 0000000277 65535 f 0000000278 65535 f 0000000279 65535 f 0000000280 65535 f 0000000281 65535 f 0000000282 65535 f 0000000283 65535 f 0000000284 65535 f 0000000285 65535 f 0000000286 65535 f 0000000287 65535 f 0000000288 65535 f 0000000289 65535 f 0000000290 65535 f 0000000291 65535 f 0000000292 65535 f 0000000293 65535 f 0000000294 65535 f 0000000295 65535 f 0000000296 65535 f 0000000297 65535 f 0000000298 65535 f 0000000299 65535 f 0000000300 65535 f 0000000301 65535 f 0000000302 65535 f 0000000303 65535 f 0000000304 65535 f 0000000305 65535 f 0000000306 65535 f 0000000307 65535 f 0000000308 65535 f 0000000309 65535 f 0000000310 65535 f 0000000311 65535 f 0000000312 65535 f 0000000313 65535 f 0000000314 65535 f 0000000315 65535 f 0000000316 65535 f 0000000317 65535 f 0000000318 65535 f 0000000319 65535 f 0000000320 65535 f 0000000321 65535 f 0000000322 65535 f 0000000323 65535 f 0000000324 65535 f 0000000325 65535 f 0000000326 65535 f 0000000327 65535 f 0000000328 65535 f 0000000329 65535 f 0000000330 65535 f 0000000331 65535 f 0000000332 65535 f 0000000333 65535 f 0000000334 65535 f 0000000335 65535 f 0000000336 65535 f 0000000337 65535 f 0000000338 65535 f 0000000339 65535 f 0000000340 65535 f 0000000341 65535 f 0000000342 65535 f 0000000343 65535 f 0000000344 65535 f 0000000345 65535 f 0000000346 65535 f 0000000347 65535 f 0000000348 65535 f 0000000349 65535 f 0000000350 65535 f 0000000351 65535 f 0000000352 65535 f 0000000353 65535 f 0000000354 65535 f 0000000355 65535 f 0000000356 65535 f 0000000357 65535 f 0000000358 65535 f 0000000359 65535 f 0000000360 65535 f 0000000361 65535 f 0000000362 65535 f 0000000363 65535 f 0000000364 65535 f 0000000365 65535 f 0000000366 65535 f 0000000367 65535 f 0000000368 65535 f 0000000369 65535 f 0000000370 65535 f 0000000371 65535 f 0000000372 65535 f 0000000373 65535 f 0000000374 65535 f 0000000375 65535 f 0000000376 65535 f 0000000377 65535 f 0000000378 65535 f 0000000379 65535 f 0000000380 65535 f 0000000381 65535 f 0000000382 65535 f 0000000383 65535 f 0000000384 65535 f 0000000385 65535 f 0000000386 65535 f 0000000387 65535 f 0000000388 65535 f 0000000389 65535 f 0000000390 65535 f 0000000391 65535 f 0000000392 65535 f 0000000393 65535 f 0000000394 65535 f 0000000395 65535 f 0000000396 65535 f 0000000397 65535 f 0000000398 65535 f 0000000399 65535 f 0000000400 65535 f 0000000401 65535 f 0000000402 65535 f 0000000403 65535 f 0000000404 65535 f 0000000405 65535 f 0000000406 65535 f 0000000407 65535 f 0000000408 65535 f 0000000409 65535 f 0000000410 65535 f 0000000411 65535 f 0000000412 65535 f 0000000413 65535 f 0000000414 65535 f 0000000415 65535 f 0000000416 65535 f 0000000417 65535 f 0000000418 65535 f 0000000419 65535 f 0000000420 65535 f 0000000421 65535 f 0000000422 65535 f 0000000423 65535 f 0000000424 65535 f 0000000425 65535 f 0000000426 65535 f 0000000427 65535 f 0000000428 65535 f 0000000429 65535 f 0000000430 65535 f 0000000431 65535 f 0000000432 65535 f 0000000433 65535 f 0000000434 65535 f 0000000435 65535 f 0000000436 65535 f 0000000437 65535 f 0000000438 65535 f 0000000439 65535 f 0000000440 65535 f 0000000441 65535 f 0000000442 65535 f 0000000443 65535 f 0000000444 65535 f 0000000445 65535 f 0000000446 65535 f 0000000447 65535 f 0000000448 65535 f 0000000449 65535 f 0000000450 65535 f 0000000451 65535 f 0000000452 65535 f 0000000453 65535 f 0000000454 65535 f 0000000455 65535 f 0000000456 65535 f 0000000457 65535 f 0000000458 65535 f 0000000459 65535 f 0000000460 65535 f 0000000461 65535 f 0000000462 65535 f 0000000463 65535 f 0000000464 65535 f 0000000465 65535 f 0000000466 65535 f 0000000467 65535 f 0000000468 65535 f 0000000469 65535 f 0000000470 65535 f 0000000471 65535 f 0000000472 65535 f 0000000473 65535 f 0000000474 65535 f 0000000475 65535 f 0000000476 65535 f 0000000477 65535 f 0000000478 65535 f 0000000479 65535 f 0000000480 65535 f 0000000481 65535 f 0000000482 65535 f 0000000483 65535 f 0000000484 65535 f 0000000485 65535 f 0000000486 65535 f 0000000487 65535 f 0000000488 65535 f 0000000489 65535 f 0000000490 65535 f 0000000491 65535 f 0000000492 65535 f 0000000493 65535 f 0000000494 65535 f 0000000495 65535 f 0000000496 65535 f 0000000497 65535 f 0000000498 65535 f 0000000499 65535 f 0000000500 65535 f 0000000501 65535 f 0000000502 65535 f 0000000503 65535 f 0000000504 65535 f 0000000505 65535 f 0000000506 65535 f 0000000507 65535 f 0000000508 65535 f 0000000509 65535 f 0000000510 65535 f 0000000511 65535 f 0000000512 65535 f 0000000513 65535 f 0000000514 65535 f 0000000515 65535 f 0000000516 65535 f 0000000517 65535 f 0000000518 65535 f 0000000519 65535 f 0000000520 65535 f 0000000521 65535 f 0000000522 65535 f 0000000523 65535 f 0000000524 65535 f 0000000525 65535 f 0000000526 65535 f 0000000527 65535 f 0000000528 65535 f 0000000529 65535 f 0000000530 65535 f 0000000531 65535 f 0000000532 65535 f 0000000533 65535 f 0000000534 65535 f 0000000535 65535 f 0000000536 65535 f 0000000537 65535 f 0000000538 65535 f 0000000539 65535 f 0000000540 65535 f 0000000541 65535 f 0000000542 65535 f 0000000543 65535 f 0000000544 65535 f 0000000545 65535 f 0000000546 65535 f 0000000547 65535 f 0000000548 65535 f 0000000549 65535 f 0000000550 65535 f 0000000551 65535 f 0000000552 65535 f 0000000553 65535 f 0000000554 65535 f 0000000555 65535 f 0000000556 65535 f 0000000557 65535 f 0000000558 65535 f 0000000559 65535 f 0000000560 65535 f 0000000561 65535 f 0000000562 65535 f 0000000563 65535 f 0000000564 65535 f 0000000565 65535 f 0000000566 65535 f 0000000567 65535 f 0000000568 65535 f 0000000569 65535 f 0000000570 65535 f 0000000571 65535 f 0000000572 65535 f 0000000573 65535 f 0000000574 65535 f 0000000575 65535 f 0000000576 65535 f 0000000577 65535 f 0000000578 65535 f 0000000579 65535 f 0000000580 65535 f 0000000581 65535 f 0000000582 65535 f 0000000583 65535 f 0000000584 65535 f 0000000585 65535 f 0000000586 65535 f 0000000587 65535 f 0000000588 65535 f 0000000589 65535 f 0000000590 65535 f 0000000591 65535 f 0000000592 65535 f 0000000593 65535 f 0000000594 65535 f 0000000595 65535 f 0000000596 65535 f 0000000597 65535 f 0000000598 65535 f 0000000599 65535 f 0000000600 65535 f 0000000601 65535 f 0000000602 65535 f 0000000603 65535 f 0000000604 65535 f 0000000605 65535 f 0000000606 65535 f 0000000607 65535 f 0000000608 65535 f 0000000609 65535 f 0000000610 65535 f 0000000611 65535 f 0000000612 65535 f 0000000613 65535 f 0000000614 65535 f 0000000615 65535 f 0000000616 65535 f 0000000617 65535 f 0000000618 65535 f 0000000619 65535 f 0000000620 65535 f 0000000621 65535 f 0000000622 65535 f 0000000623 65535 f 0000000624 65535 f 0000000625 65535 f 0000000626 65535 f 0000000627 65535 f 0000000628 65535 f 0000000629 65535 f 0000000630 65535 f 0000000631 65535 f 0000000632 65535 f 0000000633 65535 f 0000000634 65535 f 0000000635 65535 f 0000000636 65535 f 0000000637 65535 f 0000000638 65535 f 0000000639 65535 f 0000000640 65535 f 0000000641 65535 f 0000000642 65535 f 0000000643 65535 f 0000000644 65535 f 0000000645 65535 f 0000000646 65535 f 0000000647 65535 f 0000000648 65535 f 0000000649 65535 f 0000000650 65535 f 0000000651 65535 f 0000000652 65535 f 0000000653 65535 f 0000000654 65535 f 0000000655 65535 f 0000000656 65535 f 0000000657 65535 f 0000000658 65535 f 0000000659 65535 f 0000000660 65535 f 0000000661 65535 f 0000000662 65535 f 0000000663 65535 f 0000000664 65535 f 0000000665 65535 f 0000000666 65535 f 0000000667 65535 f 0000000668 65535 f 0000000669 65535 f 0000000670 65535 f 0000000671 65535 f 0000000672 65535 f 0000000673 65535 f 0000000674 65535 f 0000000675 65535 f 0000000676 65535 f 0000000677 65535 f 0000000678 65535 f 0000000679 65535 f 0000000680 65535 f 0000000681 65535 f 0000000682 65535 f 0000000683 65535 f 0000000684 65535 f 0000000685 65535 f 0000000686 65535 f 0000000687 65535 f 0000000688 65535 f 0000000689 65535 f 0000000690 65535 f 0000000691 65535 f 0000000692 65535 f 0000000693 65535 f 0000000694 65535 f 0000000695 65535 f 0000000696 65535 f 0000000697 65535 f 0000000698 65535 f 0000000699 65535 f 0000000700 65535 f 0000000701 65535 f 0000000702 65535 f 0000000703 65535 f 0000000704 65535 f 0000000705 65535 f 0000000706 65535 f 0000000707 65535 f 0000000708 65535 f 0000000709 65535 f 0000000710 65535 f 0000000711 65535 f 0000000712 65535 f 0000000713 65535 f 0000000714 65535 f 0000000715 65535 f 0000000716 65535 f 0000000717 65535 f 0000000718 65535 f 0000000719 65535 f 0000000720 65535 f 0000000721 65535 f 0000000722 65535 f 0000000723 65535 f 0000000724 65535 f 0000000725 65535 f 0000000726 65535 f 0000000727 65535 f 0000000728 65535 f 0000000729 65535 f 0000000730 65535 f 0000000731 65535 f 0000000732 65535 f 0000000733 65535 f 0000000734 65535 f 0000000735 65535 f 0000000736 65535 f 0000000737 65535 f 0000000738 65535 f 0000000739 65535 f 0000000740 65535 f 0000000741 65535 f 0000000742 65535 f 0000000743 65535 f 0000000744 65535 f 0000000745 65535 f 0000000746 65535 f 0000000747 65535 f 0000000748 65535 f 0000000749 65535 f 0000000750 65535 f 0000000751 65535 f 0000000752 65535 f 0000000753 65535 f 0000000754 65535 f 0000000755 65535 f 0000000756 65535 f 0000000757 65535 f 0000000758 65535 f 0000000759 65535 f 0000000760 65535 f 0000000761 65535 f 0000000762 65535 f 0000000763 65535 f 0000000764 65535 f 0000000765 65535 f 0000000766 65535 f 0000000767 65535 f 0000000768 65535 f 0000000769 65535 f 0000000770 65535 f 0000000771 65535 f 0000000772 65535 f 0000000773 65535 f 0000000774 65535 f 0000000775 65535 f 0000000776 65535 f 0000000777 65535 f 0000000778 65535 f 0000000779 65535 f 0000000780 65535 f 0000000781 65535 f 0000000782 65535 f 0000000783 65535 f 0000000784 65535 f 0000000785 65535 f 0000000786 65535 f 0000000787 65535 f 0000000788 65535 f 0000000789 65535 f 0000000790 65535 f 0000000791 65535 f 0000000792 65535 f 0000000793 65535 f 0000000794 65535 f 0000000795 65535 f 0000000796 65535 f 0000000797 65535 f 0000000798 65535 f 0000000799 65535 f 0000000800 65535 f 0000000801 65535 f 0000000802 65535 f 0000000803 65535 f 0000000804 65535 f 0000000805 65535 f 0000000806 65535 f 0000000807 65535 f 0000000808 65535 f 0000000809 65535 f 0000000810 65535 f 0000000811 65535 f 0000000812 65535 f 0000000813 65535 f 0000000814 65535 f 0000000815 65535 f 0000000816 65535 f 0000000817 65535 f 0000000818 65535 f 0000000819 65535 f 0000000820 65535 f 0000000821 65535 f 0000000822 65535 f 0000000823 65535 f 0000000824 65535 f 0000000825 65535 f 0000000826 65535 f 0000000827 65535 f 0000000828 65535 f 0000000829 65535 f 0000000830 65535 f 0000000831 65535 f 0000000832 65535 f 0000000833 65535 f 0000000834 65535 f 0000000835 65535 f 0000000836 65535 f 0000000837 65535 f 0000000838 65535 f 0000000839 65535 f 0000000840 65535 f 0000000841 65535 f 0000000842 65535 f 0000000843 65535 f 0000000844 65535 f 0000000845 65535 f 0000000846 65535 f 0000000847 65535 f 0000000848 65535 f 0000000849 65535 f 0000000850 65535 f 0000000851 65535 f 0000000852 65535 f 0000000853 65535 f 0000000854 65535 f 0000000855 65535 f 0000000856 65535 f 0000000857 65535 f 0000000858 65535 f 0000000859 65535 f 0000000860 65535 f 0000000861 65535 f 0000000862 65535 f 0000000863 65535 f 0000000864 65535 f 0000000865 65535 f 0000000866 65535 f 0000000867 65535 f 0000000868 65535 f 0000000869 65535 f 0000000870 65535 f 0000000871 65535 f 0000000872 65535 f 0000000873 65535 f 0000000874 65535 f 0000000875 65535 f 0000000876 65535 f 0000000877 65535 f 0000000878 65535 f 0000000879 65535 f 0000000880 65535 f 0000000881 65535 f 0000000882 65535 f 0000000883 65535 f 0000000884 65535 f 0000000885 65535 f 0000000886 65535 f 0000000887 65535 f 0000000888 65535 f 0000000889 65535 f 0000000890 65535 f 0000000891 65535 f 0000000892 65535 f 0000000893 65535 f 0000000894 65535 f 0000000895 65535 f 0000000000 65535 f 0000186538 00000 n 0000186841 00000 n 0000382573 00000 n 0000382914 00000 n 0000383338 00000 n 0000383638 00000 n 0000488501 00000 n 0000489008 00000 n 0000489640 00000 n 0000489940 00000 n 0000581579 00000 n 0000582010 00000 n 0000582606 00000 n 0000582668 00000 n 0000583144 00000 n 0000763781 00000 n trailer <<95574F645FC6714F98DD49B5E551C27D>] >> startxref 765816 %%EOF xref 0 0 trailer <<95574F645FC6714F98DD49B5E551C27D>] /Prev 765816/XRefStm 763781>> startxref 784216 %%EOF