,Photoshop 3.08BIM̒http://ns.adobe.com/xap/1.0/ image/jpeg Tabela de Emolumenos Cédulas Rurais_3 2018-09-17T10:38:22-03:00 2018-09-17T13:38:23Z 2018-09-17T10:38:22-03:00 Adobe Illustrator CC 22.1 (Windows) 228 256 JPEG /9j/4AAQSkZJRgABAgEBLAEsAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABABLAAAAAEA AQEsAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgBAADkAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9U4q7FXGtDQ0PY4q8KtW /OVvzUfyRJ+YPNINMXVnvf0PYjmPXWIw+mOleVefP6MVV/Kv5q+a738y4Zr26VvInmC9v9J0GL04 gEmsVj9Ob1VX1D67BwoZjuflirDta/OTz5a+btes7XzfAl7Y69LYaZ5Yu7G3SCa0WYoGk1ArGIlQ bfE/I064FZDq/wCZPmFfzh1jy5eeeR5bsLW6sIdL0waVHfi6NxEjSxeuI+cXxsByc/tdqYVZ7+Vn mrXtd1jzvb6rdfWIdH1y4sdOX0409K3jJCpWNVLU8WqffFWI3v5r+aIvzQM6XS/8q+t9Yi8s3EPp RGt9JAxeUzcTIAk1B9qlMVZh+eHmXX/LnkOTUdBvPqOom7tYEufTjm4rNKEb4JVdDsfDFWMXHmf8 y/JPnDT/AC/5j1yDzJYeYLW9fT9RWzis7i3uLSD1KNFFWMpWnWta+1Cqg/yE/MHWvNd/H+lvPX6X 1H6nLPd+Wf0VHbehxlVBJ9djSNXpyX4R/N7Yqh/zQ/MnXNI/M650OTzx/g/RY9PguIJP0XHqfqTu xDJQRtItV3qTTbFVe3/M7zlY/npcaDqN/wDWPKIubbSxGYYE9O7vLITW7cwgk/eSxvsX7/LFUn0/ 89fNkPmvzVqd3OLrytbaTeal5f00xRIGEV+ljbu0qIJSHcMTVzsfliqcah5q/N7yloWieeNd1y01 bSdSltl1Ly/HZxwC2ivACrQXKn1JGT/K2r4jFWVfl55v8xavc/mCmoXfrroer3dppY9OJPShiDcE +BV50p1epxVhs35n+eV/5xy07zgup08xz3XpS33oW+6fXpIael6fpD92oGyfjiqL0380PN9t+eV9 omq3ok8nyXkml2sZigRYLk263EPKVVWU8uLKOTHriqQWf5w/mFez+eL5NQEOmwaPPqvlqH0LcmGM XfowSEmPk5ZFJo5I3xVQb82PNaflfrnmDTPP/wCndZtBpvqwfoiGz+oSXUpEicnj9OflRlrx2417 4FZK/wCa/mu7XyhpYuRpnmL9Nronm22EUT1fj8LqJFNI5h+8UpTuAdsKoYaj+bdj591bQb/z8ZrH QNLXW7qddIsVM8SsC8AQbpVa/FzPyxVr/F/5zS+QT+aSa1ZJpy1ul8pfU0MRsxKY/ivCfW58d6D+ zFVLWPzQ86X/AJyW1bzJH5G0u8trS68trd6el1bagLiFZWEt5IKRUZuJIoB0+0N1X0BirsVdirsV dirsVdirBdX/AC1u7zzrqnmuz1j6ldahocmhwx/V/U9BnkDi5D+qnIrTZKD54qxNf+cYvKNpo2mD RrhtP81adJbz/wCIqTy+pLAwZmNq1wI1DkdFO3jiq7U/yB1u/n1+1bzi8HlzzJqMmp6lpEWnw8y7 yCQKtzJJI68Sq7gU26YqmbflF5ssPN2q695Y85HRLfV/qi3VidNhuyUsoRDGvqzSeHLdVHXvTFXa b+U3nXRvM2r6tofncWGn61qcmqXulnS4Jw3qSFzEZpJS4+H4eS08aYqx27/5xu/Lu30CPTNS1VV8 66lI5tfMc0kkc01z6vrExWZuBG5CfCQKn9qtcVehef8AyDeecPJMfl2bVRaXitbSyamLf1A0tuQx YQmRac2FaczT3xVKNJ/KG/OtSeYPNnmWbzLrsdtNZ6bO9tFaQWqTxmN2S3iJUuQx3qPv3xVU/LX8 tvOPkxbSwuPOP6V8u2UUkcGkfo2C3oXYsG+sCSSU0ZiaE4qs8y/lh5rvfPNx5t8t+bv8PXV1Zx2M 0X6Ohvaxxtz+1NIF3anRfpxVB67+Ri61H5qN3rZ+ueZJNNuYbtbYBrW402P0/VCiUB/Vq2w48a0x VEW/5G6GmprJPdGbSP8ADaeWJNO9Pg7IsqyfWPWD7MSvTh13riqEsfyQ1NzpWn+YfN11rnlfRJY5 tN0OS2hh3gBESz3CEvMqeBHTbFVfSPym826N5q1TVdL85C20jWtUfU9S0U6ZBIJUkl5PB9YkkZ15 IeHJQPGmKoC1/ICeKODRJfNVzN5EtbwX1v5ZNrCGDCT1RG93Uu0fMmq8R9++KozzN+RkGu23miN9 XMFxr+o2uqWdwtvyNnLar6ew9UepyQsK1WlcVXX/AOR1rM+qLaap9UtdQ8vw+XYYPq/P0UgKkTcv VTnXh9mg+eKoO/8AyW846r5KuvKWteePr+nPHaxaf/uLgh+rC0dWH93KrSclQL8Te++Kpz5q/JzT db8/aF5zgvTYX2lSwyXsIi9RLwW5rFy+NODqOS8qNtTbbFU2j/L+EfmBqnmye7E0OqaYmly6YYqA KrBmcy89+QFOPAfPFWHj8hL8acfLI84Xo8hGb1f8OfV4vU4er6vo/Xa+r6fLtx/HFUX5u/JnWvMf q6VL5umt/Jk0kT/4eFlBI0Sw8eKQXbn1I1HAUFKDFXp8EMcEEcEQ4xxKEQdaKooOuKr8VdirsVdi rsVdirsVdirsVdirx7Sta/NT8wr/AFrUPLev23lfQtIvp9OsbdrKK9lu5LfjyedpT+7Vq7cOlehp UqsT0Hz1q2pfnBfWWr+dYdMvrDW5NL0zSv0NDcyXNmtx8Vul8sQeBZOPAlmr+0cVRVj5m/Oe88se ZfOtl5qgktfL1/fx/oG60+29OS3svib/AEiMJLXgdh3p9rFWXfl9+Y+t+aPzDa3eX09EuPLlnqsO n8I/3VxOycz6gX1G+0Ru1PbFWMeXPzQ883n+EfrOp8/0p5mvtNvv3FuPUtYOPpx7Rjjxr9paN74q 9C/NzzPrmkaLp2neXLgW3mTzBqFvp2mTMiyiPm3KWUpIGQqkamtR3xVg95+annuX8mLLWtOBPmG2 vv0V5nvkt0uJLMwsyzXItlCxs32GpTiOXTFWeflNrF5q3l2a8n81Qeb4mnP1bU4bZbJ1T00Jhmt0 A4OrVO+9CMVeMaL+bv5k3vmk2Vl5l/SWqjXZbGPygdMiCvp6MeVw17GicQgrtyqKciaYFei6T558 03GmfmtNNe8pfLU98mit6UI9BYLd3jFAlH4soPx8sKsD1783POMFp5Ia884/4dt9X0Vr3UtS/RsF 9zuQ7Bf3Kx1XnSnw0AwKy0/mH+YC/k/ol3ecbPzt5kvYNN0mYwoCRcTfBctbsGUVgBahFOhphVJN e/NDz7/ypldbtdYFj5q0LVW0nXyLa3k9WRJDFThInCP4WR/hTrtiqJ1Xzz5/g/MSfy7qvm2LytHb Pbx6Qtzpkb2+rLRfVdrpuQhLt2XYV49Rir3nFXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXmE/ 5Pa9Yaxql35O843PlzTtbna61LTVtILpfWk/vHgeQqYS3iBUbeAxVZo35Sec9D8y6nqmjedzaadq +ptqd/ph0yCYyc5OTRmeWRnFU+HkoHjTFUui/ITX/q+oaPN53nXypqt7NfX+j2tjDBJIZ25Mn1oy SyUIAB2ofDFU7178oLk6xZaz5L1+TynqFrp6aQ5S2jvYpLOKnpp6crKFZaD4qnp9OKoC9/IhotB8 t6d5e8wyaVfeXbubUF1Sa1S8kmuZ93kaNnjQb9Aa7ffiqrqX5JT+ZtQ0efz9r58z2ulQXEZtBa/o 8SyzvyEpa1mXhwQIvEDfjUntiqnp35I6r5cbVIvJPmqXy5Y3t1Dd2dotqLwQGOJopY3NxM3rLJy5 fEKqVXrTFWS/lv8Al0vky21NptRfVdT1i6N7qN6YY7ZGlIp+7giqqDqaA4qxpPyHjj8vXFjDrTQ6 wuuyeYNJ1lLejWkspjDRen6v7xSsdD8YrsabYqv138ltYvNR1ibSPNs2jWHmYL/iTTorSKVLhuHp ytC8j84PUUtWnLr3G2Kpr/yqDR11/Qr2Ob/cRomkS6INKlj5+tDKpQs83Nd6Hf4N8VY5B/zjvb3J 0fTvMeuvrflbQmu/0dorQyW7hLmnBJLmO45N6NBxIUeHTbFUJq//ADjVG1nq+keXfMJ0Ty5qtxa3 R0prRrwxPaowos0twr0d25HvsBWmKpt5m/JnzP5oJsde87z3nluWeO5uNK+oW6yGRBv6V1yLxAtW igUANMVeqqoVQq7KooB7DFW8VdirsVdirsVdirsVfME3/OU/nhJXQaZplFYgfBcdjT/f2b0dlw7y 1eIVn/Q1Pnn/AKtemf8AAXH/AFWw/wAlY+8o8Qr4P+co/P8APNHBBpGnSzSsEijSO5ZmZjRVUCap JOA9l4x1KfEKN1D/AJyJ/NbTo/Vv/LVraw/ABLLb3aIfUBaOjmXieaqStDuOmRj2diPKR+xTM9yX /wDQ1Pnn/q16Z/wFx/1Wyf8AJWPvKPELv+hqfPP/AFa9M/4C4/6rY/yVj7yviFVX/nKTzwbiOIaX pp58Ngk9fiAO1Zqd8iOy4VzKeNk8/wDzlPoIv1EFhdNYEVd3gjWYGjbBRcsp3471HfbKR2VKtyL/ AB5J8QJS3/OQv5oufrEHlqA6a6+vFcm2uiv1YvwWVnWUpSvwk1py2yZ7PxAfVv8ABeIpro/59eeL OSS785+Vrmx0VFdFubSxnU/WEahRnupo4xTg9RWtRSmQnoIHaEgZe/8AUomeoW6h/wA5Sad+iruT TtPmbUFbjafWIUWDeRynq8Lln/uVFeP7Ve1MY9lmxZ2/HkviJNo3/OU2um8gbW9OtU05i4nayike cUSqcFluEQ/ERWp6ZZPsuO/Cd/P+xRkT2H/nKPRUs4PrljdLf8la4SK3jaIxM4I4MboNy9E13H2v bKj2XK9iK/HknxAi9N/PLzTqHmnQdIXQXs7a9lhh1Oa7t5U4+sw4PAwlZeLowKlvHv1yM9DGMJS4 rrkvFu9ca8uebheAAZgKqSdjT+bNaza+uXXjH/wJ/wCasVQ2pa1c2Gn3F60TXK20bSmC2iaWZwor xjjDVZj2A64qx/T/AMz7e9uJIE0zVIWjYLym0u7RSGlWLkGpSlX5GtCFUt0GBU60fzI+q2v1mCKS FfhPC5gkhk+NA4qjsGBo24O4wqj/AK5deMf/AAJ/5qxVa97dqpNY9gT9k/8ANWKqs91cJMyJwCrT qCT0B7EYFU/rl34x/wDAn/mrFXfXLvxj/wCBP/NWKu+uXfjH/wACf+asVd9cu/GP/gT/AM1Yq765 d+Mf/An/AJqxV31y78Y/+BP/ADViqJ9eT6j6+3qelz6GleNelemKviGfyF5uaeRl0LVipZiCLCYg gnOqGohX1R+bQYqf+AfN/wD1YdW/6QJsP5iH86PzRwtx+R/OCOskeiauroQyOtjOCGB2II71wfmM f86PzXhR95oX5m3ljHp97aeYbiwibnDaTW128Kua/EsbEqD8R6DIjJiBsGF+8Jo+aX/4B83/APVh 1f8A7h8+T/MQ/nR+aOF3+AfN/wD1YdX/AO4fPj+Yh/Oj814Wb6f5d/MM+Xl031bhNOiMYSzfTbo3 BUsGkhSYQMyoG5MYzIErX9rMTxcXFe179R+ttoqb+VPzE/w1FpfrTi0jU2qWg029E3oM5lP7xbeh jLsdi9a9qb5LxsXFf6R+tFGqRkHl3zXBoculGwmW3SFY2maDWF9QLLFJUIv7kFTFyXkgFK8vi45X PLAm7/3PmkBOoz+YZ0ZTaQajY3NncCSBYrK49LkkKKJiZJfVkYl6FTbt0O+2QJxcW5BvzH4+1O6X 3mnfmja6dBJaz6lLF6ckTW7abRCGUtLGsCNMWUmQMjSpH8W43BImJ4id6+f4/SjdCXXknzsfMbvH e6xEGgMUl1FYenM8HHh6YijuDCEPpH4WmWo7b4Rnx1/D8/2foUgo7StC/MuxgutBS41K3sRbGxjj i05ZloCRRneWKILyd2V43k41LLvvkZZMRqW18+f4/QtFOPLfl3zFJqmgGayu4ItM1WCacrFdLFKi SCJXlN3c/aT1fhEVvQAsa05ZXlyxqW43Hl+gfpTT13zFZyX1le2cN9Jp9xJUw3MDRrKrCQn4TKky jlx4k8Dt03zSSyRjzIDYIE8g8Hl8yfmEBAkd1qxgWN5RIba79R2p/dyhdKPEchxBBrQ8vfI+LHvC eCXc9c0C01+LyvaRS6wH1i4VZpbi+SOdYywUmIpElhyUb05AMK9cfGh/OHzXw5dxXC08+BkJ13RS oIMi/o2YE+IDC+29vh29+748P5w+a+FLuLGPM+p/mS3mmSHSdMuH0iSCK3S+t77T0i/eAF7gw3ML yrNG0jbhipCj4e+Jzw/nD5r4cu4p8NQ86nQLC/aK2t9SihjbUtHAjvpZCXFRFN61hCknAHl+zU7V pu+PD+cPmvhy7i7yze+eLq5kbWDBa2cf2YXtYop5kkX4eD29/eKrRttJySh24+OGOWBNAhTCQ5gp /wCerIX+lXNgNYfQ2uJbf/chDJ6MqpHJHJIkb8ko0kaMla7V6HpkpSA5mmsyA5sBg/LzzFeXc8th +YN3Isjs88MdxPMAGnaSPjS4/dcUIUBKA8QDVSwIjOMuRtAkDyKbL+Xvm2QxfWvN948YjjjuIYjN CrmKYSB1dJvVRmQFHo9DkmSFh/Lbz19UuobvztdTyzLAkM6CeBl9O5+sSn4J6AupMdVp8FB23Vbv /wAs/OFxf3VzD5zvoknu7m6hi9S5EcSTzxyRw8EnTkkUURjABUfEaUxVv/lV/mhYLW3XznqTwxrE t08k1z60vGRXkHqJPGVBowBX46GhcgAYqr6F+X3nPT9U0+4u/OFxf2NmYWms5BPWVorcwuWc3DFh K59RlfkOWKvS/wDpVf8APD/jTFWPyatFanToZI5JGv5/qsTIFojCF5uT8ivw0iI+GpqRtSpCqWea vL0epSl38taLrHBeUcuqOFbn8C97O6p8PLevZR3+FVKofLmowXLzweSfLEc0kgkllS8ZZDIVNWYj S6lv3jbnsT44qnsXkTyQtt6J8t6WiPUyQpaW5TkxRm/3WtatEhrTfiPDFU++EdsVdt4YqgbeS/Eb ehBE6/WXFXmZD6ZlPNqCJ/iHxUXvQbiuyqG1jUPMlrFbPp+kRagzyRpdJ9b9ExxsxDyLyhIfgKGm xO/0qphfE/o645Cjek1QDUV4HvQYqiBSnTx/VirjSnTw/ViqEZpxqM/pRqw9BT8TlfjDPwGytsd6 nt4HFVe3a4a2ia6jSK5KIZ4onMiK5X4lR2SMsoPQlFr4DFVjSagLm1CQRGJrgi5czMGSMH92yKIi HZjx5KWWm+5puq87/NdQ+u6ZEtzbxtLJwnt54LKf1IJJXhNfrM0EgHOZVBjr8TAcTWmavXQmZXEE +n+dKO/+aCPm3Y5UOaSQeWL680iK8iszdrNCLq2kt9PsHIeRBIGtmMjx1ZviDF2FT9qmYPhZ72j/ ALOfLz9LPiHf9gVE8q+ZLdomNnNc3iQiGacadp6i49Pi5dlM6EEnmsY5UVnJI475E4MxH0f7PJ/x Hz/Wnj8/sCXTaRJpttHZX4gtpbpyY9Pk0/TIWeCVlt445IjNxkjiWWNCUap4qu5PEk4M1/Sf+VmT 7PSvGO/7AymLy3faNppuZr6zs7eNfVvLo2UNvDvVnlYmiryZixr45rM0MuQ+rT5COnrv9LdDIY8p 0oaZoXmq6tUa08x2+oJDKwe5Sxt5OfGSRZI5PSCpVBRfg4kOtTtVTE6X/oFyf6f3efv/AByl+Yn/ AKomnlq5toNSfR7vWLPUdatqtLbxrDHdxrt/eRREEABl34Drk9FpMo1kJxwzxQF3ZBH0n48/Njkz kwIMuJA/nuG9bSzvxrcVI8eMNOu1c6LtDnG/P9DzXadXC+V/qYl+Uj+avXlGlG1XXm0+MSC/DGDl 69v9YJEDLVuHMrxNK+2Q0fD4x4eVfqa9Dw+PLh+mv1M2uLj8+PSYNbeXBKyxcXVrxgrDaWqkpyDf aXccenxfazbO5Sq8n/PvkxSPy2qinFWN6SdhWpDD3xVByyfnYUX1W0BJOTep6YvHXhRKceToa/b/ AAHiQqgr24/N0KCn6GZiFDITdKAeKl25Bm/a5ALTwNe2KrkvvNpaJLy2tlXpNNFdSV6DdYzF4125 /Tir2Xk3+AuVTy/RVa96/V8Veb+V9T1bU9G8pXmpyPJdtr92rbBB6aW18kYKpGoIVeNOQXem9eqr JvM3l0319LcL5V0HVjLHHFJdanN6czxrRuD/AOhXXwq6qVHIjvtiqXJ5D0x1mMvkTysJFRPQUMjh pOFWRybBeCqdgQGqN6DpiqbWkHmiws3+o+X9Ft7mSXk8MN9NDEysC7uXWxqX9Rm/Y3ryrXbFUwtr jzU08wudOsIoFalu8d9NI7rU7urWsYQ9NgzfPxVTb6B9+KoC303Tp42ae0hlb6y8tXRWPqJKSj7/ ALS8FofYeGKpR5q0r8vpxYQ+YhYQNFNC2nrPMluwmWQvCIviQk8lagHX4h0JxVPrz0/0ZP6YX0/R bhxI48eBpSnbFUSOnQd+/tirj06Dt39sVQbW1vLqM5liSQ+gsdWAPwOz8137NQVGKq9ta21rbRWt rDHBbQIkcEEQCIiItFVFWgVVAoAMVWNpunPc2sz2kLS21wZbaQopaOSU0kdDSqs4dgxHWpxVhXn6 F5PNFm3r6lFGsdaWM08cTOL2JlEqR2tyhrTixaRaIW248mUpSiKWSLXrMt+kyizQ1pPdyQtzW4Wk qfUPR4AkFqyKOhcjinILTNnlPqx/Anf/AHZb+H+phVinmVbibXVYPfxpElmES0uZY4TzuiZOS29l NExIjUPykNF2PpqxZlU28ymSTypfJH6scjWxCvZzLHcA06xNbwXMyt/qRsfbFUH5BMqaDGJTdSPy c8tRnaS4oZXI5NeWtnNTwBiFB0qN8VSvy1b3ieeHmkm1NoWjvAIri7uZLQE3rsCInsIIahTSMieo SgUOgDkK9S1K0tLqWSO5hjnQMCEkUOK8RvRgcEog8xbExB5pB5k0uK08valc6MLHSdThtpXtNTnS KKG3cKSJZHMcgCJ1aqnbIjFEbgBAhEcgwawsvztv2Wa0836Pf24jmF2bf0qJdszL6KUtJv3cPHip Y8+dWcOB6eTZKsXlf8+mHG680aeRHw4NbwxRtIPq5DrIZbO4Vf36oQyr9kuafZUKpivkn80Lh7ea 487xWdUjN3Z2ulWkqiQnlMsc84rxqSsZMYooXkGbkWVREvkjz7+8aHzlFzljCBZtItJI43PIu8QV o3/lCB3egB5cyahVldho8UNjBFeiG8u0QCe5ECRK7/tMsY5cVr0FTQdz1wqnPpx/ob0+I9P6vx4U 2pwpSnhgV5h+UYtovJttHqM9vcXFve3ckMiOkyoTLIqlXUkcgjFSevUHFVXznqflcXlz9fsPLF2B CpaXWLxIZWq0NVlRrS44p9g15HcJtuKKsZ+u+Q2Q3C+X/wAv3hSlZv0lDRePBSOQ00j4WdR9I8cV ZzYfmP5NFs7XWt6LbRQv6SehqMUsYFW4KSywhWKLXj8x2qVUc/n/AMjIsjPr+nKsJKzMbqIBCpVW DEtsQXUH5jxxVaPzD8hmMSjzDpvpHjST63DxPIsq0bnTcow+g+GKrLW60q/tUubeDTr+Ca7E8Nw8 gIdfVDLOrCKQF1C1Sh34r8Q/ZVSrzhba/dQ6f+gZbK2WBZRcRfW723orCnGEWzwRuzfsvKv7s7gN yNFWUXmoWg0ycPNGXEJDEE0rwPiScVRI1Gxp/fJ37+AxVx1Gxp/fJ27+IxVAT3VjJqU/wW83+jFK ytQ/EW/d/Zf4Hp8XyGx7Kq2nXVjbabawcLaz9GGJPqls1YIqIB6cR4RVRaUX4F27DpiqEmjtJtT0 5l06ymaO95ib1OMkRLOfVVfS+Jjy3FftMd9q4qwb844o31hOd1bQf6FIALi302c/73QmoN9NAadq fY715hAVLB4rdF1K0H6Rs/3l/pjxxfUtBHL0YEDcSLrny/fJ8S1dOSiIFTUqvc+d07QujBkYEqwN 0QQRUEHCrzvzlbh/PCSy3ttDOtrYqttJb2MkzD6+G5iS8lS641XjTjxDEGPlJtgVkvnaSRPKMn1q eK3tHe1S5edQ8RheeNZEkW9eK34uhKmrV3+EFqAlUD+U8VxF5Rt44pYp1VpAZIIYbdK+tJUCPTJJ 7UU78Xr471xVJvKSBfzFk/0uCR/SvyYI4NNjffUJannBM95sfhbknEnd6S8hgV7Lc/70SfMf8RGK Em81h28u3yxhGlMdIkll+rxs5I4K8tRwVmoCRv8APpirzvTPzRmtLSKz0/SrOSf02ubl7zzBp5EN sK+nLcSq9zMaxCIg8WXiwq5oTiqL/wCVvaxxtXOh2Ma3AuJ2WXXdNR/qsC+os8XFpEkEkdf2gqkf EwT48VUk/OPXBFcyXGhaZbpHwNrcN5h08280bSRq0hkoHjVUnjkFYzUMBsSoKqpp35y3smpx22o6 JaWdrcTJFbXEeuaVNI6yKrA+j6yEtSWNuKM2zbE/DyVei6VqEWpaba6hEpSK7iSaNS8UnwyAMvxw PLE2x6o7DwOFU1/6VX/PD/jTAr5qttR1U+UdB/R4ntzceYvRu1t19J/QE8zN8MYX4CUXlt9mtcVZ X5ru/Ltpqn1m4g8v/pONIeFxqV7HaXIK8JI1ZvSkdV+FmG/Ybb7KqZ89FbQzyXHlxCfsH9N1jNW4 r+8+rjrwk7dV778VWl89TSzi3tZfLk07bxxLrhLstC1Qq2rH7O+2Ksg0LVl1O0aQmzNxE7R3EVnd rdIjKxFDIBGamnQqCMVTLif5U/4L/m7FUpBsgP30GnOf0ggrcTKrc/VXi26t+9Hw8F7/AA7iuyqc Op4p8KfZ/m/yj74qp6gv+gXHwp/dj9r/AIrPviqTTHTf07pStaaW10WvfQmNyi3SUUiQwxcKycj/ AHoDDi3j1xVkDqeB+FP2P2v8k++KpfdCEapc+pHbMfqsh/fSBTxq3Ib8vgO3M9ttjiqDgbTjo8TR 22lLAY7XhHFcI1sFMHwBHCKCoXaM8d1326YqyawX/clbbL/vQOjb/aX3xVif5v2moT35NpcajBSz kBGnzXcO5vI9/wDRrK++OlaH7XHl8PHkyqUpurXUDeXoW71QcryF1RJLsR8Fa05cWWxcKvWqKxVg Xqw+Ixqs08uxOmhaOkszNKtpEJGuRHJMWES1MrzCCVn/AJi8aNXqoO2FWM+aLS+fzjHJDdX6wfVr UFLaSeO2qLwFiY7e0uIORXZyZuRTZlVfjxVOfOlpc3PlOSC0uJYriRrdUeycW0wrMnSa2jvJVH8x 9IjjXkVFWCqj+XVvND5chjuLm5lkBf8AeakTNckeq9Ob3kVjN06ViG3Qkb4qlnk62v49f0wzS37x pparI1zPeSI8nw/3kc1pbxeqP5y6yGprH4BXoXm3zZpHl6RX1BnrcMREka8mPBV5HcgUHIZTm1Ec dX1cfPqIYgOLqkieYtC88abqOh2UZleaAie2u/UiR4GYJJV4W5Uo1Nj3yOHVQyGgxw6qGQ1Hm8+s /wAidX0u/jktNN8trFFHJwukfWoblZLhfRfcXclVSP4l+Otdl4FuYyHJUW/JvVpVNjPo3lq30xpY pC31zW7q4CwwPCELl7dnWjcUXmqotfhY4qqad+VV9pCwm2s9D4COVntob7XbVY7iRfT5RuZrlW+B mXn6asNiKdAqjrf8qfK8OoyapF+jNJnljjHoWceqJwI9MyKXg1C2R1PBthEu9Ca0NVXpsOv+W7SB IY7lI4oxRVVWoPwxVPvrMH6B+s8x6H1X1Ofbh6fKv3Yq+c/OfnPW9E1jQ7awnjit765KXAkjD8qv HHRTTY0kJG/bwriqf6v5o122uFWGzubtSkdXh+qAD92h/wB3SRHep+75Yqgl85eZCGJ0m9XiKgE2 FW3AoKT/AE74FRNr5n12aQLLbT2y8eXqS/ViK0U8f3byGvxEdKfCfapVFLq+oKWZZAC5qxCJUmlK nbwGKt/pvU/9/f8ACp/TFVthr2rKlAskg+tqlVEI2aRqt8RXYV377bDpVVA6r531KxNtGbW9uHeI yP8AV7dJAqh3BJYfCSKfZUlj2BxVHz6/fXGkPOkrKksMTqHjCMA8Jb4lZQQfY4qqRa1qT+lzDEhp +MhWIheMdAfH4h4eO+Kqsus6kI2Prf76/ZXvGT4YqoNreprqt0FZnAic/CsfVfUou9Nz2/HFXP5h 1c2vqGOVHIgJiIg5DnEWINGK/Cdjv8qjFU00XWtTfzHpkLJI8ct+8cjAQgIqkEM24ajU241O+9MV QP52WuiTXrfpKC0m/wBBkX/SpPTqn16Eld9S0sceYU79wPjBojqUkubTRpNTvp5dOtUYXyJK8ku/ qetY+nWmrihf0UdQUU0A+GvwyqvRfKyOnlvQ0tFRLVbKAW6RG4aMRiFQoQpLcqVp04zOP8puuFWH +bY9Hl88Ce6htJryOCztnmeVxIrpexTLEyvqNq9V9WNwPq/7S/E9RGQqffmHw/wRcG/EZtkNs5M0 k8SBlnjZG5vdacqlWAIPrrv05fZJVb+WMVjH5ZjTRYYbfTfUmMEVu8ssYBnkOzw3N+hPjSX/AGK/ ZCqQ+SItFTzNo6WlrZRXEeiIIpYXVpRASoCLTUrtzGOO37p08Ja9QrIPzr8vaxrC2g062e4MfrpJ wUuVMqR8SVUqxHwnoR8xmDrISJiQLr9jrtbjkZQlEXwn9TGPys8ka3prXGmXqXulxz6c9nDqNujx OknqRsrKW9XiaIftVH6sr0/EcpkQRYYaaMzmM5Aix+pk0n5TzqySL508xvLHH6fN78sGIAUOycfT LKB/Lud2qd82Ts0BP+UN4ZVYeb/MpCosZT68eLKqhNxwpyK9WG9d+u+Koe//ACnvLj1T/iDzAkk1 CzR30opQktwU1ReRIqKUAAApvVVA3f5T6o8tzIuta+TODxX63JxjJblWMdB+rFVLS/y417TLt7hr zVtRMgPKG7k9SPkTXkFCihFaUG3ttir2X0Jv8D+hwPrfozh6dN+X1elKeNcVYpqHljyxc+YdItrn RoLgtb3N2l04JMUkDQKvHfYt65NadsVUNetdAtNSEB1fQ9OpE5+qX8bPPSOFWDcvrcHwx/bf4fs0 3X7WKsfjvNElZli86+TnYKzlUtWYhUUszbaqfsqCT7YqyzQNM8s3olh+taZqtzAq/WDYrwCNyeNi yetcFQZInABOxUipIxVN/wDC3l//AJY4vuOKu/wt5f8A+WOL7jiqVJpGhQKQJdPtv9NCcZkJNTKA Iv72P94/Oif6y/Cf2lVHzD5ImuoLRNNkW2kVgLl4GhhpHVqlFuLTUeR+L7NV6faG+Kpte+WdDXTp wbWNiIjViNyVQgE0oMVXR6N5Ub0kSO2JmDmFQ1S44/Fx332HbFVZvLOglSDZxU+HsewoMVQE+g6F Hqdx8FrCTbFyJVJOxesn20+Ba/H8xuO6rVnp3lSTTIJ5pbC5DxwtJdwHhBIWj5K8YMkvFXU8kHNt u564qjIvLsEOoWlxCtqgiuC8g9F+ZDN8IRvVorD4eRKmtDsK7KsQ/MyyubrzDaxx3F/DDJF6cosp 7qBaG/iJLG3tpwG4gjl6iHjyGylnRSxjULXVTpNpcLc6r9blkguJHjnvlYSJGCapHp7jg3CjRtAq GpJUNtirLvI/1tvL1it5NK80fJOV4qvOQoFObXMFhKx92i+k4VSbWLa9PmO8KT34ja5gZDDLcpCF X6kGVI4rSWAI1G5cZG/b+JeUvpqpr56hmm8pPbW09xHcz+mInsC0Ew9P9837+zivZYwUjYf3R5H4 OrDFVTyJHMNFHryTeoXkNL0tNKAZXoOd7HaTlQPs8o+nQsNyqlPlDT9Ri13Sbie6v5If0WIjFcXF xJGZFKkvNHLaW/77f7burnf931oFZJ+afm/VfLz2i6csfqXbSF3kHKgiWOgAJA355h6vPKFAdXA1 molj4RGvV3sb8jfmxqGo22pX2rRh7OxsZL5kQRQyqYZFR42MkiRAjka8nFCOuR0+aZmYyo7WjT58 hyGEq5XYSkz/AJJ6beXd5HoSSXt3ObxvU1GwcyTRSzD1oxPqHCMpR2r8NK0+0Cq5znoKPVfyfNnd wx+VvTspaveWov7AW4EsUbLI0ceoGJeQhXgQKihYUqxxVVs/OH5YadGsWneV4LiGWF4I2a60ycTR lUWZf314zOeMaiTl14itRTFVJfPP5ZQ2sscfkjTUtvUBukP6F4K/EhGk/wBII+zK4XuByGKpt5b8 yeRLuAXuj+V9Ht5onBZIYrMyxMkgdCzW3qqDyiV1+LqAeoxV7D9eb/Cf1/iOX1D1+Fdq+jzpXFWN 3Yr510H90CBp2on1zSq/vLL4B/rdT/q4q3r+umxvxG3mPR9MQxyEW1/Fyl+CHny5fWrf4U3d/h+z 3X7WKpS+va2kksb+dfLKSQqzTIbGQFAgVnLA6ntxWRSa9AR44q2nnrS5kgt7bzz5be+eiEgI4kkZ CqhI1vgwrIVNORNPh67hVk+gajFqOlRXsOo2uqQzNIY72yWkDqJGAC0ebdAOLHluwOw6BVMfpH3Y qlC3/oow/SNnb/6aY+My1PxzAel/ex/vH5/D/rL8J/aVUfMGj+Zr+G1XS/MJ0eWN1N08NpBMJUFa qguBL6ZNevxdOnWqqN1XUdPtdPlS5vYUdqWymV0RmnkjqkdPh/eODUKBv2GKotFvQYuU0RUBvWAi YFjTbieZ4/TXFVY9Oo7dvbFUBPP6eozj6xDD/ovOkoqfhZvj+0nwJX4vmNx3Vaspb2502C4iv7S6 9aOKRLuCFjBIGjBLxgTP8Ln4k+M0HduuKtNf01Cxi/SNmvrXLp9XK/vZeDN+7iPqijx8fj+FvsnY dlXm35w2mlXnmm0h1TTra7tYbSa5a4ubmCEwrHP8fCOaNyQagu3ILQUbtXC1fi/wGv8ANMvuIbIV 1STS/IixPpeq6Xa+YEufRSNdTtri05PAZhccZXQ8XWZ35u0e771O9G13ia6z9Ff1ZtlQ8/sZXpba zppHpaPr87zIrObu9a4Ibg7Mq+tcuFIK8W4fDVhSq1Iw8uLtGYP7zh32qJ7/AHMwcY6IDWhpb60s 2oWkmnX8jIypN9QEl1SS34y1nWWY0eOKHqNwKCoRsqx4e0YCjPjPeRP9BA80k4z0+5ket2sd1okn 6UBis4E9f61PVkt2iHJbgfWI3iUxfaDMtBmBI9qDISPEMb5ECq+EwftbP3VdFLyzaWtrbTjRiJoJ Z5JZ5raihpjIwk5/Voo0LKRxJI5bfESclmn2pIDhGSPuA8u+ZKAMQ7kDo2n+XIfNYgt72E3lo0sq aIv1UG2dx+8lVFgS4Vv3zVLP+2a9c2HZuXXnLCOWMuHrI33Hn6yP9i15BCjRZN+YPkaDzWYo5Ln6 sbYuN4xKrLKiBlKlk/kGdHqNP4lb0Q6rVabxa3ohjmkflvZeUrPULyT/AHM6aLGaG40WGyDNPFtI YooxIVZ2KABSKHIYdKYS4jK/x72vT6SWOfEZcW346tw+ZNAsbNbqw8g6vBNqTRme0g0uFJv3zSFX mPqLH15FqvVOXxAVzMc5Zc+ekWO5lPk7zF+53ITTUZpJFaNWSMCbk5X1vtU4sFYqzAYqo6d5ptNS LL/hzzBYsVUlbnSJY68pPSC8gzLUbMd6BTWuzcVUBY65Y6n9aP8Ah3X7UwKHcT6QQWAPFuJWRgzo tCU+12UEgjFU38v+XI9cs5JxFe6RLHI0UtpqFl6EgKEiqkSNG6nqGRiMVejfUf8AnVfqHP8A48fQ 9Sn/ABTw5Ur+FcVebXHm+/tPMkOlyyEw3McKWpSnMSyC5kfmzOPg4WuwVa19vsqrtf1m+ivFUatq 1r+7J9Oys/rEf9xWvP6rcbj7Sjlu21D9nFUt/Tt99aC/p3zAa3Eg9P8AR1IzSnwc/qIpGv7Lchy3 +JuyqM0nWr5LyOJ9X1i8c1T/AEuz9KOoMhLNIlpAorw/mA2X+b4lU/8A0jff7/f78Vd+kb7/AH+/ 34qlYv8AUWMQXVL63rflOEEKyI3IseDloJeMe1S9RRtuXbFUfPcao0Vuq6jcRtGwd3X0qyBWNUfk jDi3fiAfAjFVPVp9TkspymoTxAcJCE9MgqIzyiPNG+B+pp8XgwxVERa1csIh6s1ZRIVqkgHwrX4i V+H/AGWKqz6he8T++f8AY7+K4qhW1a6j1O4DSymkPL4VZtkL/wAoO++w6ntirY8wTPaidZLkIwiY BoZlekkfIVRkDg+II2Ox3xVF2kmoyatZVv5xEt2TJCPS4SKaARvVC3FSajiQfEkbYqxP83NQaz8x 2LpftaFYZJGjkvprC3YRXKz/ABFLS7R2KwsGDMp9PnsRUirJlEehPuZAJHout2NxqsFzf61dWhqJ re2tp5bqOQWrvHIk0U9nbhQ31keoCa1VaU41yB1IHQ/Z+tPCz7Tdf0rVX5WExlERYPW1SMjcrWj8 aglTQ9CNxtmLqu1sOCPFkuI91/czjiMuSWeZNE1bUNWs7mzuLiGCBFWVIrkWasRcRSnlCkM6yfBG wqWGxKftcl1/+irQ/wA4/wClP6mf5aaZa1a3d55eurOzd4rue3aKKSP0rV1ZlpVbhVnaMjs4RiPD JT9qNFEkGRsf0Sv5aazy7ZXdjayQ3ckkkrSySBpWS7bi8rso9R1hIAUii8fh6VNK4/6KNFw3xGj/ AET0r9a/lppdpPl/WYfPV3rEtzcvp06ssVu98XgWoSnGx9BY4jVW3EzU+na7S+0Gkz5BjhImUuWx 97GWCURZelXP+9EnzH/ERm6aGN/mDcwWnkfXbqe2+uQwWM8sltSE8giFuk6TRbUr8cbD/JbpirwH VvzJ0zRIl1ew024ESzvHomp2S6KAhjL200SyfoxzCrRRgRn4y8aruvxDFU6g/PPXWuZWtrbVLyyi Ns8sjz6esnBpWWMRRLp6tyu44+fGUpXlxj4lo+SqGm/PLzKkl0kttrUUETxW4ui9igWYW5eSsbaV 6wj4cp2bgzAKvwIG44qrXf57axBc3VryuGu7D/QruBb+xYD4SzX6cdLd5DHwb1V40QUJj+0FbV6f +WPmDX9et7rUL+K6SzlNIxdz2UvpXMU80NxbRraW9u3GIxCjyE8gRTvir0P/AKVX/PD/AI0xVgie Rbd9XOrtIr3TwwxKGFQghMzKy/5X+kuK4qhPMGlSR3W+qalbcY2JjsbBrlPhiAryFpcVYV5KvLdt qH7OKpNHAHljcaz5h4yNLOIjo0wXgpP7tj+jgyhfTPFeQdqjrVcVU1sXFy9u3mHzG7KHjYnRZAnL deQkXTApoTVSrU27jFUztdU06O0Ac6tMYBHG80ui6mJZGIb4iiWqVrwJYqgUVHSoGKp/Z6SbuATx O6IWdeM0MsL1Rih+CUI1KrsaUI3FQcVQ8XlO/mVWi1WW2CXTyMkSQlWVXYem3qRyHj32IPvTbFUT N5WvHit0XUHjaJlZ3VY6yKGJKPyRhxau/EA+BGKrtQ0CX6hc/vV/u/A9kIxVXXQJQoHqr+12PdaY qpXOjvEIw0q/vXSNeg34n+Zlr06Cp9sVQOkWi6lc3VxDIqopeEjlHJ8UUssbbwvKvVehPIftAHbF UzbQJSpHqr+z2PZaYqrW2jSRXsEpkUhJw1KHuwxVi/5iX9nba1Gs9zbwym3nmhjn1F7Lm0Bdj+7W ORWRUZmdz9mgPE0qNB2xiyynEwF7fzBPr5yjTkYSK3+9K7Ly/qDpDJZQ3Nxp0qRPFdHV7+V2Al9R SpMUgZeLsa+p8Qoh+HppjpM/LgH/ACojX/TT3dPNu4o9/wDsk3iPm3/dmmRxycDxC3EjBmCKQCTZ g05lxWnQA03oMI9iZOEjhmQf6H/V1n4w8vn+xLL+ZP0nEvmCx02G79OM2DXE6POayR8wqy2iMFW4 9MKVJ5NxOzUGSx9k58Uah4oF8hGQ+P8Ae9yDliedfj4I/V5dSi0uRr6ztzpRUrqD30xjgFsVIdm5 WrowptxagI75X/ImUT4xGYlzsQPP/lanxhVbfP8AYpaTLqDWMraPYWzKHm4pazD0PVEjg83jtfhZ m/vKKSGr1pvbm7Fy5B6+OVd8ZE8h35fLbkgZgOVfP9i7QX8vP5oug0enw+ZI2ZZVgaGS9aLhGWaa kUUqfEQCDXbia70GV2bo9Xi1OMET8Ec74gI7Hbh45DuY5JxMTytv86dZ1bTpNPTT7qa2EzTNJ6Dm NmKLFxHIFf5z3pnUa6chwgGr/Y8/2hkkDEA8N/sYf+WnnnzLcadq2o39zLDJBpk90tvqMhlSKSGd UUt9YltF+JT3kQb9cGmkfFMeLiFe/uXTSIzGIlxR4e+0zsvza1lomWd7EXUz8rV4l09VuFBQCONB rMxaR0rxPOn3UbYuyQdx+bXmRSf9zGkKSXH1YRWjShQzLU/7l+NEChm6bdq7Yqt0z8zfzF1D1Gtf q94IirtHbWtmzMnJkbiU1WYfaUgMdtu+KtP5+/OBFq9kzMaGi2NqoUV+IGupPU+H+YxVFab598/C 6a2v7eSKMs3C7jgtI4RQseRAuJ5PiAAHw9evXZV699an/wAF/W+X+kfo31edB9v0OVaUp1xVJtW1 ebT7SGWCMTTNJbxCLvxmmSJ26j7CuWxVjGp315rOnWWox3Vzp097arcNbwWutX0MaPApkQSWFxZo zio4NQNWvFeVcVQOjpp6yWwvb3XrlYIbhZhFY+bLbmWLOGBluZl5KrN9rk5NOJUhRiqZ3L+TEvJj J/ioy825mMeaGiryqeHp1j416cNqe2Ktw6h5MjhECr5pKqxcM8Hmd3qylPtsrPSh2FaA7jffFUz0 XTvLurQc7afWgLWRFZbu41azkBjqyK6TvCzjjJ8XIHmKc+VBirI9NVUtuCsxVZZFBYljQSMN2Ykn 5nFUQTsNziqjqB/0C53P903/ABA4q1qDMunXLJ6jMIpCqxhmckIaBQjRsW8KMD7jFUt06edvMurx utysKQWRjeSOYQEsJeXpO8zxMw25hIkI25F6jiqmSUGoT7n+6j/4lJiqIJ26nt+rFWwf3ke5/vF/ 4kMVeb/mnFc/pe2ntrSK4kVCnOSONnQtdK8bIzabqjbPHU7qq/aIqAy0ZtTDGakWyOMyFhK9E0tb yZL7VeFuA1tc2hjt7CaUNBy4hlm0qzkiLByW35KSQvHfMOXbGAGjfyJbhpJkXt8wzRtS0wujc2ot a/uI/wCmR/lrB/S/0pZfk5/0fmGP65bw3+qrcpDBPFEtuIXmitOacJ/Vm4h7K4YVCIf7zcgU9Mjm X+WsH9L/AEpR+Tn3x+YTDW5bO90C6sYQss80BjWOaGARkkUoxkgukp/rRP8ALE9taf8Apf6Up/Jz /o/MKHlNbXS9KW1uESGQM7cLeG2aP4pGfb0raxT9r/fQ9yeuP8taf+l/pSj8nP8Ao/MILy/pTQ+b Tfm3tkjdLhEljS0Ep9W5eYA+np9vKAVap/0g/F1Dn42sw9qYckxGN2fIsZ6WURZr5hm/mzy1oeuO q6qlRA1YZA5Qjkq8hX34jMvNhhMepwM2CGQepIo/LGh+V7W81rRYbm5uraBy9tb/AOlSTRijNEsJ aPmzcfhHIGuQxaaEDcWGHS48ZuPNjb+dfNL2qGbT7k3bLDIIh5Vvz6auhLcqXzJyjV1qFkqOLKAz EAZLkpfP5w81nSkvRot6hWF2u7c+WLj1eSTItFQ6moFY5lYDk32XNQRxCqIPmTzFFbo9xpV/L9Zg lktZ7bQLgqWBAgV401GWRCd3pJwBDAFkZWGKom1TzpdxxznRLn0H4/C1pZxyNWUktvrWy+kOPSvI 8hUfDiqY+WvLes319MddsXsrJIl9ON4YYnaY05FZYNS1AcdmPFo16j4jQ1Vej/U4f8O/U6H0Pqno 0rvw9Lj1+WKvOtTsNF1L8wNDtb4CWZbC4nihPIf3FzazK2xptLEh38PniqzWdXXy6yaHpVv5oWx0 iyWGJNK0+G5twiwxrCsc1zDK8sgrtxZgG5ep8I2VQOha55q1KeZY087IIYi7G+tNAtEJljZo+Bkj i5uPAVCtQPQVxVNJ/wDGX1u4eN/NPpxktFGn+GPTkHMAJHz/AHlKGvxkGg61xVWkh82CO4lFz5lZ 1jVI4U/w9VmEnAyR81VeRWPm3M8aPsOXwqqnehS6vAiQXi6ndF3ZWur46cGUKXo7CzaMcWAFKIT0 qAeWKptYsfRb4j/fS/8AJ1sVYX5tuyuoWY/SHmFf9Fkamn29Ih8VOcv7tKy9lTfx44qzTUGP1C5+ I/3Tf8QOKr7hyLaQ+pIlEc8415uPh6qtH5MOw4n5YqhreYnU7tPrN0/GOA+hJDwt0qH+KKX009Rn p8Y9RuNBstd1VZGP6Qn+I/3Uf/EpMVVyxp9o9v1Yqh2trhrm1cXs6rFcF5IgIeMquaCN6xlgqVqv Aq2wqTvVV55+aOl6fqXmW1truCO5EltKrxOwqIpLlYZnVTeWhX91M681jYivX9hwYgpSPTPLnk2D VLKwg0nR+MhS3aIWtq1x6ckU4PKQ3Dyt6ojp/duTxeoYElQYAptm48m+W4p7do9JgRolCRFYQCix qyoq0g2CrI4FOgY+OR8GPctsK836H5WHm5be4sbU3DW9oR6piV/Ta+Wqsj3dpIyl0Qp+44g1oXLF MkMcRsAtpp5t8g+Rl8uXt1LoVgLudAFnkgjR3nmYKo9RhZfG7tQf6QhJP2q4RABbR/5d2Ma+X1jV WASWfkiO7gOZ5C9Ss2pCvLr++O/ZfsjEy9m6bIeKeOEpd5iGQySHIpV5YvTJ58ktvrjSBIrw/Vzd GSnC9kSpi/SNx9mnGv1UU+zyj/ulcXZ2nxyEoY4RkOoiAUHJI8yivz6klQ6bwDNT6ywjFPiZUh4i hKrXegqR88p7Qq43y3/Q6ftKrhfLf9DGvybn1e1ub5kWS71CPTGkMAWMvLIs0R48PUhi5UJA/eUH 8x6mGjMfFPD9NfqYaIx8eXB9NfqZnqut/mlbylYdNW4jiZVeSKyhHqhoh8cavqycVWUNXka0KjsW O1dwlp8yfmeJ+MulStG9SClrbx8PUA9MOzas1TGT8fFd+1KYqjb7/HnoyLDq1ksvqkxu1pcECH9l Souh8fi1af5OKoB5/O6R0l1S1eTmCWjguEHp0FRxNy/xVrvXFUAb7zakymfVEaEfbWNJkcjiQQGM zAfHQ9Om3vir1n1JP8CeryPqfovlzqeXL6vWtfHFXmnmfUotO866PdzjjA1hPA0opUSTXFtFCD0O 7y0G/j7Yqkms60LqaPV1g803FjcQo8Nvp6uIWWW2iYALAVmU/CRUkcXLbj4TiqzTbpbtrVYvL/my MyRTsv1i7u4VUKzgrKZrxAJG5fAW33FD8Pwqo97K6F5I40PzIx5N+8GrH0zVuqodSFF704jbt2xV EaZaXdoy3UWja6sof+6udS+sfZjehKyX80ZU8yAK/aoSBTkFU0XWtaZUI0PUfiKBgWtRw5Fg3Ktw Pscfi41rUceW9FUz0trprcMVkQmZiUbqKyPUGhI+44qqv9Z4p9v7Pv4nFVPUPrP1C4+3/djx/wB9 nFV8ktzFbPLwlk9NZW9NAWduKVoo7k9sVQwvJ7i9uLMwXcZtBbSi4ZXSGQyo/wAKOD8ZTj8anpUY qvhinj1G5VTKQUB+Jnc7mTuxOKol/rPA/b/Y8f5TiqKsfX/SVty5cfrArWtPtLirHPzPikOtRSxW 4lkjt2Mcn1RbhldbyNhRzp2olaceQAYdK8duaFLFAl9JqUE0lkGdLvTyk7WCF1AiZmox0McQrOTy 5rQk/HD9khXqTqvqx/vI+/8Auu28P9fCrDPMlsW82iQW0cw+q2o9f6nDJ0vVbj6o0+7Hw/ap9Z2+ 1wT+9Cqbeby8fld5Yo47uSJraRLf6vFNyKTIw+CKDUZNqVqsDEdar9oKqX5f2yweX4oeCW3AuBF9 Vt7en719/TNtplK/8YBXxbqVUs8rwt/jFJxbCOOe3uJlkNkkB4z3LSoGk/RtqyuytV0a55A/aVzW QhXqGrabp19K0d9aw3SIwZEnjWQA8QKgMDkZQjLmLYThGXMWkOvaTY6XoWo32i2MdnqkNtKbS4sb GO4uVk4nj6UI9P1Hr0UsAT12wDFAbgD5MY4YRNgAfB57N5h/MwILd7vWvrEU0jSXi+W4XgaIXDD0 /TF00jcVgYqytvEwFGlePJtiL01PzNubWSZrzWri3kJmtZJNN0GCSS3ZWSNFR7mNklDSrKTLGuyc SgJIZVD2Pl785DeE3mt3rwLFzdW0fQVDkoKxxst65WVeWxZeHIb8l6qt/wCH/wA2Et5opr69uJSJ IoriPSdAQ/uwzrNxe+IPqMyoooPhU8lVmDhV6BoWgTJb8tVW2ujJWSOOSzhiniD0b0pWhkkhcxkl aoOlN2ILMqyj0Yv0L6PBfS+rcPToOPH06cadKUxV5L5l8u2mq6zZXDMY7uGOMJIK/wB3HcJclaAg /EYAOvzriqFXQGsLO1sDp+sagbS0S3+t2199Xjl4W0S8ljF1DxLUovwijAnavIqoO30ohyf8O+ZV +GQVk1jkN1OwH6Sb4j0U02NDUdcVX3GlF7tyfL/mVgzmsserlI9z1VBqK0X24j5Yqs/QqhnpoPmW gRXBGsv8RNKoP9yP2l5GtdtjQnaqrJNAhePT0h/R19ZLHXjHfTrczfExJ5SiW6J+l+lB7BVMNOjP pH92/wDft/ycf2xVUeM8U/dv9n/jY+2KqeoRn6hcfu3/ALsf8mz7YqtYzNbhTZXBEiS8grIrL8HT kGWjHsVP0jFVscBF7dN9Vul5Jbj1nl5QvRX2jj5twZf2zwXlUbtTZVUWM/pK4/dv/dj9cntirc7T Kj8bOaTiYwOJT4qoTUcivTpviqPsUI1K2PBh/pA3PT7S+2KsK/Oq30l9SEl8luzCylUGeSNPg+vQ t+3qGmjjzCn50+IbK6ljk/lryrFfSOtnAHsb+0MEpmFEkiFrHEHB1JC0gRv3fJRQV+BuX71V6noc 9zeaRpV280sj3FtHK0kbuUYvGGJUp9ZWhr+zK4/ym64VYP5ltdHm813Zu0ik1BbmzRJ5pVMyxxNZ yLEOd7BKB6kwdV9JFrvwcsPVCp9+Y8EDeRbkXoE1tW2ZorxqwErPGy8xNLp0Z+IDZp1r0+L7JKqf 5VW1pF5UhTTuMdrzlKLZOfQqZpCePpTaknXsJz8l6BVIPIljo8PmzSJLWOBZV0ONImjkRmEQK/Cg GoXZ4fZ6ROOn749MCvZdRu7W1lkkuZkgj5Ac5GCCvEbVYjBKQHM0xJA5sf8ANdzJqPlHW4tB1BE1 A2cy29zbGSZ4pGjPFlFqJJuX8vBS1egJ2wRnGXI2gSB5F4rr2g/mpPZz3Wl+Y9QhhvZ2rGyeYxLb +nJIYvRjit3mQSRN+8WWPjWnDbhSTJXh8vfm89xNcx+Z7uEIbaRbN4dceHkJWeBXea15yLw9OOYx 8NizS7ofUVQ83lL86Vlu2l8z3foF4oFtkbXnYRxQEtIk6Wf960YoWEZR5GPwh1VcVVLvRvzPN1dW 0HmfWQbc+hbTG21pfUs0T9+juLB4hOOH7qeIM7mv8ygKvT/yv0HzDYW13e6zrlxqs9yTDJDMt2ka y288ytPGt4eaerGyVWNVjBX4eS0OKvRP+lV/zw/40xV43oGq6xrFpaauLFpGZJkZbdXeOqSSIByH LegGKrdXh1afUd/L+sSrIoDT291PDCOUCA0RJoyKceIolQ1W2qSVUpOl6nBcKsflnzHKrgq036Tu yih6q1Ve7DVHWoX3G+KqsekahdXbGby95htgzOTK2pXqx7UpxSG6YgNX4QF7bgbYqjv8Oz8+X6N1 ivDhT6/qfGnDhXj6lOVP2utfi674qnH1nXP+rRcf8BJ/zRiqhbahrcasq6bLtKzUKSVB5sadPfFV x1HWyFH6Nk2FP7uTxJ8MVW3Goa1JbyI+nSKrLRm4SbAKRXpiqFu73W4LZTHo17dFAyCKF5FciQcS SZJIlNAa1LVHbFVO31fzC1/IzeXr+H1kQPNK3OEeiWVQsQmfiWB5Eqm4py3FAqjhqGtfWpJf0dJz dQGThJsPi36f5RxVe2pa4QR+jZP2f2JOwp4YqjtH1HWH1mxWXT3jja5Tm5RwAGcA7kdsVSD87b/R 7TUC1/JbRsLGRg06I5CC/hFfi0/UtuZX6afCT8aKWO3cvlOHWrhALCOaC6hWMejCGQpJYIgB/Rrk cfXAH7w05faHWJV6X5bltLvQNGuw8c4uLSGX1qr8fOJW5dbXrWv9zH/qL0wqwnXrvQI/N95FJLar OtzAGRkiLcj+jqAsbGck/Gn+727fEtP3IVPPzIuNJtvKaxXbW8cV0wUyTcXAMEEl3srRanGf959+ cOwqQeYUEq3+Vj6PceVIJLFreW15SiOSERohpNIDRUi0xevhAPm3UqpH5GvdAl826NHaTWz3T6FH JGkccat6JccSjLYWrcP8n1UH/FI64FTj8/jdBdPNsAZQLkxK9eBk4RcOVKbVzW6+rhfL+x1XaNcU OL6b3+xif5Tt5ijg1gWZeXXf0Ncm1VWhjdrgPH6VOSyQq3zVlHuN8hpOHxjw/TX6mvRGHjy4Ppr9 Sc2t3+e017Jb3GnX1vDJzVb2XUNHMaMoahCppvqcS3T4D2699q7hE3el/m5DMnpambqJG5SCW7s4 y+/2fg0o/DRe3E74qh5bT8y/35kuyOUVYlW7tjxl+JeFf0aNvi5cvFR8NKjFUpNn+ZYjcS6jJzdK VN1aN6bBgarTTY+VVWm/SvTuFXQ3PnS2WKC4jS8Usxlu5bwCUAuaUSK1iRvhoe3h7lV7byb/AAFy qeX6KrXvX6virBksrbRvKC2WjCWzX9J2bpHbSFXPq38DTCrNXg/Ng4r9kke2KoyKLV9esLfV47BU XUbYTGMa7qNuFaW2iCqqQQ8F+MMvJQONOYHJmAVQlv5Y8yKyc9NRFjjlRKeatbckvzI5A26gks9O Zqy9R9kDFV0/lnzKL+WaHTldWdmQv5r1tKgtWvoi3eNP9Vdh0xVDp5V8zKHiGmJ8ZVif8X69zqnK gDfVuYHxmorQ/dirL/LUeqw2UkGpWcdo8cjGMRX02oBhIfUJ9W4jhkADNQKRt0Hw0xVMbGnot/xm l/5OtiquaUGKqGoU+oXP/GJv+IHFV9w8kdtI8MXrTIjtHDyC82C1C8jsKnauKoIG5u9Tngu9PMdl Z/V57G+9ZT6szK4kX01oy+ltu2zctumKrdI0nTtKnubawiMMMhNw68mask8sssjVYsd3YmmKpmaU +79WKtinqR/8ZF/4kMVec/mddXK61DZwX72UlzAUTjcyQDk99FGGKRahpzt9unwqTvQNv6bqUhvv MM8dkmojVWSC8uLe5WFr2jGIqhMSSfpSODl8HKqNwK1+B6ksqy7ybqTapoGn3KTTScU9JpRcevyM agFvUikvwa+87t4nCqRa1qk0PmO7txfTrIt1AFT66yBVIsgytEb+3O5lFP3K9fsPzHrBUz88XVzZ 6FaSLeTWxZ3UO1xJCDSznalTcaZWnHlT1D0rQU9RCqp+X9zcXmgpObua5JeQeqtxJPWkrinMT6nW n/Gc08F+yFUm8o6vLc+Y9MtzfyT89ISZ4mvDMHqwo/p/pG7r1+36T1/38emBXqepWdndTOl1BHOi sCqyorgHiBUBgcEoCXMWxMQeaSa9psNlol/c6RbRWmpRwSfVLiG35yJIVopVYobhyflE/wDqt0yI xRG4AQIRHIMH0WH869SVLsatbpZTvIkq3CG2nhVmI/dQTaYrloTQI0jFZFFSBy+GbJFx+WvzoN2h k8yWbWSxQJIhghE0kgjaOeUEWzJFuwlVD6lWXjVVJxVDX/lv89zezzWWtaObYlltrWdF+ECVZEkk dbIlyyc4yg48Vp8TN8WKrYfLP56rbW6vquiPOr/v5JEDgqI4krxSzh5Vf1X4jiQeA5kBgyrO9A0S 6t9MSLWjBfX4JMtwsUaoa70RFjj4qOig8jTqzHfFWR+nH+hvT4j0/q/HhTanClKeGKvH77TP0l5j 0qNZPSmhR51kLOiiOC+sJ5VLAFfjWILTv+OKsk1HRdJEghtvLnl+5tYYWgtmupRG3pGCNFj4C0mC q/H02AY/AqnevFVUmtfLdhG5YeSPJ8IKypzjuQWJZWXh/wAcxfhevFt+hOx6YqqXPlyye+knXyT5 RmLSFxcy3NJmNa82/wBxj0bufiPzxVc3l+wL3IHk7ym5YLAlbgKZLdB8AkH6ObjxMUYCfEBTr8Iq qmGh236OvrJ4PL2habbiN4ZpdOvDyhV3LsEj+p26urFVJ3B5Hp3KrJ7C/svRb99H/fSftDvK3vir EPzK0Cx8wRaev1Szv/SnR/38AuVj48xzdfr2n8kHL7Px9/hNcVZbd3dkmlzJ6sQ4wlaIQq/YPRam g8BiqrPeWUltInKCbmjr6UjAI9V+y2zfCe+xxVDQSWUep3dz6FnD60cC/XY3BuJuAf4JRwWix8vg +NvtHZe6qsl/ZfpCf99H/dJ+0OzSe+Kq5v7Kn99H2/aHcfPFVH0dElvLRzDbPcW9wZLV+KF45ZDS R4z1VmDkMR1qcVeZfnRdWUWv2MfrpBqPpSSW4eOJuaJcBvtvp+psrCVY/TVePJyAKtxyrIZg7cvx 5hkKSqzska5s1mh0G6094USz0q+vLSGk8yu0Ci3/AEfDMjAhoUHMHgtSheoyviy934/0yaH4/sZZ Z2uvaeptbHy/olpaxs/1WG3v5I0ZeLEFkWALGSwSoHLYk1PGjHiy934/0yaDF/MM/wBR1m1/Slrp lvqepzRzyxrKswjjSe1t0EU36PlaTm6x19VlYGnFgqqUHHl7vx/ploJp5uk1+PQY9Qu7DSre100G 6nn+umVkAtzGSqvZXhNDK/2EDUA7MyYeLL3fj/TLQ/H9iv8Al76Q8uwrpUdjdWiF0aVZI4V9VZGE iosEFlGVV+QDCIcuvfIGefpEfj4rUUP5Wk8mxedIdNsL8T6xp9k9r9WW0to09KBwkjrPDBH0ccCs cnp1BHCqmlODLqzMCcICHeJEn5cP6UyEK2L125/3ok+Y/wCIjNi1JD51knj8o6xJDFbzulpMxgvG iW3kUIS6StN+6VGWoJf4R32xV5tp/wCZl3pNqYtJ0bQL2a5uJFBstc0+zjuZQIWLRREygO73Dlk5 fsk1JdeSqbz/AJr6+i27waNpUsc8QnZpNfs4vTjd2KFqJIpHoq0hKMw+B6E0HJVBXX5161BbfWP0 FpbxMkZjb/EemoPVYAsjs5VQvJZo1ZS1WjbYDfFVl/8AnfrtrZ2lyPLumutyGLSN5j0tIKrSqxSs 1ZGQni/wgKw25DfFXpPlrWJ9Y0S01KezNi9zGsnoGaC5WjAENHNbvJHIjVqrA7jsMVT7/pVf88P+ NMVeEeZnmGpae0TCrDh6alfVP+n2NSoYj4QD8ex2P3qo+2t5tb0601Wby5ot3Lf2qSyzTzEM5lto xQ1t5PhanA7n4Ap3+yFVCHyzIGXl5L8sxiNJI4ytySQG5fAP9CWiszkN8zsehVXS+WHF3JNF5L8t OzMzeu9yVlepryalk256nc4qojyqwVof8D+VgjFWaMXRoWWoUkfUOoDH78VZXo9u8GnpHLp9lYy8 naS2s5S8Ks7liVYrASWryb4BuT164qi9Op6R/dx/37ftH/fj/wCViqo9OKfu4/s/zHxP+ViqnqFP qFx+7j/ux+0f99n/ACsVVasISY4omcCTgrOVBPDYEgtT7sVUXWaSSWOe1tjaqIGhf1WdmcAluUZA C8CFKkMa+1N1VsMMMWo3KxQQxqUBIU0FSZKnZsVRL04H93H+x+0f5T/lYqirGn6StvgQf6QNwxJ+ 0v8AlYqxT83NQ1y21W2TSU1GSSRJEeKwgvplI9XnUtbXunxRkcOrksQaDbkDCUpXsEikLpVl5qhM dzf2WtX63CJOkdpdXNqYngTlHHKLjU51YuKKQo4s27mmU+PL+b9/6mXCE9fzD5h+t+n/AIY1rgnq cZvrFlxfipI4D1+fx0oOSjrvTD48q+n7/wBS0kmu67qkepgzJe6dJNDBJBY3F2iSuYZUZlRU1CCM mV7gQghKc1+NnUoDH8xL+b9/6k8I7021HU9Wm0W6jlstQ0eEJJG+qXVwiwQxpGW+subaeKVYjxp8 MiuO/EVORyaqcQSIGXkP20PtURHeivKouE03gt9JqhR3V7qCa5kXkJHqvKd7x6ofhIMm1Og6Zi/y lm/1DJ84f8Uz8OP84JdojFPOMsL6+l1cIkwk0f6zePMgaYyhnhlupYhwWRV/uB/klVogswa7LOYi cM4A9Tw0PlJjKAA5hM/zV816voMtkmmukbXTSGSRlDmkax0ADbft5brM8oUImrdZrdRLGYiPVjnk rzbfebbfWNL81QtLpUmmzy3dqI6T+mrKjoBalmYujmgQlulN8jps0zkMZG9mOmzzOQwkQaHRTk8o /ktaQLL+g9UlS5t2skWS116dlgikB4cGV2hCunJNlO1VzPdgo6hoX5Pu3p/4fvEX01T0YrHV44eE Dm4UNCsYib945NGU8m23O2Ko6+8yfl9cwrBd6Ab6JpPURLrR724HNh9r97bvTZvo6Yqp2XmDyPLd vZ2Plu1jmcReoH0ma3Ui3HKAs8kMa0j9P93U7ECnbFU8/wAa3VrGIoLO3jiX7KICqjvsAcVZx9ek /wAI/XuI9T9H+vw7V9HlT5Yq8d1TRjf3EN2t20LW7xgxFisZRLq3uXO3ci349Nwabb4qh9UuPJun ypYjTvL0kdtB6ERv7kRzemtpEeLqYJaAxij/ABH4Arb1oFUrhufKcU7K3l7yfDIFdCEvAXqyheBH 1Jdm9RVb2boehVU7nWPJBuGuRo3kx1kkYx3Ut8qvIwNS1fqTfFvvRj88VTC0XQL6Mz2flrytc20s QiaeK5Mgb01FIjxsiCiuir12ABp+zirLdPk8s6bD6On2tnZQ/wC+rdPSXqT0TiOpOKorTtW04xH4 o/8Aehh1bvI9O+Kr31jTQsfxRbrtu/8AMffFVmoatp31C4+KP+7Hdu8Zp3xVCtfaWLZGa1sOEcc4 bm7BUHpmqglPskH4um3Y4q3Dq2jDUr5ljsUl9O09WaKQm4cFJCgmUKpVV39P4zWrbDuqiV1bTv0n cjlH/dju3YyV74q64u9CkR/Vit35mIvyBNSEIUmp7DpiqZabqVjJqtpGjR82ueIoWrUMvicVS/8A MDy1fatq8U1ta2twkW5e4kgQq6yMtF9W3nP93K5rUdAB9okFKG8seS/qFwL+9aMXYaSsaizdSr1I rLFHaSbcqfRvXFWTtawmRCI1KivIgim//PfFWP8AmLyxNqGq2t1Bb2zxwRqrNI1uHBFzDL8Ilhu3 +zGfsyLvTatHRVH67o317y9d2EMMLXE8BjVJWiCFiKUYy/W0p/rQuP8AJxVQ8paFc6bpYt9QjiNx ydndHhdWLyM9eUCafGSeVTSEb9z1xVAaR5Uvrbzpca5LbWkcM6SgyRSWrSglgqfZtI5yDHErHlct RjxowCtirJfPfku28zSwiW5e2ktGYo6qGBEipyBBI/kGYup0wy1vVOJqdKMtWapIdJ8pWfkCO98w /XHuba1tJBcW4iRSYgVchWaRETdB8TEKB1IG+QwaQ45cXFbDBo/DlxXZKQwf85K+Rr55Y4tO1cTo hZYPq0bu7ckRECxSyMpkaQKvIAV79MzHNTrTvzS8jarp0d+Lq6tYZZ2t1E9ncD4xOtuvxKjJR3de PxV61oVcKqgm/M/8qpoTMPMiLCRVZDb3AVqReswQmMcmRPtKu6khTRiBiqEsvzC/KXVLkW1v5qiR 2UvzuIZraIAU+1LOscanfoWriqeaZo3lbXvW/Q/mG11L0OPr/U5Ibj0+dePP03bjy4mlfDFWffUV /wAL/UOZ4/UfQ9Sm9PR4Vpiryu107Ub7klqivz9QKpkjViUA5UVmDELzWpp3xVJdfsdVtb9on1TS 7EonFoLuWD1FaK1SRg1bqL7Cn1G+H7BHT7WKoFlvDctCmuaN6rSSW8UHrW5k9aMLySgvAWZCfjUC u46dwqhBFrLx/Wf8RaDJZoA8siNCF4FygPP6+ygFkZQfEHwxVFWF1ZlIre413SLm+dzHWG+s4w78 qBVjNxKeXxAU5HfFU70zQNT1Wyjv9MWK9spq+lc288EkbcSVajK5BowIPvhVGab5Q8xCOptOlxX+ 8i6LI4P7WKrpPJvmQpEBZ7qpB/eRdeTH+b3xVbqHlDzF9QuP9E/3Wh/vIv2YiD+1irVx5R8wpp8v O1jULHOWM0kXpAGKg5/F9nx9sVQMfljWRq9/EYbISlLFQsc0IuyTHKAJgX+yaH0vH4sVRcHlfW59 SupIYFlTgRySWFhU+oKbPiqJl8n+YjGwFpufS/3ZF+yhB/a8cVTDR/LOt2+uWVxNbcYY7vm7c4zR SVoaBq4qzDWNU0zS7a61DUpY7e0tyzz3EpVURS/EFmanfYYVY6/5p/lukccj67YrHMhliZpogGQM y1FT/MjD5g4qmMGs6f5i0aebyzqls0rfBBexrHdJHLRXo8astfhYEqWBocVQNlpH5gRyzNea5ZTR MS0SJp3playKwWv1h/hCKy9CfirU0xVbo/mCKwhmttc1WLUrtJSEuILRoFCBFBUqDICeYY1B6Gna uY0tXjBq2k6iAPNNT5n8ui2W5a4RYmYoCykHkN6EEZGWtxjr8gS5OCByi48vk1p/mby7qg46ddxX BeP1I2jIYFWBKsCNqEDbDDWQlIR3BPeCPvbJaeYF7EeRBSr80fO975W9CS0hika4MjSNMGKqsKIT QKybnn44NTnlAxEauTrNVqJQMRGrkerHfKX5kv5p0/VV1qmn6bDps19Nd2LSxTxRxcfUo0Ukjh1D V+A1qO+Rw55nIYSrbuY4NRM5DCdWB0Siz86flKfq99F5/wBXuBaxSQpDJc3Q5KXUKZIPRUuyhuCM yktXfkwqMxzl7+fPyn0y2D3fmPWL5qus1295q+7utGLLbiOGM8ZRxCIoGxUA74qhpfP/AOUEIaT9 M6wYyoAI1TXiqgMPjDczQNzA5Voeg74q235r/lTDLBeC71GtlCrxcrzWPT4SgqHZGqkjt6hqzAse 52xVN/L35zeVJpf0fo8V5dyRqiv6738xQcSU9SW5ibjyA6s3xe5xV6r9e/51X6/w/wCPH1/Tr/xT z41p+NMVeQ6r5T0q8vdCn1PzFZabJpF5Nfpatc25WeNTbyuSGlUH0xb7mh41rtscVZhf+bbZ70RW PmzQIA8slvDbzmKaUzJGi+lVb6Hk6TNyZQoPEhdj8RVQUnnzSzcAx+efLKQc6tGXt2f0+IHEP+kA OXIE8uPQgU2qVU0tNdlM/rT+Y9GmsYl9edIljjb0H9Xg/qteyKq/Y+PhQ8W/m+BVMLbzX5ZuvTNr q9hP6r+lEY7u2flJw9XgvGQ1Pp/HT+Xfpirdr5q8t3YjNpqtjcLMjyQmG6tpA6RELIyFXPIIxAan TFVKDzT5at0tkm1jT0a+kd7IG8tR6wZyw9L958ezj7OKtjzn5SMhiXW9NMqSeg0YvbUsJeQX0yvq V5cmA49anFULqnnryVFFcWs3mHSobgqyGKS/s0YNQrQgy1G+KohvOflVoZfR13TA8cYcubu1ZUEk TTRu4Eq/CY0MnUVUE1pvirUXmXTJU+vx65pcmlStClvIksBBYsY2X1hcFGLyFVSiihqPirsqh086 +VILq9e68w6UTboPX43dqhjCSOhDqZnIo7Bfnt1xVG3PnDyrbWkV5c6zp8FpOFMFzLeWqRuGUsvB 2kCtUCopiqY6VfWmqwRXumXEN9ZtIKXNtLFNEeLAmjxswNMVSPzT510Ly/fi21N+DXSyPGPVgjJS MuZGHqyxNRAKsV6dcpy6gQNEH4AlkI28mj8rWEs8X1bzHGklpbSQtbMbqQq0jSqkjgamd6bV68lq COgwZ9qxifoyf6X9rMYT3h6L5e8xeWrLRrPTYr36z9ShWC5mWYM7SNGrFubTSSAsGDCr1AI3wHte I/gyf6X9qfBPeEPpWqeXE1BdUh16/vYOUpFs94slsZNoq0D7+mqMvCvHkSxXnQhPa8Rzx5P9L+1f BPeGFa1pmia1fel+k4EuSGuI0gniE3ps3D1B9p125R81p9o0Ncwo66cL9E6v+a4kdLkBO8fmmFz5 TsdY0WPSgR9Uty/+j2vpmPg8JhVDQckAUmnAqffMHJ2qMMhKQon+dt3cnYaLT1Axmet7b9OqO8j+ SBoGsR3Eby8CrxekUQRhGFUUHjzCoeXBeVByIG3EC/Tds48+eEBXPv35FyJY4xhKibpl35j+SH80 tAqXCQNbFwyyLyV1lRKg0/1M3+p05yUQaIdDqtMctEGiEg8t/l0nlVb2a9u4jpVxZS2NzHAJIGSK YqCYmj+JW+Gg40PhleDTThPiJtr0+kljmZGXFYSLSfOX5HTTSJpnmDU7m4mQhrcza1PI4ACHhE/J mZVP7ArSp6A0znPQo8x/kldXUlkfNV/b3MDO0wubzWLQq4IV1YytCOQb9nt2AGKpv/jj8rbVLezb Xoo0blBBNcxXLB/RjSUk3EyEPVJUYOz/AB12JOKtaj5n/L+C0tb2fWolivlMtoRa3Lu8ax+q0nBI 2cKqfEzEUXvTFUfoGjad5ksZL3Rr7naxyvbu0trcWx9SP7Y4TpExoTQkClajqDir0j6i3+E/qHIc vqHoc6bV9HhWmKvIvMH5d/ljCy2C6RoBs+HrLb3XmfULIGS3ThJJ6KRSoxSKnOWvL+bxxVF+WrH8 vtAuIUstI8lW15LcNbOx1w3M6tEsUTJE89k0hk4n44wV3oSSXJxVFSa/+WhjtXFr5ANzayRmFW1W 14wqI0DPE/1KodGjVVAUVVVNV+yFUTHb+VP0W8cXlvyP6YjE9zbi/hFuI5CT6hYad9hvq8R5FKGh /kFVVe01Dy/dzadcW+k+S5ZhcSIk0WpxyNG0yCaT6uw0+rSSIWdh8NRQ132VU9Ml8r3DpcW2g+SX l1ATtcy2uoxSmWDmgndXXTl9b4ifUBoKhanfZVWu7ryfBZ6ekGleTGnnuBLptvNqEEMTCIBIJrdh ZSFpFjEY+FPh6BqAVVUFu/IsupRJNpXkg+gv1AyLqNvJcRAr6b2yRmxXbnJ6fDmKhum/HFULqN9+ WtpqdzN+i/IKX8cokhmuNStYbgyVJd5P9Bdo3WUdi1dzUEUxVXjk/LuaC6uJ9I8jNezQvLf8b62d HaQfWYfVlNkGZJUjMzOy7ceQDdQqr2a+TjAmu2+h+SkvJvVKahDfQOjXUr+nGouVsVZvVZyHbqDt Rq4qsn8yeVYo5rZ7XyULfTyxaJtWiAiS3ZVti0f1E8D66hSP91mnHkdsVdqd55QXT7J7vSfJQ0lr VVt5bnU4o4Q5X1UghrYcHhLwoagjYcuHwgYqzzypdaRceX7I6Q1j9SjiWNY9LmW4s42VRyjhlRYw yqdgeK/IYq8w/OH/ABDJerb6TFE6ywSNI8n6VVlMcxf4X0xSd1DDjyVmJFK/ZMJ44y5gFIJSTSdb 87QX9lpwtdPOnfpCa1lMmn6q831RWj4H6xNCyeoeTVlkb0ztQmjZHwIfzR8k8RejvFbesn+jQ7g1 +K13p4/Bh8GH80fJbLz/APMKPWRqxOnQoIilqPhGrPvW55b6UoiH7Hv/AD/7rweBD+aPkvEUt8wT Xf1adIGozypGaM9RG8qpJxNuBIrBCeLCnE7mgBzVxhHj/Z+vZ1oyHi5lU8lz6k2kOb2hl9RKEGdd vq0BP+9g9T7Zbp9Px8sxO0IRsV93/EvR9lG4y67+TXli41p/zMhJJ/RshmADDU60WNkP2gLJf3ke 38ymq9atl6OGMcP87/M/6SXUCXq7v87/AKRe73P+9EnzH/ERm5dYkXnOeG38paxPNcyWccdpMzXc MkkMkVENHWWKOd04nfkI2p14npirxSTV9CjkZ/8AFetyRwNO0sFxq2sW3pLHDNcJG/DTBLR0PINK 3KiUQvxKlVCab5h0kC9RvNepPcRWsz0/TetTBYDa1NyS+lKooyq8bhSv7wla0jXFVkvnfT5zP63n K5lure1uSgt9bviHUn0WLJbaLHGTEvOVGVS37RqlGVVPLDzz5Vs9HgS516bULqeBJ7QS6zrXpJC8 6xl5b2CyidayJ8TSp8DVj+FTir1nyldLcW96fq9xbyLdOrrO186sFCqjxNfRQHiyKKiJeHKtC1SS qyj/AKVX/PD/AI0xV41c+R9OujPp9peaEbSArKLVZtDIaRI5IWmliOgyiNzNCYyQT+1SnHhiqYeT rPyBYCa5jj8o3bW0ay3F/Fd6aZLdfQjBq1rp1moR2WRizU8RseKKrv0h5UW+tLa70XyDFcxE/UIv 0tCZRMlIYxCraahX95CsdV3HHYErTFVJ9Q8iwaegOi/l9Fp92X9ANqtusE3F09Xj/uN4NQxx1pX4 gK9Biqbwax5Fu7uKTTrTyddTo1z+ipF1CD1WmMayTBeNo5QsXYylCxC0Y15UCqWzav5MtYpryLSv IMdxOQt7K2rQIGW7jWVecg04l/W4s1GHxKobfoFUaZtDiiEVxoXkmA2LPctD+ko+MDW0EfoyiunJ wKBkVmoOCcSK1AxVD3Go+RJWgkttM8iXNxyOn2Zk1O3UmP40NvGy2Ehr6ciViUftkdKFlVZbXydc avFNYeXfJFzcXUnq2V0L2D6zPOYvXVkCWDkszHlVXYhfj36YqmcvkrnPfufIPlV/rHL960/x3BMq v+//ANxZpWnM7v8AEB/rBVXtPJyR3SagfI/lmDUmkDTXMUtZB6jOJnEv6OR2bgVO9ORZgSKVZVFW egXkkEUF95U0CCCL7EMM7TonomM2/ANYQgUYHt8PFaVr8KqPTyV5VutOtYdR8u6WGihSNrRIIpoY qFHMUbNFFyjDxrT4FrxB4jFU4sbGysLOGysYEtrO3QRwW8ShERF2Cqo2AGKvEfzxS3fW7FZpbWMN FIim5t9KnKkzirKdSuLdhUfAQisCD48cUsXksrIWkFyt1ZLerbi9N4bPQyTPNZ3LtcrW4CrI7wLI zByjcFoeAkYKvbW+u+rF8j/y1eGFXlX5ntHLrVws9xbRNGtjGyzQaVOQa3DqzHUriGah5/CCBQiq cuT0CobzMHNvIGZU/wBKt92UMKi5Tak7KlT0BryB3WrUGaiNcfz/ABtu6yP1/Nf5CSRdFk4SpLWW MkokcdD9TtxRhaM8e4FRv0IA+AKTh9pVYvz/AB6npuyL4Ze/zQ3k6GIfmRpz/WoPV5agWhEOnhnp NPQK6SG6BTm3IgGv7fFywzP0p5bHp1l3e6vxsw1A57jr0j3++30FduiTyF2Cio3Jp+yM2luuY159 uVXyRrkkVxbx8LSXlLcR/WIFHHf1YljuC6U+0PTbbtjdrb59OrLfw29zqfnPy1f29vErTvf6LHIg lYetMtopsYGchFhjZFYt8RJCNxGKoo+bfLUekWi6trWi3mrpxnguYEgcK1ywklkRE8vTGCTnD9g8 m+M8zXhiqI/xD5ZtrWGKC/0y2mZ7VLaztRC8komjW6iYxf4bkbZ3EicYqB5HFVIC4q6TX/IVtJbz W11ZNfaUlu4jW0SIWcscpMrBovLjvGfWXo1N3Y8UIXFXtf5fazb6rojSprT6zdRycbwyGEvby8FJ gIitdPYcf+LIVeta+AVZl/0qv+eH/GmKvPb3zYkM9vDd+eNOsIjC7JL+ltMEk6uiCKcpLpvH7fqE cGC/CNmBKqqgH88aoz2xj836AumQTxpcXo16xaaZCW48lOlGJWkCMSikdCFYUrirIdI89P8AoYzz 6poN1MYZ7mKf9MxtEwjkfmDLHZwKIYQY1aQRkipDVIqyrcn5gX8i3xs5fLMoswsjM2vMAkDxtIJZ +Nk3p/CoYDcEVPIU3VXt+Zem/UYrlNT8uMeJNyTra+ihCLXjKLc8h6ksS1KrswPWilVdc+d9Xgu2 tXHlxJ5i36Oik111kn4MC1U+o1WkZ5Hjzp8t8VQsH5k3hSGe4n8qx2lykz286eYmcSCBCzlOVggZ U29Qg/CN/bFVb/lYF7D6n16Ty1bD05vQ/wBz7HlNbgmVG5WMfFY+Lc2FStN1xVMdK8za3qsbNpsW i3xt7hbe++q6rJKIaKDKCUs2/eoxIEbcajcla0CrJ8VdirsVdirsVeQfmvaTz6pG0UupxlISR+jr q7txX62v2hbWV9yPGvXtX4aVZVLD3stSmudKiabXBbxCzSR1v9Rjc+opDiXjpC+pyC/G0jqVNN4u W6r0zRZJG0rS2mQtMbaMyNM8PqlvTWpk9SC3flXryiQ1/ZXphVhHnqzup9XuWim1eFOdm1NOvLuK L4UmBCLa6bdx0YsPU4uexbjQBgqVeYuZQiP1FJuoqmBqNQTAkExxSniafFsARsSBvmpiPUfx+kOs H1H8fpRPlCP09MlHO4nBmXi9437ygtoB0liiIrSrUB+Mt0aoGF2hzH6Af0F6Tsc+iXLn5ftd5Qim /wAdWRebUOEb3hWN5JzbkyST/bBtI42AUDgDLRQF41B5PlaQ+ofT06C+X9Yn7GWoBo/V8zX+5/Sy L8/XuQunrAfjIuSindS4SLhUVWvXxGX6+rhfL+x5ftEi4X9N7/Yxf8nbnzBbjVpY4/W1iPSLiaG2 CiblMsiGJGQNbo778TRlBNaEDIaQx8U8P01+pr0Rj48uD6a/UzW91v8AM+K1R7fSw0ymaOVVsIRy CN+5ZA2rJxWjVAJJNDXgaA7V3CJRvzFms4ppb3T7Sd4+UkD2cxZXZForeneuoKty5cXYHse+KoG9 H5gmWQpqunrDsYka0uWZaEH4m+tqD9AGKpdczefxEQNXs/V4qA4trgKHqSx4/WjsRsBX39sVS6O7 88RzcrrVrd4iQXWCG4iY/wA3xNcyb+9MVewepJ/gT1eR9T9F8udTy5fV61r44qrz+cfKNvPJBPrm nwzwsY5YpLqFXR1NGVlLVBB2IOC0cQU/8ceSv+pg03/pMg/5rxsI4h3u/wAceSv+pg03/pMg/wCa 8bC8Q70fpus6PqiO+mX1vfJGQsjW0qTBSdwGKFqYUg2p67rtholkLy+YrCXEdRx6kFv2ivZcjOYi LLbjxmZoMV0r83tB1Lzfb+Vo9P1GC+ujMIZ7iFI4SbcSepuZOezQOn2ftAjxyuOcGVUXJnoZxxnJ caH6f7WdZc4TsVdirsVdirsVdirsVeE/nikba9pvqXFtCvpyAi4ttJnJ/fbEHUri2ZaNT+7De+9M UsHW3h/xBoP+5PT+QXTSsX1Hy9zfjShRheeqle3oq3H/AHXXFXtHlRblfLehKjpIgsYAskavGjD0 V3VLVpLdQewiYoP2SRTCrzz8yYFfX731r62t5C9ieEttpMrDjDcfabUZ4pm5CtOQBG/Cql6BUL5s VjEod0T/AE2A1dUcE+sNgLhkWp7EHkP2QTmqx1xn4/jZ1sPqP4+5E+RRx0iZYJFkgE6elxWJaL9U t+IP1RmjNRvWg67DhxJwe0qsX+P9M9L2RfDL3+aF8mQyx/mRYy/WYeEz3yemtvYI7lJrlmUSpMbg 8OQ5UQ77vRi4GfpTy2PTrLu91fjZrzjnuOvSP67ey+dtQ8p2fD/ESRSRu/8Ao6SRGU8gi8ioAanU VzM1E8YA43T6ieOIHiJJpMnlHWI7y38oSQabrawP6F8lrV4eXweqEcIr8Sw2Jp45DBLDI+gbtenn hkfRV+6kLe+S/wA0XYeh+YskKCtRLpFhIxHNiNwI9+BVenUE96DLcxefKXnl5kNz57Kw1LTJb6ZZ RsSzg8UaUThUWMELUM3I8izCi4qmNt5cW3m53Hme9u0pT0Z49MC18axWcT/8NiqlN5fsGMZPmW5Q JF6TAR6Yeb8Svqtysz8dTy+Gi1H2abYqmj/4O/b+p/TwxVkH+if4d/Y+p/VPbh6Xpfdx44q8GvPL PlGbzPfajqVzZSwvrF0L6wezla5P+5V0krODx4ejVqgVpt1+LMaZhe5+0tQx3vQ+XmitP0X8o7pL WZ7CG3lCvNdQT2rohWZJfRj4LJIeULJHyUTb8jVqdI8WPv8AtP62QgP5v2JmLf8AK+GKKI3M8Jih tY/9FFyYkkheP13RT6m0qy8KfFxVCV3yBhgPOmwGQ72T/lTHpiav5m/Rro9sz2TD0xJwVvQPJQZS zsF6VP4Zk4RED08mG9m1f81vJd15pt7S2GoiKC3P1mHTJ4JGtZ7tHEUKzXMHGWJH+sGNwDWh5L9h qnLj4xTl6XUnDLiA6V+P7GDeU/y31LSPOVtf+bPNem2OvwqqaRDp7QJLItwJrf0/SnhiRggYJBxj PEfuwOKIMrx4KNnm5Gp13FEwgKie/wDHz7+fN6t+Yf6UHkvVH0uaS3vY41lWeFxHIiRyK8rKx8I1 b59N8yHXL9H0eO31X67a6pd3lq0U0EkElw9xbrNFJHG/2y5Dq8binLYlh4BW0yiRzSvWNe83w6xq MGnz6Oba2CfV7S6W8S4IeHd2kjV1bjOyUSNG5BuPJWpUEgKASyTSH11kf9Lx2qSVLR/VHkdQC7UQ mRE5cY+HxinIk/CtPiKG/W1dLi59SCBrUSwLZOkknqNG/FZjKgiYKUPIpRiG/a4bnDsjdLLnzJqE F47Cykn01Lh7d2itr03I4LGCyxmHg6Bi7eor0ZQAnJtskIo4kq89T+ZpbfQRo80Kawkq6hNoKXht pryO0CyTQwyP6JkSpETCSML+8Vn40oUEAHa+5RG5CzQ69f1fjuSr8odQ1m+mur3Udatr2O7srE22 nx6hHqMi/Vovq81wrQyPEiyTo6yceXKQN8Xw1bEwwyRJ4j3d7ue0tVpskYjDHhIlMk8MY7SNgbXf DyG+w9+xP+btncz6nFLDPqkRghduGmXN1bq5+sqKSC2sdQLGhPvSvw0qy5DqWL3Nnd29tFMtxr0k 6W9lJEgvNQYGVYplPqcNJkJp9tw8fxuFEiLWjKs68nSznQbBLhZZJIBJD6l7IpuHWMlVaRri0spG YqPtNFv1q32iqxfz1a3c2rXPoyatErPZkfULy8hiXgkxbgLTTbuOjV/eAOeR48uJC8lUm8ziVoX9 H1BKLmNkEMhj5ESg8XeGKdgh6P8ABSnWg3zUx+o/j9LrY/Ufx+lE+SRMujMs3rOwmABuZGd+It4Q prPBbvVgOTfCfjLb1qBhdocx+gfqL0fZB9Evf5fta8lx3H+ONLmeTUAs0E0zQvLcvbhp/UlKMj2c SD068U5SI4AA4+OXpj6gPTz7hf8Auz9yc4PCT6vma/3I+9lP5++X9S1m1tIbK3aYfv45HWJpwhkW IqSikfyGhr1zL1ZMZRkBdW87rDKMoTA4qtjv5T+WNWsdT1uCZJrJ9Vs7yO2upIZ4lSad0ZeTo0b8 l3oyuh4qoBBFcr0+QmYuPD6a+5jpsspTFxMQI193kya5/L3zoSrnzHGZIowkQVtZCVqeRkU6o3qE 8/tNv08M2LsUJffl35qljt4v041IY2R2EusBmZlHxVXUgxo/85O222KoG88iecJLhXl1f90HLiJD qqklgq0JXUACPgFF4067bnFVO3/L6+UM17dahcyB6wtBc6jEvAEmjq9zNyNTv29sVREPl28s4Wih gu5VZmk5TGadqt1AaQsae2KvVPTk/wACelxPqfovjwoeXL6vSlPHFUBdflpo9wb0G+vo4b+WWeeB JYwnKd2kcLWMsByc98iYgseFa35ZaU00czajftLEKIxkhNB4f3XtjwheFuL8tdMi5cNT1EBpDMw9 WIguTyJNYt98eFeFNPLflPTtAa6e1lnnlvChnkuHDt+6UqoFFXscIFJApdr9lrEsf1jR/q41NOEM DXhme2EMksbXDPBG8SySCOM+lUghtuSqzYUpRHYeZ7u8XUGsUspY4o54rCe5mMTuPrirBJLBcPGr 0miaX/RZEHRWm4o0SrLx0xVQtLCxs/W+qW0Vt9Zla4uPSRU9SZ6c5H4gcnam7Hc4AKZzySlXESaF D3dyvhYOxV2KuxVQnsLG4uLa4uLeKa4s2aS0mkRWeF3Qxs0bEEoWRipI7EjFVZESNFRFCIgCqqig AGwAAxVg3nDyLaeY7nndLsqyRENawThkZmYD9/DOKB+MgA25KtaioxVKbb8qNORYI7wDUYYUjiaC 6sbThJHEJVjRhFbRUVBP8ITjTiKdX5qWR6f5di06BLfT7WOxtoyzJb20M0UfJzVjxRlAJO523wqk evflnba3eTXd1IyyTmEuPqVrP/vOrqnxXNvO5/vK/ExpT4eILAhUs1b8r9VvpCBMnpLOk8ZaOQtW Nw61V45VG46jcdiDmB+WmJEivx8HD8CQJIpF6Z+XOoWFrIqSqZp5jNMBFIi14JGPiRULGkY3YV7V oBmPquz55KNix+O4u27P1AwxIl17v7VHy/8AlW2k6zZam0gdrC3+rxqtrEpICFFPJYI2TZjsjBd/ s5fgwZRK5VXkZH79mWXNjMfTd+6P6Ho9yH+sOeDkEihCsR9kdwM2DhJV5g0ubVdEvtNjJgku4XiS aW2FyiMw2Z4JVKSKD1VuuKsA0j8lGt7mdNTvLO+0iRhJFYReXtNtmV0kqjNJ6Mqv+7LRn92DQ1BU 4qnUH5SeVYYpIhZoySXCXPE6XpYC+marGAtioKhSygtVwGNGrviqGT8mfL6O0yySC7MqzR3Y0rRR KjKSaqw03uSDUgnYUI3qqiNR/KnStQs47a4uJ24uZZpG03SZGml4hFklEmnunJUHEFVXbbFWV6Rp iaXplrp0CyNDaxrFG3opFVVFB8EEcMS/JEA9sVTbi36L48Ty9CnGhrXh0p1rir//2Q== xmp.iid:0551a1dc-e389-4445-bfb5-78c779c42819 xmp.did:0551a1dc-e389-4445-bfb5-78c779c42819 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf uuid:a0a24fd9-61b8-4727-995f-0e5a0c701d9a xmp.did:9f44965b-72d4-4744-80c8-a226b7ce95a2 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:aa13a443-605f-ff4d-bafa-b0acc03520de 2018-08-09T11:47:20-03:00 Adobe Illustrator CC 22.1 (Windows) / saved xmp.iid:0551a1dc-e389-4445-bfb5-78c779c42819 2018-09-17T10:38:22-03:00 Adobe Illustrator CC 22.1 (Windows) / EmbedByReference M:\Assessoria de Comunicacao\Criação - Peças e vídeos\Tabela de Emolumentos Cédulas Rurais\Logos\Logo Oficial Serjus Anoreg.jpg adobe:docid:photoshop:b0127b9b-6d8f-11dc-a3c4-84cd823a3a53 uuid:e0bc02b9-f037-11dc-9157-9c6332b66f3d EmbedByReference M:\Assessoria de Comunicacao\Criação - Peças e vídeos\Tabela de Emolumentos Cédulas Rurais\Logos\Logo_Comissao.png 0 0 M:\Assessoria de Comunicacao\Criação - Peças e vídeos\Tabela de Emolumentos Cédulas Rurais\Logos\Logo Oficial Serjus Anoreg.jpg adobe:docid:photoshop:b0127b9b-6d8f-11dc-a3c4-84cd823a3a53 uuid:e0bc02b9-f037-11dc-9157-9c6332b66f3d M:\Assessoria de Comunicacao\Criação - Peças e vídeos\Tabela de Emolumentos Cédulas Rurais\Logos\Logo_Comissao.png 0 0 Print Adobe PDF library 15.00 }ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw $}ICC_PROFILE{od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B}ICC_PROFILE3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQ}ICC_PROFILEDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKl}ICC_PROFILELnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 }ICC_PROFILE E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ }ICC_PROFILE K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:}ICC_PROFILE 7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_ki}ICC_PROFILE kvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht}ICC_PROFILE ! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: }ICC_PROFILEuGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhw}ICC_PROFILEgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=}ICC_PROFILEN=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dh}ICC_PROFILEjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<}ICC_PROFILE|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~}ICC_PROFILE !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$[xŅN˻jxdԐeHV ebͺU̸Wcr75P[7ȘAQMmZ 5RTt!\8FjI8g;tf!ߖߧ iE}]Oa%%-AZyrTK5jQ$*2Pȏ2;>̨jDi1CG} uy)yI22=F.h=qW2F1-eW)z 1SR2%p1S1^..OǓfztihgT9L;޼}=Ҷ! FSmw ըAs ˌR@n=[śuܪqu=ޮnnkn?056۔"Abk(<2BHpOԒqMϪwsC-OTjWe^KJZJ4 Tjԣ1r8IGTdǑdv%}Qe2ԈcȎ/JSo2j%%I3Jddz]svˬ#,{=&OtW$qu)3Wޥ,XЙtVie록;alܳ%-: Mgh *~ZU"R#N.T٭S8 NJډŠZ.}ۓ%4pW =[śuܪr[u?[uX{r*ňL:^h-]pIS!fKO-.$6~TRvE WFj"d)1i\4ʯl{է$ٌNiKI+jm n۞aT[C{/X%Hnmdd%Ȥiץ 7uˬ7W\}EO,?T͗YucU/[q^ʹ6,e؈rUeV.ßm'u >$yZn*tw>jlәw/ԺB=nBJIfCOO@K'+X <5 tl tP'y&Yqd4[OƒyQj%D>i}X{nsqdc JؠPv>^յ%Mp0o?3$ZZ^{i#lwi==ҽhp +R:@}?lsْ7}uROgr)RXpܟpYLzhn.Z)Mؾqx&Y9wݱN]|s۵$MB"CQTٗ\r_mPe /౹̿C!['m U@~036ڿoۀ?w7[LU֭|;vg;ot$FZ lTSN$j .ܓ֋m$MJnaػVƮzqyǍ96ՓqFHhKU.oYUA$(V5j %z0O* ȑC>YQ^jDi1[2#eiqy%ƞiĒ)*"2=@g/v!y\a:ێۖ^dȶuBw%ǒ j#Dװ@==r8M]`yLe2ZY KjW%qN'S4*=@{=H;z;rFގdĢu~ДhFj2z4v*t)M*[ata1h%3LVͧ ۗ-E^C>-ڽ(4θhwe^Fr[Uh fUb"U> \Z /y ;?Ou83{(ೱD'Q~p?s_ ?Gn>!V|A7޲niY;u "3.,ڈYwSlM|[ɹ1ivmaDfiX~?^~>e۰]:oX266"6-Xj/}+q̆RSjO)Zy9%l#!?ul'֗"r#׶oMEBێ'*uѕ JJP=PBv앗ML Bfk&N[{~QvG=)JW S͛mrQ*M(hkӭ&np4BRmxdkβ:w_w-jԫڅVsωT}&&κvQe,}n@RrjqDU%5 Qy7]mSP|V kS#mw?ۆ ܥm 쌟DRczIP&Jr&;2#I  w?"c}Z_z06!rdG>|WoO?_*?(Po9sQ$uVۡ.W-h5hnkL[,JCf֛|٩kb1IHb &@}az%pt@:&m^>.swgf=x 굥ȥgSQPvʝtezR.8T бݻ%eSk!C(qPfɀ+;uSVߪ]9OJb+U:fmܹJJ3Z$ZahI&sԯl|^ΫZz*6U3uIz >]imstK[%1گAQ58IMC^Ml%1j6)բ>,ucz^ q%~'K}棰Lzqd%=Q6 nKr=>: Dk=edB8oįZw]\֭D=AѤͥU>&aYv ?دUXDlSVJܒvA|-;~-έQұ,j9CskLt9ʵz˘PT\5SI>ժjϯ\Uz~Tu:j.UsNdο2dZũG셩%hR(*BdiRTFF$R2#+ԣ9wղ Pwo'/nnxZ"w)Ygr6[웒jrn71ˣןS2(S^mJJ"4?^.G]r0?ϟP_-[x{޲pׅ~rT;^ԤLI)ILy ̐joks>wq!su2KvSu:if8vu *91 ƭ85p厯d)XUg5ˮJ"vYո7Va.%mmb%ԂԴlr6YJ{:b{/#33T*E&ᵤ K'+X <VZv:\SvRtV2~&˔X'v[i} F1+^M-,>L/Շ]on7Hr=|QXFw;o-:يN*;ILU)CDX ݗXܿ_uq!~?ۇaz6*_h ?`i›m_7Qm S.-lq 6z{q,[CGQH/iK?$kWɣ? rv_ZU~njug/6rIUZcRk8~*fUu%k 2k:#ڨZҢm7~?TkQy$aLD`?qbޖսxڵXu^n[nNwOk#(X/6F)VI #\B~Wd_ SҎug]k{auK>v`Хr5ꔴ%UZCDKJuIyD[QROŵbw`۪m!CRaC4[e~! !reasB> -,{?p lwE ǿG:&m^?8?y7QX,Lw8aLk d*n8M)lKV2e8ԓ##2fn# ]gF-^ a? u萹2}W>`+ `@( d d.۞e|ivPo좾qmTըXnh'EB %6uBҤ(~+:6Uw%lC1?Ϙf[~njd6=&B{<u宕PeR`2]a?XAlwE?6|uZJkZIB5)JR)IgDU/_]M6w*XZ|RI+<#KC))jQ@๮kkwup.ˮM\w=V^n NC5j"UJTJuN!\ujR QwQSa֦e W ɻf2̬% &dNTq)R5YC@l3~nű=]lڕLmʺ"SixaFbΨuR%P&Fupߓ $83(Jհ=]bȣpTI { tWc)m)ieԹUlq&CT*8쩳uN:S8RHi@~ 4]e`0*e?)j>@|Vk=U~)+ ]T Fj$ҮUI7ԙ-njT%Ei<ɳ+W>ղB ֗y{`!"+Sn2VhV!IOT1K'+X <u]bؾeZ*&߷Zfjy)w:rZx͈]UjIIMڜVb 7N08>bgp] >@yް_ ??Sm-y)i[;l}ؽXS52QCͺYeFW`~wdڣs9M2O5pV6TmKYK+jΏ.sU)IKC)424 'xJ`U00@+_kԮV-ܪ@[SEPkT-MV(zk:c(y 8Yu RJ"0~P^-f;[ѳoKKnvշb%s -,{?p lwE ǿG:&m^?8?y7QX>-7.چݫ>۾_*7k=1X(J:Uow1a2۶r\9<+ƪ[v2⒦Ԟ%FX^FZ8o?Е \ro|~T_o ^.Cnڶwmj۔̍ݬڽ6JUjbqF6Jjm8=@OT;fW2uÎSy Ȫ9 Ok)*nLzUnvҨ4(&lI mctcy_o[7*{ݩ5ūۗ9.5lU jR͎z`@?m m'E`P?zc_恜>j?` :?}ag m~E~ <CoXO+oj]lزίFſV=—uKW Lɶ:ˇb~to.ZJkY_)ʍ,:MmSjEed}My](Lы@~<CoXO~F$._̟h|Cmp'P ݏcuXoZZj.:ܕ ޘ"s^E Ae\VeVyHyI54`&JҩNZVj&lj*Jne>LCqz;֟:w9DخdWTr&xRTܘP+(iOӦ)HQ; Lؒ@60p3ܾo UR$"=F kW.*r]}tkث~NԥEQ(`x{[E>+[YtڻL*eAuz9M6i5Ortm0ZUjuNZ֪*ՊZdVUreBSLqs強^yխ\YFj30탊U*ͩ.` QB8puFJT$:FDZ Omѧ3yg|?k e]Ჯx].եwFhvD~LNoTSzf ?opRܦt&%KƩiʧATV-PV)UD;"󐝕df uJm@ʞ/_)qT=V^Sۯ*z7짷_PTYzoOn̩@~ew-y$; sݖܔZUV\I[-0-hBj3$]-gV'xoO`{ZFR̻Ϡd,ߌ ޷]x>f겪U8nGnJy5 &HQhDʞ/_)qT=V^Sۯ*z7짷_PTYzoOn=]SX ۦ.zY7`溥S5컎u\v^?gS\) [R1i.L_RRm?*ާ'jXܫv;]y]M{-(_r((#6ݚג4ʶ]>Vmm/s[kiܶt&%ʀ]ۑm=NYו-;>Pjld~Z5 |v\7ehυ(֡m&Qk& őx> PQ˭o+uuRk[(qrcte-`ţ*U"TN==|!K#$ .}c!m;}|rShR)X0t2T#32ͩdl̈T.v6%0oF).!Tw=1HxS8 覗T E װ@%Ywt֝aU. 0ݭgy9d fnɓe8v h-6T-!nP`;0^7Wg,_0DpZɖzȺK_p)+ely%ą)= 1 [^SWMbȘޖ=oT*ݳtujn)fuF+n̍&iDi3#ُQ> 'I"Ǧ--˖8́O="-|SG87ojȋ#=ao?gc߇N{Qom_=BǵlaY5CZ(*m6dv*O} 'ЪrRHA}2{uUeOUʞ/_)qT=V^Sۯ*z7짷_PTYzoOn>p/a C2P7}> ]~u)verU6IIIR[\#ŌR 6$d_v=ȟ8E^_ϔ-{V*X5Ry"fa̦GbyW4ݐ} )$Io*z7짷_PTYzoOn̩@?See=*2{uUeOU 8 Z+ [c{SP, biѦW%SitĚu%rg;W ͟dC̙qLX-q*NoۦD%IڶG ]6xR>?"c}Z_z0 lVJWdT"Q/`UTc1UJM "ȓ3Pf$ͥ#SkN0+?See=*2{uUeOUʞ/_)qT=V^Sۯ*z7짷_PuhlΪ..xsE͔fZpɯTnP&ǔb׎[8 y+[VF=^_m?|@~?1':is*`fUslʴQ"42mr\XRIs(SkhCmFukp/_dW@7=k}JX ۀ =x qճO ~刺U{w@._:G7(ŷ:b]çs-R]+$ԘWOi5ۭ&%DVއW'\WVm|#rcw*`Bjҽ83rɲr ٶi4<.{u8mHY+b~=@mR>׀zpnӶ۝71Ć wNCGWEAVoSګ-B;TM-T@? ,,ٔFdȕW+X.{]SrvqToujhDJ ,M?a9diݳ&p9!:z eF2 u%%J:2҆֓ ۬ođOT Mۚ45ʃ"hc/BM/O &e"BK*KD\mi2R2=HՅvv Ő|h_0M~U"4P[$ŧ{vs46nFKnp$D@ ?^uc ?W Cmp,ʓ-NUzLYYYM*Ptba2 l4+ 7䢌nGh?"/S>m3[4E}͚m"%*[ЪS4UI3|@wɚfV׿"jH[ݖj#5GaF(Wr3U=2%Rl\q2QZLA>K7{{WFp!)RR\6S*)Ff:"3#FddfJ#3N3,SVOȟ\fԬ˂ q\PLtCTYH4-FyhRTL?t),1NtSRs&9=ġJrsНXtڛd|FmJI?(OL?X`>`~ w@qM'۳Q!j+r].r6Z֝Q $}!1 M>}>Ϫv^U'3v.)[*{hV!,lN6tꄞ`Wc6& 8!q|}N D(5\rzfSZΟ0~lq-*:*kH๖hR{o?gc߇N}>HwdvLೱD'Q~p>$;2VW;}b^~p)?o  A;߅#Ln[œ(3W0 uHNGJYy5Ω:eΚ$p$@,7f/5X2MUjec\ܨp.+\+J@~]~67)`[C9#'#Ի"o?Cxj -DmɎ d<򌷈:7vQjR2h63}4CS4|Q?A0:W#y0h4sp XwSv1vՑK^öbpڸ.z8i)R^3_ hu[36*xjq,c59(ŵ'E'U-5f~?y}d/@{~ ~\ً+.ȓ&Cb%5*IFM6d[20ڶߨMJvU=ٲmzzmא/:,ehQr\|҈Z1؛lU}a nGuaҧfLWْ"^k}eC&ChRcA9%R`-;òtcj[Յ{P6g]tUnS֩dBSuHqD]GLʘN r<\8TXbUZ.6;mrTyoʧJ|.T QA"RdG*$%cHeHy 2a<7hqvZr=fp*b–$q,>@~'rs}e\*{**n(KX>2ڗujfmpԵn(<ӉƟǍ5AénV_Tvunn U.F)&5󑮘%M9ԍi>Lы@~<CoXO)/6ޟ~U~P2Kl 3,̫ EdPq*jϊfLU(uxrF Hz3[.VOX&*4/N/r-=pruɛQŹj+wTY M>dJHuPˉ0JH7 .}cq6;gh"P d萶 (_?%pu2$Grf,X"L㰅:,MJR?YgXlΐj&Z"۵FŖ Ըg4Hk  Y+b~=@mR>׀z7xcfUQdbޱZ:U jRzJm9RJC4,ɀ~gq6r+ո7gKeDxZҤ̏%#&˨m$ȒymIM>hT%qm%TMFEJzg&Vnԥ(RJRPIl> @~?Et{?Pǵ;o}ںMiP4 -jmKd%ɀݸ2]a?XACevK_̖^+1SK# 6IQ8*E*҇TӕOY8P ߶|p[m/ߓ,gn#KPݵtVjK=4'Nyn6xqušR?u`ޙϹvlUTqm3E28õvu"u٪tҒ@Jݣ;l>Kmʅ{twbd*[SΟ=oJM(Cntp>=?,Wi)=eV㨔Ewh%FRcxl:;"%6VMZS, rUEŭ&%?TzեP۽Uz~l!LOy)e83 W#F ) p^ g|?wN}+yX{-4{d^f_6u}?I7`Tӌg6eƤGtKCB]UCZ䝷ߕFҹW1$M] rU4*MGxOa \qXM{yg\kׯSMT(QWUiQ72R(Ȗ=~C'uWۦEOWe^qnF{ZTVt^V-RTfd`6(~':!钲0 ǿG}Y_ {[/0i߽zE6p#DI\dd-c"wwۺתKhۈtOj?` :?}ag m~E~ <CoXO21[LOnYji]7.3+OIJ"JRI`>/iuqqm<˨Snj48ӭmI2##- 0@?)}߀ʹSv>ܳu_JZLR񴕒c[zCx.=HZnzwgiUERsbXq-TQfHSK}ҳmFGHQBSJ-kQ!A(ȒJQEfS6u1uBU_E+(լV˰'&Jj4(F R&?OhŠ?K@u'WAOj?n@|WoO?_*?(PmgbVv\፡ʭ_*XJRbjTCq+-ϭ֚EzuP0Fq'?x,,qз?RY95)O#݉yv&nϓnmٓNyHK n^z$?\^jCM>í^eiqq$in!DiQ@"az%pt@:&m^>P,a|PGdzG!oHFU;s:~ױu H:fSi[ꔌAJ1hɆڒ̹x}'XTݠ2;޽w@>1wNۚ^UK[psqȬ-d0Me= tO,e״ܯ.G#r%bd*\4U,YA))kn`W 3 dJY_v4(Q˲ȯOHt=*R. EdJsnC^Y.ţn#>üJddԶI7mv$<}l !|@-Xʕ%L!-ʕ,qBH鷍EufRX=qM33mKAj(}MZUՋfSv߸^6 ֣V,& dJT҂[QdCQnj-ݸitCDQkZFgҫzARPd6y iiZi23 +WQ`z}}KN3SXn.E9Sn6UdgcIq?[f}N8&INp շn.i4UR~ڵr9m& 4ϒMRk"lm=mmZ̈x3mEIێDQ"zܛQpI9)Z%%H4;vwohԾ_=f*TQcN/ BU2]&gV=:tyDZMfڥYT{W}nILjiJi%lXwjӄK'+X <~Hol_)`>Y9$=b?+76M&Evoz6ٵm\KMMmtI?JsO!5F'=Y*:=U$IK42\E݇4IȫH[Ȍ;"z~?(OL?X`>`~ w@4Uj~:o̱DǙ[1h•Q,s))(KG~i5 6R5!$@~ߒkΦlAnN۳TRD9{Y­,zc2ʰb֝@>|A~[Y"?8@O++S~`> -,{?p LX?W }B(WX ݘv=ȩ=' -ǛuQ_2lRKRX~O >%yHڇ[.,DwqAmCk5uݓG9M9R-}55 J5p~ )u"ڢ.;Au nQ}iE*#U)]4l-\QPA8wSV7?ʫjemF'm#3ܐZ-wIӵJ.4'{4nwrRj@̙lM[r.:F'!ݹ*& >-[\@53TXgN# s<3y2}}S|H5 ң4@~?y}d/@{~êM屭S9+p,Us`cli=I"Jv6Fdfe 2;&?5fкS:Wf+FG Rv@~:%"ڢ~At%NaiE*#0)1$l!IPA?+jOZsyޥ7ݶ|bq$ٮKvINcZUyjqdn-kX|C~3.DGwfFѭi2(|.S%.3|Ɣ=Pp~?m m'E`P?zc_恜>j?` :?}ag m~E~ <CoXO ce0ژ[{P9$Ԣum2^AMEgFt_ىls#e[bf-Ƃ/4;6@Gifhv">iFfdf*5boUUTGAyQjMMφ ̨rCT$euvnʑ}mv3>' $D1)9 @M{^*c$I-xpeMN۫s)۬n;)@oF]{6Ű%*5D[v(Qe}'POPZq}jOXwbXor ɫ4Zz1i#J¤C l +~j#r>t =DKgב\-+_7T+4&?OhŠ?K@u'WAOj?n@|WoO?_*?(Pl3"7v[޴*GwҦL}F%S镦&nCz;GmlFO!VGuKzwXcP#i[{r]oE]pĹSe㮹*2!k7ܐ`'vuV}^ӎ3U:C) :NSW&:%J 7hRA>S@}az%pt@:&m^>P,a|PGdz[&өԄQm{ʖFf*14%PJһ#232zhzH ojZieh]r)L뫳RȊ##ONOIjqԻ ?qmQhMF}H0U"l[ 6M(BHU~VxX'9oRmn >sX8Wl%;M$'1MDZ <5e7>U{!?FzvwR»T #Uhִƙ pzaBUcJGm@?fwm:֥f)jݮB:D5^x^sB-&fQj29E[>V}!7R.LvvlUz&198&MK5D\S.LՀ)N,U5j*W͝lhT1NI'mڥ!ʝNy6Wd튢<H^ K$Mu~nujbڲ1SKeF'"/W* 㦜U&^_adtjsfTS%T*5 R'O:CΛ-տ*dOʒ[-JZ֣333*ɒ27iV6b6LFV)8> x֤g[f̗e. i̎Il3*,]&4yByu*m^mF%DiRL@ZX&3)W.xSҤ{5yy)]P--:JYtQտݩQʮCXlbLnMaܕt/)NUe3Ԉ=gK'+X <I{E3jmBǴ콣2귌*qިY*ñL!4且 uسq_@1 ap%:T*3^dmFLx_I[,&W54%)&<9X7Snm,4Za&9TA-[hC;̓J,5"" &xXו}vdlvIޫ]mSqE>nТOfM-|Zi}J$.k֋D˫^Xg&>LTd.ZLNmd7h[єZ*R*T! -JP!$! "JRhD]@;e'Wn<k`X慂!.`Y͓FV;~&jaP*oT ym0jpH/uسq_@VMf*?֛bU=[7`śܪzZo=7TӲ+r[.и7@j"n+R7:Ȏ2A-kQ$Uyް_ ??Sm-yo,E[1uNǷkXMr',@1܎RHaEYmvGzHԝ@FFa ɛR2.!Am/g]Rq>= *66OP>b\ Àr dfc}bMjVQ4"tX5:-~]7.e+~r|bzcƜkiWEqԭzU6ɪRI@1 _~Y92ŬJ|ww[w՝_⚛C*X +nU2OeFFKA6m[_xR,3q-KeJv_~崟#:ϹJ].J9hf,^ g|?wN}g;6]Ҵ2-sXU;T'6߮B:eAjiQy.>%X]gpMZkh[uF>ߩL6T\'ѩ@Y@?Hȋܨm zxmZ;o@3̋iҗũA_'2\"Lko?gc߇NoW/X^hܽ/uvBe]~]*:e`VPa6[JYt}=[7`śܪzZo=7TnX={n+ri{,WPպ}`YʠuQ7V.v,5l7dzU~ոJE>lߐGz5!O6P - ]AEo?gc߇NoW/X^hܽ/uvBe]~]*:e`VPa6[JYt}=[7`śܪzZo=7TnX={n+ri{,WPպ}`YʠuQ7V.v,5l7dzU~ոJE>lߐGz5!O6P - ]AE[/0R#~Y]|0^źO锧<xV {2*eVXlmNBQh$ᑭ@ λ+oB"vY7%Q .q[u8%R*JIHԡ4 ˉ26-mnf5':b[:~o\jS%vڎ+$Uu6\j/$`@>|)xC=@VLțU;k#Mf=%35̥!,qWF&KFӨ~B`+[+;ZڦLw-bo(U"WfNS G~d[iJ"6:Y[ݮO6n|R\FAhHFI2~8l_M,?+#+a` ߀?+s(˿r!g6p%[A+a6I6}O֞7丸cxfHm[}{&]iΤ̠ܷUFDp̗le $lޝtJGo8= /M#\ԶьMyԶmW0zVQh᠌f@G ?F"ʑ]q8'9;_nMӭvH64< J/"dzޤ M_d( yCoW`u?k3MP_z0 M(m U@~0>?!%?ۏ_[p۞zS5/ 05,ΐHPaDir%L*Bb4X6Ԕ! 33" _ZNdﯬuh;.W*Q-chNȋ-b_$Ʈʌ44nߍKqM K™qE.5:sZK7V J.J]OgP?6|=MrKzKi\Sfd@nX={n+ri{,WPպ}`Yʠuسq_@VMf*g}X7Yvo׃1Ow8ocLzԬ̡ʩnjNXN8H%]gF-ջ:Yvw +QcoAݫ^YU-1=BI52x# ^jVFNŗurǾmZd[ߜ>օ.׼-r(Z)n+B+H~՛ ަ$ڎ!݆-ln&o?%vN>нq >ׯZ5^Л5-\i /_dW@7B< 7~X=~LWQ׀~@?&2i}Ǚs 4ʼnVsJgMv_y5y..$>g}XG^:fd:Fɗr=s3(7-QptGQ%\3%BE )w]Q|=~[#b=g`g|5-c/q^u-jZ8h##Y~q2~lшW\bN4@zs[WlψTb;|錡.*ujY@j:BDhSjR!hQhYT$̔$ȍ*IGF tEGh]vjt ׫( \Qz*DJ2s C} R{5Ew/,QMn<$+s. KMg*}]4JRRSA'6swⱂ3) Tt"UFuI-.]Z7\jq~_勒* ޯo#x> ?-zeڿWUIJΟ, ڣ;m&ji\֢z I-Iψ[ErwpnE2fUI]~ގB3k)I>@~os71[ԳF֫P**5zUԮ(,𙠣[!].HȠj(9tj)j En_~A2]Rl,LӋ2ViRD\I"|LXOV>@y&'o5o5㋫, u굅gؒ]u)#Ey)ɒF0&czLd_7+5Br.ߘͧ%z%pjeVs"#El1[0u>v'ky+8l Ze S|u@f*CfTQ|*#0/౹̿C17ޯ~ߵh 6*_h ?`i›m_7Qm̗Y|xfU2m=㒯^hO|sO5)I354]K\Gֈf|pb$hmvɕcp}d =Tz:[G\oMޥʷmIJBn% ivZ-50mK7 E>=M'QɕR_&n\$iV#l>b~?dfݕuF+ŠJęEN.:"֧MS]G h;*M$q,>~P+~T|",Ԁo?cyc{~*؍FfҭDa4#Ih=R}$πw4U=H7NNlmSs1wAI'VX"I&2"5+Po?gc߇N}^F\.?@̿n؄v ǿG\恙~ݱo?Ÿc+> ~=J_4 K7k[1+m~v%曷l2$e/^֭Sy%*M{SjR i?:`o)?f9e AN\[E|XўpbLN>[*tJJP}ߊ8jP},y-e}᝜Uڷ6t_Pq(mۤ\.љJrܘp:̔%)Z0BVyۄjW%UJx qHׄ ޲Gb0 MˎQr.)Ze#htD>Gl6ۈ깋Z"Ґ<<+"}~C N{᫺4\CmHhp{O58mQ?hВBFdH~@>U,N؏_fE7,a['lDDJD&Fp^QJ[]N6yv0xȑ3rzTV-"L$?@Gl6ۈ깋Z"Ґ<<+"}~C N{᫺4\CmHhp{O58mQ?hВBFdH~@>U,N؏_fE7,a['lDDJD&Fp^QJ[]N6yv0xȑ3rzTV-"L$?@w!NwR­dIVuT/ɖu!w@Zj6S330hKH=*T4vZ[em*qםqD$jRPOVV"lw`[Oڻ1ُSĸvہyij-K:n_ / /lYޑ^VoSVh S6gQ#6ВD|N_W`igMG k@%T ^xIi 3RH?u\CGd@ Qdf,oZ%!R͢=ܨ)pp:mt%Y"&%)Dy&y[FުtuI]-P[UFtQaáM2Kp!lJL ^?钽'L!HYw\lr =ջJng+5 1!٣ "Q@6;^)9+(l{tyȑ|﯅H.Y6d~':{p2b/y ;?Ou6qev ?S }B(\)?0M,^)=7}'3{ikyMɔG]e44lo8R>FҼ~*4ZBW*VΗLg0i܋6%.ǕKJm(HZL  =}#gm uAL_Fk$eiNVS1Q-~CI2~ -;1zdޫfcN."ѭN2_YcөPyffDIA37;xN议n2[[kvDW%kSKqi[ףF0`elլO[ns՟>C.j9^pxșM_)nfe%^*TSZm-)ed`9%l#!_\XRV[))rEq 2(BВR<m#-SSoPRI}M\ƒ∍(S#25'P|WĸndIAiiɲQN\hZ2JQ4ק TdhǑ㸒z,-Li -1@R/2M*J/6?6`0 ^߀ G_y[@i5@0m U@~036ڿoۀ?w@u'WAOXn?ly|x0ݚ:3 Cv>u. MLDMvTxfL*@ԜkDju(J:#G"$%}貢ԈcdG/jK<Ӊ%%I2RTDdz7~^T9InEÒ1]">EKdilXy^;l6b+jB_ \2.2wݻlت6,Yo&CGy/0&*8SR1yk*^=횵JΛڙrDTQM MꍷOӪ;[R\-[X~>.swgȘ{3?/yް_ oǿm?/6ޟ~U~P>?"c}ZCv6RkNխܮBRzUjXKCj6SHaԩZqIQ/sO˓U-&v8䔫D53[ub&R$\ pu~RokUOvPiiӫs^fd~kUzG\O(>>K~dK'+X <uzM?Ƚp|Y'$-hu{xB Jq=WKt%%.R(!&ZeQ625\JRQ>!Dt徰؊}C1 C]/ɫ1ܘ\Q ufF7S̉1z~0\H-I.W: {[6ΕѴܹ-D H3"V?d{ߢ] r˚Sj)O+0Uisȿ|.4HY+7vp-0fb1*DFMs$ 3tڎBF(R$ :6VMO#m,rrBM)x6->k˓*V7.GR`2]a?XA΢ɴY-gG!UJdQ (j)VuF:di i>ԅUEMD\ =eOU\V7IZTUr A9)*d#R% 4:~DϿ*>/kgLEOAH7TfC~Cnۜ(d>J::7ՃYB7=ojȶs:.K(mʤ԰n4jI+VpYkfkTٹ( TpP1SW(X:Vbi iZJ"0Z\d4sT)xpX(*.rRCpiyF Bleڛ,QeKwk쿂2OfVٽmwRؼ-5nT BFR'vG=DD|>O7´%Dd@p5ǯ_\zٝA5ǯ_\zٝA5ǯ_+R Ucjt{>٥TcsY谢LcǣɐʓԅiLCx a? W [pO7fn~CޭiEq-T<։r,i鬨zzKP?cΕClb$ZƞƘ1*ivs+u-M"q'?T׼ww 8l3v4mϧ[B>e2Ը]RB܈Q$̈~}_ˢǻ)Q2Z-"GlRJM"NJG: F+C2I`-PgMMR̕OG|ělGPY0ߍ*3m%hZHy;ַR̨r+?Uh(j7+Se$G![JTnZȸTF`?(OL?X`>`~ w@NKO/xKL K7UtZi6>S =2KRPDZtί!W֗+r^u.tVfKJ[m*9fD@ HXM׸2;{ѩ3L~p)?o  sԥ_@i4)fK[V|]"Xs*k h`ڍŕ*Udz{jm کv^.Ԉ@*5boUUTGAyQjMMφ ̨rCT$euvnʑ}mv3>' $D1)9 @M{^*c$I_ڷUF*idMܔ[}f˫5"5QQc' s>daY>MlodҤWo]?!VM.>o `c{!%*WVtOD@}~E~Ob.%*5 S$&=8lH,Bn3K͠\Hp l?N@zڐx6mLnX,*HmJiMWnBҤB4J8:{+?cT+(9/^7e&j:NU,$N݇ܯ2[<H^0:5h&F a? W [p6*_h ?`w/|~Y̗zmr9Mu Ǖt t-\)Jִj}~Dw-x6*_h ?`kWoڲh=Թ k[ڇ 5ۂHە);n--q-iI{3gg@q#?fvy3gg@q#?fvy3gg@6?g_Ww|~쿸6.7~oJq;?'[ Ue;TkQ=ȉ/pp4iIz TB`b#2]^G^=s)*]kA7T1ɥmd ow$6J_p.IOȯ[]cd>Q=Sjd:ǹGMUSyiy#+M24zWqRW"oۭBrmeUmM)HWThF@?1GXe|Շlx#%e`1 %ۭGIJ]D\75?"\Zkvs_{?Zr:ѱ{jUJe5Qɇ=LV"ʬ]Yf59ϕnu [pmA*ᶦP^q5.s(A${X񸻇]_Ɨ&u!7>%$h3le;YŏT? n'c2P@6_g[ܖ'&Aؚ^n>T(w5sǎ.O[~DeIRWZ$8vcq `bg7t۾O!S2E&#ޮX2}z.Q̂t08F},xT@X?g6{~)_k=ZF@yz6R}?ǹ_L/ Ckg%cEo^v5JZnDBO2HySi 6KCi7GUVoL @Va;΋-)rjұ>OM_&3&FH~J\x-{p@xO7gZۯ[V:^fݽxuPJDo|գ֚i,:e1e@k쿂2xoXGun@u'WAOj?n@~MyOƧN[ͭz~FΦȍ<љ `G02Q[ iӨ| "yXS{ڧٕf1%9o[W1S,*q/5K6Ĥ6VخZ ^L>@~P+~T|",Ԁo>m*{06O&YKxۭfVRl.4RƑ%Qq&d˂!)*J&xuv'm]N;*ܷ?gKt+Y2\TIq3 XW " dK$I(Bl|A~[Y"?8@O++S~`> -,{?p LX?W }B(\)?0M,>6?,fevAnTѴV&֚iqs, pFƫiq6Ҕөtzu_a  7p7o&zrSd7)p<^E]ܜm U@~0>?!%?ۏ_~6Yp>"*iN2PݚXmiZQy1m߃rO¹U匯JbNb\U^Dw=VHԔk@=Mԯin@LG'__O,چ:v%GhJVqgTVd#0ROj=OLw>]OT7uZy aM!'_0K? z߭ݕmS&V;Ljs*P3XRcɿ2|- KYv@~[ڭd.NmE60%:D]\uu!+R]S-$|)\$$m?˜]G&?OhŠ?K@u'WAOj?n@|WoO?_*?(Pg1>]gF-^G_(k J V-,FоZsa۸\Ri2!5 6oVӷ"³e|uJ5Sq7Cmu53ȨʳMb]RtEHa1Y mdKqA%$jWefQ~^c/e(?I k0>`b#2]^G^=?, `uXR4^^z=JM%vX7% IIs܇kK52I&P!eZQfhV2x~1ƦEs"ժϨjkλUVH:y(~π?6_]vUڭl ;td4WVMBsz&֩C*mә3%Q^ADn ='pq vlfʲ&q4fjD6wDh=y5ҥ~@-ӵong_ͿyZ%>E&n5:hʦVux)J|t88ˠ|u~Hf{ EjU&VwԖ#6ш2BE"s0OT]UƐw]3U>E/k}NME M}VK»i˓oVR. %r3Ԧ^e@ONw`M=%3}Z9F\{g-Ī/=1D.6Z$,k0q?l_gDyCoWz[˻%Xnٖ_.낢3O[&]rX5J5z^.f}ĦNrl>nkdّ`R#5DŽ=56Gg6{| ]Ń2˨g b; ! nd{^Z2>_T,|a>G̯D38R¸mڼc>RTYyҬ^?^uc ?W Cmp,ˌhGous߉dVw-h=BW.-YYPiDSkԀV[7YWhْ6o)c0f}.$,n_/:~?w'V _z0 M(tVʶ]ݦ+b{L r])G,>n2%S R&-ukϑK!ՙ~]*. tUe+K*uYξᖳ0X:w{=ڮtVFdz/蘫1HY2֖=V)HQ uV.JxTo쑀0^ g|?wN}Gn @]wMfn[pw r|j]A~W*s\f:Kq4HRd3PZj޶ -,{?p LX?W_v=ȟ8JgoT>!V|Azh?&뻭ڻ Ys%183. }klZu#Ԣy$dmDde$cd;ߔ(3.yQ^2S̮N.*[""7 U4?ۀ{K^*F6XeK&8Q$T:>1dT@JWmD9ҭ}Jj57%^1NZѢ\cYIZi/Ȟd=zrNr7&H6-{NʃQ.4HQ?F`6?6`0 ^߀ G_c`ؓ)bfE8dQfno-$DumeL? uDSfI>#DY\yQ"3"qRU}$L?[ocjs6 +|Np(n}.&VxB7 v=ATfnj`3-3ukc ܎⭢*Qm.V>Zu҄/Y&ڋi,JBI@}uq[{ab"=YRkG*8w^YF4OGqC*ZqImǝmɵ6*_h ?`w/~Uߕ߳3۟Yׇ50^KeQ|a1NN(RbTwǏܗq9jFf+*JVۭR.* OQq˕Nҥ:>3sC=:[{L';`;RJߥoS|j۴E!QҢ&\IJR4d/0;5kwmFpRUSǛ\TN2US˦CQW'1(~;r䧀Зx@|\fZ80g1>]gF-^ a? W [pz TBî2.!^ijm֝mDi-YDdde:i=d]XC5ή3S̖}& \%2ZciiջZv9&uiPc>j2>EƒI4ώ{aDԧ〈 ߏFm0.>S!ݑUiEAAy~2;FK36׳(.+65¨+q]WEDu4BOq6㐥 3IK}K(M82&q)a+֐EiQ]jC"?QP6Wd튢<H^ʼާYyv'y7E;Q+Re˧3V]]IM1:v?&7o9[ꮵ1=ZFٽUUVW~a4v]r'Dݴ$룎Ӑ2]a?XACevKg}۹u\5TPgw<&L.rlVc5XXXVh=FJ>b >Ү~K`.aL?AyfGL^W0jP~5v_crm7,m:l :?}ag m~E~ >&-'zv63kUW/PV5qj>Nxy%jO.jZ+rq\Xwo#PvarVMnZRA/j]6 ƾY9uhH=[@z^ g|?wN}g a.>?o-VۤFԫuĘtl6ԲIID2#?)FcUdJ\,2ݹ7#&?=Zc֭*ћln-N Kb4V<FoVBS:3lEQyTɒtilS#4ML+LM&` ǿG}Y_ {o?gc߇N}>HwdvL-SE`K\恃i`=?@~Vn> .ct|K8rDȔM)DfFRuDbzF'ǩm0 Ϸ6˗L݋j=ɿ,4Pj\rT5]rΨy¤ %j2%HIp-YWSU2BqLJ\QϺk CȪIR"=t0>0E]c96FN.R&Sl~ 7_[J*\;%J5f7[Sz?y4s7JGB.9D5O|V->\x\;.5ZLTMEt=5 j+q/Lhr3AHû)c; 企2ee1mscڨ%)AlIjmn@uRLо$X=뀹7`W=U˓k9MȥiӜ~q͑9 ~GOo({oNޯ[r藕e\wvDWRXulT))h稀|<ͷJw sTN6J>BWLCIӮF͑3Qum U@~0>?!%?ۏ_}M3=Vuovi|R3U=Ƶ -Qc8lMҫ0n)[țX~Q 3>f;+*@=\UrNKϭ<qIId)N ?M_٫Xcywx %Qm>|\xsSI2SKH$TBZ09ƻٳ֎ Lы@~<CoXO)/6ޟ~U~P>?"c}Z^U=ֻR;wS"0jXuE6")Rf" EhuTP~8W5pw%g]JuuʵsەR)~ϑKQ+m*TTĆJ\iԕ:&m^>P,a|PGdz{ڵniƢ,_qqbj-XQ\Cze{@ > @~K_% A(-\oK_VA)L gfP.LSkrVf$&F7P\)B\Ym X4eNE. l+NȾ1HRNnĈcL&?*-2MթG%WT.keﲾRFV$U^ ${jdz@ of]2-j|oU"CL'q*l:`"4ӯ 4ϼeuHmAqřRDffz稳`usi` p;z[٫>2 =Ô#S굪 Uq\cv-*Sȡ%`umV^J7/vƪk1J ´/ɲGa`ri25G&re{V0kO].e:yX֔SOwO tcrNL>i}WG5U޷zP|ݧf.DB!ʹ15% *+JmlqjdF},xT@X?g6{~)_k=Y~W~6vmPǛ*avٍ!T22u85*Tz6u=@S?m*6Vn/'Y Bh?FO`7ۯNY٧'z rV_iuIޫ/4C}\$U{}@~d?K;c]h?cw`l|ۋl&ߥ65S!d_ݵEGEōٕ iaTJK*h<>$/yŷN)}]sk>٧_ǥ>5oP/.az%pt@^$7 _goO>l?)?g]vێfxj&2k֬ e_-#c6t_NMpdvk̔g{ݾ~Sٗ1dl%T2S+7wVoV*&NȌx4mj4H3fb;Mm1ڄwWLZ}nUGc&e}SXwFS:Qk#$K$ e'WNάzvBB[OIѪۼ:IӬ*:2O[+i]BiTD2?̀#neif?鑷_l`b`ۯ0uYYdmX,26z۪ڱl^m^pQ;:δ_;캮:j=m[VWڼb…dʒi Z _z0 ߶Z*Wk:}EXUFR4u@Pf$ |מuhmjQH]V_luV./K6Lc+UF}?̀#neif?鑷_l`b`ۯ0 w籭Lc f&>;*J6ju6-{2VݧӚZT`e&F"0^-?#xD.۷B܎vϛJG⊭Ja]NO.>,&z:m 7X,26ݮuuOˌd["r:q ΄FQIrڻ*Ȇ7 4SIkNPnMCcC.HaəfL1f;ȹizC1W <;ݏmԃUkK0\IƁ{g*cd ʧ۶j7sIInHRԭM)A} ~/1ʑ鳓Q^="Vet[&$kQ RR.Varҹ`<TVVPK ō"%՞2XdY O]7_mp^*s(0T}_ v:~ΘG c}b mp8ؖ͠EOm(fA3'=ԥ+RM%n[-FH~':[- /b!ca I}ƶlzVNjL~Z#U RXeO(FdV./K6Lc+UF}?̀#neif?鑷_l`b`ۯ0uYYdm`ct-;'~&:}~;;|.K |A~[Y"?8@Eٛ:- /67^LkfǪh橔έE5P%T8f@?Lb`ۯ0uYYdmX,26]V_luV./K6Lc+UF}l ݎ7AOѹm#~w/2c|s.;;ߟ=ёo?Ÿc+> ~=J_4 K?ىn3%Ԕ-T܆c.MMK^9ZFmEfs~k|-÷\3tfgFvp"뎑 f]zLcLw)]| S$,T"W ȷȏ@)ed`9%l#!uUN2 N.Pl ťEZڙJ8,f3 j"С1G[@䪸u;n^MNCiꣵ nUutj=Bcreو!7C,-FHjۈ$A_ϪT+8q־0FnF F$jpq j+٪S(eP8ڒ-)Z(IRT2RTGtI7eC]UnyTjVmNXVت:F\u-蒅Lx2ȌW\_hPݹtS. ׆4iT:>ŧeg[uV{y\r[jB+'Xp>.V8-jRֵֵKRJRԥf}&`:I[D]e[eS6ɳsq#:J MYm$hK[Ө~ ?m m'E`WR7XW(9[ن5Vno+bjˆ׸unPCNF̖p3- z]V_luV./K6Lc+UF}?̀#neif?鑷_l` OZgV=~LPv!Z֪4z='w~jZ|< CL,5 Z%ڙmhܻg-Zn)Tb4Gc%c8VuH6ΩxlW=P.%X [[ګԭܫSz6E6D&3PUUn3.J>;o0KK:&FD`?FÙ&ӵ0?ZZ>#~In✜Q'] ,Xlf2+U!K>VٚՃ}a`k"]2Ʒ}ZRTר)hQ_0tܞvgɿ~c6׵fRFqi\ ڽA2KqD!J2#^/ʬg[V|ۚ5KS,LjW ^zU0RDK٠V<:!3\NuR{w{\;FT!w%2GÔU}{k/II`6*_h ?`w/Y9/Z9{__}ucڅ#N׭Z7 }rR_Ԕ\*?"bnnnw=6|sVX댸#ZٔE 0@}SJU$o".벭dG8r q͈_f_&嬶y%|Y-ji?U? -MhRd,z-iR#*JҤjF]$`==l›m Ro7QbM\U)ۈi z&H . Hr%-f;hlCcx]Y`phѰn,H7 TLS"TN*ֹ3\y `ϠpJuul盛kYʡC3mҭA&7t+1)cDđILtJ#se!1ǯt;6`f3Və_wK!\WocK6Lf֤5KTZ|FZWݗB9 þ-˧]qU3+!t4XƆ֌ˈQk| #K%}?lU ^߀ G_`=vs2x՘}j质3j-rR[UbGj =]%JቖJ@wߒ‰i:| p-V˫Y$ԮV1KBFuRR&PKҤELjq.^3Suy͡+p֭8q$T(>|j~Yה69s@3"b6D|SK^.SI3;(-{6mHR֗@2pX>]ٻTHBmSOnܴ) J8u*kfjDj0ڳ͙=a-+9b)ۍ:{[+ȤTT6HQ\4MJa))RM$ .}cBDn{V"\[o7&s>ԚdMx\v̥\MS-hA tw^ͳ:6\-0#;uݰ[JOxNȻuKAIH k]dۣ-_[[!q[ Q2>+ ԕB-+K)RI)D` &Ui*2Z֪4z=&VUn>Lms弆e-\Y%$j2 ?u_`=iYnec\!E\EoTXrJ$vL]&_zTW*Y 5v_crSM?+@yް_ C%e~3*`r{-lnrr6;dZq,œ^js0Y\RmDsF\d"֧JZ֣Zֳ5)jQJQ=LϤPuJm2śKm'%Sݜ JfU-k]/ɑRJ"24{Nz|S(skbɕ664ۯ2V%TLz-NhsǤޫm)&fmsu$NjruN.eW\K,#4VnʬcR;hY%H~4ʝ:Mi5h1*tۓ NPCҔԈ:ZLҴ(C<^ {bے־a̼oZKVDf8Q6,:@Q1mY3kCymň̉::gUר|V ye50.<lV]ՠ4Ш4\JR"d /y ;?Ou }ೱD'Q~p>?!>!V|Azh?&17;bL%5Ņq/:[iζ/{~m#_m։)' z? {kͻpm W,i}Jɸ*N!&\7 KC_miRQ~HۯUYH܉YdɌ6m"v>t$O\{]@>~ l_M,?+#+a` ߀y c-b35OnV]kҮתP1͚dADsDIL!iZm s:3TjغbuURۮi\_R$GBeUܦb`$iZ;Nde<CFxƐMcÐi4BPA*l^ZHáK Ež-Ǩf7GsѤqv"XSi΁RdwAꕨ`5]}_}}:8뮸[,ԣ333C}\^tVv0-3eO/GdZ%ˑ.6nd:_oHiudljIgd7›.-ڶ9IƆEQq޹/;j6꿯،J+o=2cmb3LEe CnSnW?-Oj?n@y֏Cci2m[ݕv.`WݼqvmsZƸ#7/JKR*83'_k,Z+'&bbV] @-U^[%y\ikmIQ>{y7$ʿ| /û+օ_ 7Xl!pK/~!Mޭ J/rHZF%IUdC#2Mv_踯 kMjpV$B_դ˚Pk= K2-On[Je*TdSrv"?!%?ۏ_,f'ÈmYinxʉ)̘=]PRuJU{VmⓅ}tj%,l>7@},JN'[?W #8h6oqIi4bژ%cV w7 2쬭|D|lyu'b :?}a{.?ɟnz TBuZu\Q]qfkqfjQ`!> q+;l2^ȗB#-\GOȗZv72/f$4JdĤ쳲mMm[cCL"8\5ju_׌Fjv^16vı" q) 6 c!xuu*5.7 Bܢ6hEbq-5O5†ْH$~+B"O92hT8FьxReXK^M^Cx@{:ܜiA$uЇ7aJI/4O73I- Fғ.5/NM2u[=͌-쩗(׳0湆b_vE SWx ).fkmrsUrۆͬ+UY*DڝZQ~LBcRy354x%b$F*SG;KzD-- 8θJR5)FDE/ ֥սթH>lR'͹`IFzyu }cѨiBʧӤ:ߑwSi~_勒* ޯo#x>8?,zg;mlUF*j1QiЦ)7*ӑ\5$3IȜ̘AĘy[a"go!Y΀RQ6n:moDR)W2I~{p6_HaW`iÎWdѱKM*[h:=,|jyFfflTs;X.oH*Q">g[nWk$R BYKG.U:J -|!amRL,;^p;QjLsO/VA ˒76ꊤ%<i2#JH>~0~ 8 : @TjW[*]jPhJ% ^Wj6JiFkeByեIȀ~?7 ԭև÷DVyWjd=O%C^YZQHuj @t,n_/:~7w)Zc :?}a}>HwdvL-zg>ڿWUQŷ^kXj6TyԊL{[֣f JK( ڔiXmlS/%2[q׎Tl$^6j[I)R"5$@Ǐv"Dabxѣ#ǎ,0IKli$)"JRDDZ G-|}Mw;ոBf]a s meNޙ)XQGrSQjN#T4қ2ҕPNІ4hBT' {3b,]194c;YtĒ5k>ڡGqHJȦ[/B5UI bJoYg#Y& [_(ar۵Ѷ}N\v5zDzI}mZlyYמ4We!2iQ$?[2!ȐÀ%u2_-=AyWSa[ti/X<ɒ)Z2s4ve SR]Ȩ9<VU3<=AGGNN#3aGnqDu{w)hmeNDK:Q2)d?[-uRm.+w=yuŚnٿ[j\r1EDDY#t,"d@Xv›rQn0W [ps:kѤO߶-Qd۬͘ɕWpLj-"kCeULbѡ&+Q?fZd(1a"<-ʊƐّC+So0.%.4N$ҤIQj 3X/}L4Mȴ^{{^K.ڎ;6kzjC^a@}TQ&:86Bן22jॉBߥv-pYEqș*@z6*_h ?`w/|Sn̓>\&Hn6[\K-b#c((Ae䶹knnלDf&|hi3B44/[8os]۠;RFP_5kdžnEۄHD-)RI,>@|\fZ80g1>]gF-^ a? ߒ}~@>`+ `@(Ș{3?/xAAS4Uh560'vrFo ?^߇gNxC|L qƙ]M뉎ԄZUUjt*2Ej)5=ZuVUIrBSmp*%e!ƜADJ# W@7B< 7~X=~LWQ׀~@4}ۗXݮnr㱫#֨uKoLwzc̍BYB(Ti)J!ّD/tRiOʾZ :ۥKMzLOܜ=ՉES(RZM'EAE:wW֑! :=5rrv_;vC##ͩKCk*u""^ԝJM ]uYmoqp[C,p.̺U:㑍R-"$åGqg&JJ~8]11Lry=t hX693I85 Gni4}uX~Or بn3-Nh~916&+C*%:rlʩc`5v_crSM?+@yް_ C%e~3*`tTS*U)i|Yϝ!ˆJ2ThmKqũ(BffD@?޴L߿XVvR511"%dbx"ǖ4%S+300mW~wM]\gKĖ Mi&d낣J{fR۰,"YQD%F H"%jzTobƯ LMNŏ1ډ ("|A~[Y"?8@DMpo?Ÿc+> ~=J_4 Kʑo7n!5ʔ Z.6ݵݙm7/7{EQYѡM*@~F>?#g 瞱۳r#2Sѕ"y-Jİ#>K:\bb먰[R- Թ@bJoYg#Y& [_(3Xgn]{7O)Z4:YG:L̆RYMram0n H| G-@qeޫKqO^ږV^4d @Yj늧>~*;ui(k6 㶻76T+lgl0KRv'*d8#bhN- J1 boZ.6Øʹ 㐈#ջ>7N[Ъ9Z-Ԓ ']LȀ}]~G}Mp۾.K*`.I;'H:}pCrjbZ\ 4sNjcKv+gZxZq2ص ڔm4ԪWtU9)\ڭNL WH ݇ܯ2[)cϹw J}U"p]6C_8]nɔZ I3Kcڭ۞CP=~޷W6zo/LVɏĶZc;Kwdd+2sO;>kIJa5A캖v-M˟UR+ԳRKLWIoRо6&ܻ}mg#u)a1ve׋ve8nnP7bZSPbObb=.r}":M?ڎO%Ѱ@u'WAOXn?ly|xY=V߮@UW)\"JS* ,EHQ@~dGO}ڍF~e܅f+.u_w:׷2]U44FDz`?t3l;unj%++[DgeӬ*B#V R,ֵ%JRj0@>.swgȘ{3?/yް_ qNLp@?_0?0OʠLы@~?6,![icKF4(Fp)gNj:M¶ԊKhnA=XBP ?s_ ?Gn$Dxo0@z.occ<ņqFه~=/inC.smdo/Eѷ&6ZOrޔ ]괺ټmEekuFI T U MQny\,S鲣WV>&n;k*XpX#alIRvɖ}vͮ!aWaBrII2?6,.4Ф(l99A1ݭ[q t SI(ђüU|:d Tsq7*v%`Kk8TƦ>@mk~"pNU1e-S-R FMJ\5ynJ]ESͪ˨pytπ?0Icoͻw^\xMybP1͙iUc_ 'i̷&Qۆiqsq ۭ:îN2.-u m֝mFu-Y)&DdedoK!EśW74&]KSlZږ= N$u 0P N[ Um>yJ͵a+fש4_}HK&th3mnC}Ǐv"Dabxѣ#ǎ,0IKli$)"JRDDZuW*:Sd=ST&U*2]ޱ\-L|vyR[BPtIh@)q(#?fw3gx@q(#?fw1>p= ;Xfְ.ܷ7phL?"KP{xV. ͛6CšB" :$) 5-*ID23K+B>I6w̩TK*QJ:|ۡDuoʙ2Sq2RJ5Ǩ\z?ٝA5Ǩ U:%04|0`H,k"ʸbv=/M"=-WmA\+8mh z:n{n+Pjv[FK̘m.߫ͥHV'v*+Q{ټOL|xGQFr=Egl ?QFrjN[>ݶPnkZK3t;ƋRh*M :P8%!I9{:7C2s;˹Vzn{^?5[/O*(330q(#?fw3gx@q(#?fw3gx@q(#?fw3gx@q(#?fw;hƓmu|{_+m\rfq%sj|FxaFMp+Ö[K){ic2ZJiv"JI<ʀ-֠6d0{l^fָ靵2th7:M&i"T"v>[XuBҢ# =Egl ?QFr=Egl ?QFr=Egl ?QFr=Egl ?QFr=Egl ?QFr@ǃ4xf?,ܥ_uuoqnFk9Ur. Dy:$r9|4jR =Y oe[}Zr=ޡ>y.Xj_6 ;܂kQG3? ;܂kQG3? ;܂kQG3? ;܂kQG3? ;܂kQG3? ?>fX[ڎ|eu^ݾw |hW3 FHWnS\%<ޚ|m Î/Ki*O{{Ri֝T*$vĹm:HHfSĝaJV@\z?ٝA5Ǩ\z?ٝA5ǨOWw#q|TrEz㐯wVoۓ2n vޗ)(3 #$m%n8߀wGW;̒ͭz}Bg1|ǮϢ[M><>/ʖU2T EK[m4P3gx@q(#?fw3gx@2n wp^'c컊.h7}xꔊzk&_r^uj f ][2O* θĆ]eš@ (7y}w7p;\Q6˷Nnu aH=j϶[&RyWk\z?ٝA5Ǩ\z?ٝA5Ǩ\z?ٝA5Ǩ /a:(بح=ꛃ}r̸vS%hLe| "ZtZR ƝIRXl-;. b))&;Rdy9[5&W k5ԥz7fضF9Fjؖ5[mHQV6ڕD”HI[#2I`H7óZDz2[86]3UǝƮթɤ'v*ljG)&R}|2PJ\z?ٝA5Ǩ\z?ٝA5Ǩ\z?ٝA5Ǩ\z?ٝA5Ǩ\z?ٝA5Ǩ U(%X3|%71d^|woc }?u_?7,7o{f=ceo7 dqQlg<;]SINU| lSM(d;܂kQG3? ;܂kQG3? ;܂kQG3? ;܂kQG3? ;܂kQG3? kQJg KnbȽ:ﻼ߾A~꿹~o)Xo87;uXvFֲ~v<5QMZ|Y&Ƨym>~+$;܂kQG3? ;܂v8n؏`9m-C݊mjEwrV:iBe(͙&KjQ(w=A-κPֽC[W%:Y`H)S3.l:>S|d;܂kQG3? ;܂Ⱥvah^.p<3md[zEo~N7G?&+f>!)lלCD-``XŸPw|W]8ZR|7v庪|jKS'HZy 2m(J@89m[z<~ŹZus)N)! ^5-YMĦ%II|S?3L< G5umz#rmM(S%j"#ZH _΢ufb{62\Jq+򮻻ˎmS.ku#Y4p{ rֳџOVaM*Ec,rSn%m[o_ D^2̓#%)`}͝cgY;^)i:By+St\LUvNB59riqDD$fonwR. qT vɫUv;=D0L„%$D@o5Ǩ\z?ٝA5Ǩ\z?ٝA5Ǩ\z?ٝA5Ǩ\z?ٝA5Ǩ [鶯[[e˹t۵?Cv{]1ԉݧQRR9O.p I{Ӿl+'ڕ%YvCHk\VenQROp܃Zk7 qIOuBnVMRkk7uMe;Yer-7)w8R9KO ҏ3&D kQKs.`gG"r<"M9qG "~EYsEUat)>%"Q-۵˱!D龅)JRydI%((̩M@e{$wP\bڽ;qv%3-eKgbD' |$\fȐų*78e1آij0}:[Ḙ̸gW\+ºgf^×-1]6Bd6q. \6ۈfh6'Q< Iwv;ĥ~vk9\׹q(#?fw3gx@q(#?fwsKyCfw;}_zo:dZkRR{mGb|x3KJ?`LO,5-NqU޵K-ǒY~saMpǨ-MdF@ #vշَc,[Z2nB!\ՐMۙLJiHJT.?#3ȩV1-Wf/?;(8" k֢SP2>kvP|Zrl+ԞhBJW.5" &܆jM'ޭ޹ߐ܎5)6r|a=[7`śܪzZo=7T4NU!6iR@~f%עߵ JLSs6ۓ9+ͭIFUKkq MpOM >&s Xl˴_T;lr)n7JXCjRaLfjjٵRJLЬonu]Ȼ{K(CMp8FTh̘uǦ1ozE CMwdN䓊sWt0ci7In?#n{[ew)eo2հUg p lOdohrcCyTfh[TxqfK]䈉~)BiJBIB$)JH)IED 3w@Y 崤d\dY+mk6L4)G)">7Ekd/`eEycH&C+So0.dT8J%%Dde?eif?鑷_l`f6ɲ 7`k7Y"- b[rԍӟ-5O=NR5K3Ԁl)ЪpT)" LeBԸrSOƒe\I%F.콉DTYCh+mO"ezVtUqw֡;3;eO[elX%?v8e[.ihJ[$I>" uN)KZFfjRԣ3R35)FzI2~4٣ rOcp:4nPtjTpK]E`I=r[nrz^n䔋gqmnVQoTj_ jV@>={9'>yFA*f6+ᬃ2짥}tF(kYHDOȍS6fեsj9#V]f MkC{ϰMύ[k^˝)O5Pzjfftw^ͳGuo<}tw^ͳGuo<}tw^ͳGuo<}tw^ͳGuo<}tw^ͳGuo<}U&n?3hی52B_7{~[pzȡ[V3EgW+Dn)jPzǷŀz2xF_kҧd>Щ6[5j|ʶ5OvAf6#L(ׯylqzǛk6?@?ׯylqzǛk6?@?ׯylqzǛk6?@?ׯylqS+?Ts,Y nIN6ˑd2$FDHo+Fg0mj96ʴu>>SŗZFl STEf(6eyINܞԳ +Xᳳ?Ȫ58f:MA#$YѦzz7и4neELVV!4)X%BX|kz 1<.(Pz:G·ѴMe el+0]ԴՌoۅTe;*ֱE>auq`=^2̞l;ZiVĶk`'"n:Z8e.ض$;"oSJ﹔ԆC NRa ͩ A5H0Iӻ/YqJF,;JԩGY9˖;$'.I-op ;a9_4 KV=Rg’BU)J3QZVPV9juYj RvTn=&C"Z" %x-]ȺK6jiݫ\vZuM7RJ1(QDjAd|{Lk2')3Er.} ӹoҡ ]GZOȌGa͌nwox̽"" Rb$c\Oy'$Պ DuIU!)0ͽRm[{]6p]6]XtWop5*ԈN G-O*l) H$tw^ͳGuo<}tw^ͳGuo<}tw^ͳGuo<}tw^ͳͥW}w]gr5ڻv"Bl, )Գ6m jZ< ĿlaǶjCJlr֧WtJG}/V~TiRѷElH3Q8j ^,׫-L9Vdm5vk&m8c\d)L5*e|$!nKũZ6R JׯylqzǛk6?@?ׯylqB}]l;aڞ7/ XK%xs;]m1_vnwsVIsx[?G,?7=,kfY͒2k^?!fI٫SU}; 79a*iGgΎЩ6[5j|ʶ5OvAf6#L(ׯylqzǛk6?@?ׯylqzǛk6?@?ׯylqzǛk6?@?ׯylqg?+{~yk_ d6d.=( }^uX6>NMqԺ!hA-im,=? ,M7e8#/{_jRFq$Hʒ2n0 A8, dO^E67;rGx-hl)mN 9 [ȼ}#Yz%nfh-ͯR{^঺%JIqH2Kբ-j"̘շ(v:@uX xEeC-%P×Fuutnofۈ;bob(~ 0^Aؼ[ʫwO)+ Z=3<.>_̗7m>:;_f7m>:;_f7m>:;_fr~wűk`}ܻ:V,V=bnzԖy$=|4I1fEyp璬IH.2Kcg2˵:9:kMFٮDBRR`<3\z0KquJ חZ|bnXQًoJȭ3ܳ% p@򉹿>+0ͳ5UTh6IeQ)Q ~F`erNUr |dyvW RW!j }HIF̋]td.T QA"RdG*$%cHeHy +H~[U1 HZZaQ$i}uՄ6.C#yf5k6\_s[s[IP fypZrO&t2&͛!s&Ky2ʒ➑&L5k3Rffff\:}:Ŀqc?C0?0Oʠs7JGB.9D> -,{?p :츇YyZuudmdF'˶*lղTw"$CZZN6ᚣyYd :Dx62* %ՒRDU^N:hMR : :RNK 鱢!=ҬY_q]3TJVڪ P{" ?.? ?4@~Ku3gೱD'Q~p>$;2VW;}b^|A~[Y"?8@O++S~`4w4lSt3p)UlIDd")H}иܓ_D{N%O(҅ ?jbpUZr:XNyR&Ԫ9NͨO[,U-FgM)=cw_9  ۪men7Nb?õs6VhlT|&W#*֌__XY*eSVRnh؛pVGHdl|a~[Gڏ#DqNLp@?__v=ȟ8JgoT/y ;?Ou.-c_庥:ЗTb{a ٗ&ȍC3fɤ)nSq-KB IP~Ot;sw++i{`jr^(gIn^ƩPY?Fձd@xiF[-NnBU;-!5$\ KxC)qUbVKBHhHڧ]o<3jۛqLڛ"LS6vBlխGM R-}G Lы@~<_gۏT,_rW{K*1aޙ^eO8Ԥ[];Zˑ6M6dĉ ?&δe^v2t1H%x!Y>ӵetZȔep cpİ]lecC%s2.[ɵ FZ跞[1}zw[oUpM1(U+Fhv9=6=+1Wt+De| hLj0@(tu~Ǘ~>`+ `@(o?Е \ro|A~[Y"?8@e~^ؾ&7K k JU v綫RILDu$:ˈZOrOѷר6)N5})6E:2tdy;:-F2KL]1@~h=gdO7o?gc߇N}>HwdvLೱD'Q~p>$;2VW;}b^|'~ZN_5TT=rv6q),ULIw*s^eQG\]rӿʴc\Ԯ_.mjkT*74> T&lE]M[.Sk%7:;7 JtnܸԖ ﴔ"лYKtFEhvL6yi4^]~. "F/UP(ڗ*2γ!g-LɔP-6@ȿ)nJ=jˊvWu9vkӞV+5iNNYJѡh@-~Ku3g a? >PT թ3S*ɑڕ>KЪ'&3#-&D\iԕddF޶:YLuj[7juES乍#ћqiLGi]z92w@8 ?.? ?4@~Ku3gೱD'Q~p>$;2VW;}b^|A~[Y"?8@7潋n?o#GzD: GLܖ5;V3@%0} :6;k`bwT?30.?!5 J5bfV=LJjۏDR56k@~iɻ$jkl8Y"C%SӪsT[H ܲSJnivEeۦDJTyjϿeRv2wV|ԧ>A1e]ܾͻ܁hZT[knwZjWnJdZJ"QǨSf ȏd[?ڏ-HȘ{3?/agg+X (ThtLi"pVTIq.ΨHf;zHh/ f۴țGb:Ec\&&g4ZS72J՟1hJ44sm\7[6C\=\E ZnQtlW_Km4ڔ"#0W_\ֻ9YZgRW}R 5p5lvҕ5ͨ$HdAroF/x*E:sBoj@>j`7oR>'`>6]gY ./[n{q=GnI#*Z2qUkQZMÊKn2{I?" n؍.6s&N1]K\&5o-lDH%,e/Kn1\_r_<mSF5|%:6"?T><\%)Ba"ZJ[7 kx>NZ{BmRYڗe\C,SlcA)iMy%-&|]^pLW6CR.{ћqSTh򞎾DY ON-:tu~Ǘ~>`+ `@( _m_Bk&Ԭ_ .ͧeE1 BݷJy5 DƧKsF̵2TlOq_̩M@?S֛e=*27`{UeOZo=ʞ_̀{)+qT'T2N:˴[<-tVJX'ʮdksV}zTvpSbJIR +Pz. ǿG^Lwz^%ϋV5c/VU8,*RL!460eOZo=Xd%J6)pN6Qpbj2S]m:-ʈ%R`0 q5ʡv勒tftqм@[YfɾZ P`v::ӶuG8lk>P(4zwZVYnƥ0(ܑU1ͦ"A8Т-H̀ylr[ו^Zm\ֵoTQADPϥV)8H%6D~_gQ 6>phv(Q|ɉ%necp3 Ҥ*[M60MLSX{ ?.? ?4@~Ku3gೱD'Q~p>$;2VW;}b^|A~[Y"?8@O++S~`?~O)Tq[U(ĭj)u)y2.%~Ik-|s"̖n~W)`PJsbJDE3$* xV?J?ȹyd}g\FܸېmCأ352OНr(|.1dZ>@~Qߕz !M'l͢Z%w]6~ev֦NTT2Fm6D `Xթ1mrd}W [VmhR&kSy,@Q_:dUД "5#2^\T E,5"eJ,joW%unKs )$E\D& 1,j.5%"]Q{P몹@gT9j,(ȔM|E.9vd]ru*eccVU9ȩb,`]ǦXyMZ[ I$p 0-GD_c?&y /y ;?OuC%e~3*`~':lm.oWTqYfZ]_7:l`ɢN7l}+etq -93gx@(5Z8"2`ml qNC܎$.a,IDr„Iy)h|FKgufd*eI#7%::ػ9VłN׽h h%(jFqK>a[/PE6힩XEnDITU)Y}c* KzF뭰I*S @~+zRn!Zu _rؾ:܆;˱[SϨRԩ2ouZ-5ި 7"'Sj,\kf]=ӳh+[JS4=9I#Qj6.p[R7uEvyu̙Q)Jxzv=kn|1eL(d-mguLhM=.B)Y)p0`֋S[ǸTnnFT۵rLb=͇jꄒ'!ذ[T|D#ԍ)`l筷/cӸ앹* ^8ܠK7s™V}ᬑQ~uaJ\"R̨jDi1CG} uy)yI22=Fmj?e %:3S~|A~[Y"?8@O++S~`> -,{?p LX?W>uK&_Uۤd{VL֩IdBW>9c[*w+ez7DZM (קlu%QLy>lzorH}XqxQskS|aT% ]YALR-8 4/ҬVގYʻxΖ rES(YA K{]3.^O5yW ioKb귮vқi1'VcQ+QZoRR)-E&t h$צvS?%W>Gvdxt\\n$;"Zt[m*Wj%%?>7XEVLz] UM~c/-gڤeۚ [j6q(X~ 5v_crm7,m:lʳòlV{00ͅ".+ٗUS-4S$Eoi7 L!Z3{w֫|BݘX^k:r)Wj1Zշ,%^C<}PT Ǩ@WY}yen;VN 6"%G6:uhg_ѢHw]EKJz[˻%Xnٖ_.낢3O[&]rX5J=:}woyݵS_Qj{jEaA&hX6*Mm\ 8Ʋ"@=IꥼٷBŷqx9rmɶ5ƍk[e=j GK|6u#%tTFoغ¸fʠ]mf[PZtjz e[.'Jyk~TT3%:ǜZ(y8 PGdzo?gc߇N}>HwdvL^4*@ߩZuSc߫\Z.Ow_A) "Z +JT@7\]Sm!hEv1r&J{JSo\X^!_1*VkWvhǔK9IPT[8ݰ]5t1Gm":j7]Tj&d:eR$[u98DNtq`X/hQ;c({.?ɟn ǿG}Y_ {o?gc߇N}>HwdvL-Wz l.֫shzחHșsGE4ǬY6=.%܏>~dl;jFE-)Rd7&l{EJ7Boiz8Ӵq(_\cf*jiV-U"{ C.ѝa\ێWϢ9~I[m2n ~e[Bk"E93d$֐_z0 M(Ƨt]_nލ ӧ4ܻfcKm۰HQ-\f%d(Lj*cizZ8Oen6Q)06RZi+}䑩FIIz|a~[Gڏ#DqNLp@?__v=ȟ8JgoT/y ;?OuC%e~3*`fV.fOm߻.es[_u!b K7%Ed t$ɀ2ΨੑJؠbժjSق&MDu*tpU,է L?ZoS>-ʷo㝖I һf'+]I{dPrҭ͞R-23#P e2ZSRuje6 IP}CTR亖BHԵStlb{hf}2.:T[Z m7t֥lYjOIuqnWb5-[nUDP}]4iZ!IRdf@W۶n9In%re-|VM-MC4inCd'XR} 0]f&uqG̾(bmR?5ЦdDe/౹̿C66ok[6X%F#Hao2.4ب6Ɉ)<ɭ%D@tɞ탱|]uesvmok#"mXL}mE[M z|' 0?ʜ,>f=]۹-CN/.~}͒c)|Mdש)#=tJ3~MW;`]YءUisi[seEmY"4saRŋ`c硲%jUM䥵IZH=^_m?|@z.oc|A~[Y"?8@O++S~`P%%\6I4+2K?if&̦ԡʧiAtwbM6#bT9_CoƕԇZR-&FDdT9Cmn9]L.3AHF1K~F)-iDz$} F2ߒ}~@> -,{?p LX?W_v=ȟ8JgoT -qЬvv5h4f֢.;S}iZ :Z)&AS(Ch3>tun»mgv5LJ^Xkv Cб7[!ML/(G`4nmRmSk*_̖O cQDxŎ؍3 BHlFE#m|vH|[2Qɨr&r_ VkC&餖QhlԤAD;ln`7=UoT)P_{SQdObZaRMxRf,>@~&}r~ٺ߈fSޥænK#7aeJ˙Sr"Kn28J/&@ dqUpc meޖJE"DJ)uCGyV4,)&wS]mtGUm}Is41kuI&*My)Q."ۑ!lUHJh>¢K>,idǛlveÙŗKiz<R~;쬖*I @u'WAOj?n@|[hO%1fMr7ilbIRjnDm1Qq@>@z=J)!qm-u95jgǩ9qQcJWm*%mj?e %:3S~|A~[Y"?8@O++S~`> -,{?p LX?W7.̴RpK6h?x|rjM7.V.m-+Q;3nyQ ȗۥJvS.;obl@”hUךojuz=2oaMVO[2 qֆж7?}0^)2D.n-$KZ uu1pr\]* NMȷ~`9-)_fE%(vw5UurY{vQ3Ujfr*$r1B˅ZS6!ؗf[txɕ59DY|`,hghfos[lXI>)QMתY9.-DkR֠@~G<=s]_˾vc&=͜5d l{NMKi>MJ$ _e7/o\`?p? p-Gϲ]Ƨŵvՠujw ĒPY A5+JP>ٺ*[^'X5-i/-ѐ=ʓmvg"c CB`)vDcZʣ~w4-c{-`̕dgu)v:]m- ZdaН3jLg "4T ,ی m!u@RuOٖ%/F4rsBW|^ݵXvR;_q zLRI%1'ISRKU~vaaC,LI h$BH"""ЀD^_m?|@oV.,ok;T¿pP{]t{E^U TZuJ}pZIuvbM(Q Fgպ`Y_ʠuYzسn@Vf*?ebͺU=[śuܪ&nm#ۙ3+K^1%Q-Z-J-^m8J7ԄRRJ> -,{?p LX?W:7plyIl SsշC2Ә% yͧ!J[k-,f7|*b$-ea.8nPoLY~œK "4{RC(uh{DIq78x/hQ;c({.?ɟn ǿG}Y_ {o?gc߇N}>HwdvL}ѺoUN[A5 5jݰUERI{jTW^F^"2^Ȱ*2F۶1 |*bꕊkR{f Nr4xߔ=/T~l]=+[n;5q`y6ծLuFH4NT:fFS:7umSpJh6B Ǫ}f8nH't+`;ngnփrl(hn+=":"xOu$:m=%*H2S>,La+N~+-Ĺ(}^ƶrqjz^bc8"2Rw a? W [p.=]7 uEb\LGOBo{˗ҴG*,J\vU2Ԅ9)dn2wx;˛5eߙ^: Z>3FŶX}Kr=gp@jyo$: R1FW_bKh=V4p[۞UnE;)^is{OS%6nLV1>@|a~[Gڏ#DqNLp@?__v=ȟ8JgoT/y ;?OuC%e~3*`̿c~l?u^~ܚLo\ze욍. vޠqȓ{.LgNS2R*QJ:|6tnS&J}n?&TRqjRֵ P"J*41M6C1!È˒eK%ij4ho?!HBF(Ȉ7O{aҗ$pHhnWZqG_s1ՏJ%n;ʍ:LTh|sC;2[*bVB; Ìe]muQ:&: N)*m#MS@>,DQnaM~%To8$Iic1/L>ڙMn]A羫3̋gyZȮ&REx!'7vv^Q%(*Tz_7AmnK6Z3Pf3KJLTXt,M1pH.#2ִ,n_/:~?w'V N}^=gޕErvTp (ɫ\:X3~D݌(ih3}uo`d=դH~IJüۊz7ǕjV] c[Kdo_.&vY *Bp;{>d,H凪ޖv#"Mq&C3Lh@Koz93j=m\ٶ5}RvY:n&XR b"?-1tu6rx]bypzs!\u)i%SHIZJe3IP?0q\)_R>zCQJlḩ͹ -/"ێA%`Ҁ/6ޟ~U~P=#ȆPೱD'Q~p>$;2VW;}b^~\_shCzqv*BbkFKMVlf9")O3Fqք RH@C\M'iOonBIl>2rVBF#tmj?e %:3S~|A~[Y"?8@O++S~`> -,{?p LX?WLXrv.ZN+KC~-}իKq5Yh*RА$~L.L>Hr}jetW> *i' v䤶"\RÇ@o^oK# {S˓y3= u'hmҪ*W6rBkRV7·DA&JҩNZVj&lj*Jne>LCq.Z0|n8 m[AqVM6R56l˫oUj N$K{`>֤)H$(̔E`̍FB{yU~Fi7tF='Ie:٨!}IF|n's[ݶOm4dmFvUXSF>]6޷):Q4 Q_RTf*OY4W'[m"i5TgyNm2m&[ڷ)r{~Ox~xó18vv?ǖ ʲm:#H[fBSXZMmFSS0|a~[Gڏ#DqNLp@?__v=ȟ8JgoT/y ;?OunMvlnK[ٻmZ̘KHu*mKg:TR*ZJ&* EBpe[f*jzPoov8\ݵr88ד\|  W 3/۶!/6ޟ~U~P=#ȆPೱD'Q~p>$;2VW;}b^~c[vGYNmaIݙ[nI)Fppah? mI23uZ8dΨldFn*5قm Y%I ?.? ?4@~Ku3gೱD'Q~p>$;2VW;}b^|A~[Y"?8@O++S~`0}w 5q4-~c[ l qH[mVOhl[m$jQ}s|ח3EhWRe7L9qߗF櫦#kR,ͩ 4G)J$*;1eǼMkm7VΙzNT!AW.8մS| ш2JȘ~6oŹet+ZѠ{j*D*=@ǥQPҵ-iODmfHAjfcw-&E./blȘJlWY%zZr0s_ONtV#-4b|T_,[*Ne(Q9V,Z.kI[UZ Q~߿tt8 .DT7Iç]6USG:NkGQ%SO#JjD7Ft?-V-Nd vԩsiٮϢ<Ɏh*,fmITM*oKCz 3ԵB갺pgmU &jױY?;* f\.8Wr@q[vZ&.JĹ*nպuR؝KA} T(wӰ4365}mI <CoXOrZmߐnj5`ڷ%xSN;BSnjAh[FѢͪT- D -fI3Ӡ'TgP?Y$09oy,'?_y2PT7oԚU`^R%mX8KT[Fȴ&GB259*RJqr&MgJu:-j  ?.? ?4@~Ku3gೱD'Q~p>$;2VW;}b^|A~[Y"?8@ݨnOxY +șdEٕv K[S+$6 YPHQԑ~]NK6XS6͹^Jէ,&sebC,xZEܶna,:n6@}ZL0l0heYB[iI!m6hIRDDDZHwdvLೱD'Q~p>$;2VW;}b^|~XU:,]uNԽ7_aDa-*{ CC_-X\+.TNhDK /Y'MLohX[\iLlXmХ 8ڗwgmXZKRo?ϳ*fP7Ef qYt) #. o2Ԇa}[/2O4M4k%!B###|JWWp,[*uEK.480W|ꝼpʥQ`K|rmTMK_0]߯l%U˒dg7HE BI┩e% Ąm.D:)LJKs&ֲ @}#M\wOutCn\ԛ{*AJZȣ֒Kf S.f~E6 zRV+BТR)*JfJJ#. yް_ r%U3$ęLMAu6XyO&u29AI 6mz,/>jLklϰ?W^ஶ/Yʫc\"m2Ep&RM6rd%W]1@~h=gdO7o?gc߇N}>HwdvLೱD'Q~p3N}rէ6;("["-?1WlTqcLΌɕN7 jxP~]Dm}Z0~q5ܽeUTvKZWL6jnSr)4č\Di$>@|[T=u[NLr\ B4sl3Ny$;*fJOG#"Ԑ %61שSzcP[NmQb4& vm3RyR"V~>;,hv 7]B9.n`bsOe#frLŶҜsiYm&cFJ^`ߓG[.ڮ]N9uϕ"=mfI(ʛjmeXbKhn==' ݗXܿ_uq!~M h75N>^r鳳cSB++-\v qNL D !ظ`Tqd{α]9Zʺ<%?%[3.^4Wתrmi EU͐┾e|^V]㎮ݏm;ĽmS.;B-ߩ4}n߭ŃVNi+#SOۉ#-Kuzz7KMf⳧;җ--j/^,2 E][GTV@~һE.)޶鰝YUlo]mN1Kzq5q#\]e&mOP [>.v4GS0&dy 긣+ޕɯ)H9vZۋ[% I{nCA&ӷ25I9^Rc~] MlljUk&LE /"` J2-BPt d5.RD!ʎK%m) B̌Cmp'P u{x ǿG}Y_ {k컿"^vaZ*.4kRe+CP锨.ꏡ(Axnuܨ,OM6c*]sTje '_.յOƧ0Z EBIFE )~[REyƄy;"%O^m[2#4ˠ~>:?-vGVۮE:eRea<{|]9-IqzcgX^Pˍʹ-1PR/MfK:"󍺕ܪ:8Ii&Y( p#`Zf&Y]TL"׳*jj/ ̺wzM5"mHAh|?:Ul{mWPsf|qŌuY]*yiWZ[)=xX/y ;?OuC%e~3*`MP[-uZ-7ڜ;]y YEv`NO3 YT ?k4ȇhJ>::ll>CVA(h8WnHrd9GPӢXԶ0u [ΎJ-b޸ii\cGSf8p2>z?&'yǼ.l! VUO#m~UGkɐ&8L'm+Cr)JJRI0uju]JǢG'\:TQKSJȚ-3?a?ɴ޽S{SỪdOk~]B`QJʪx&eZ+]RPqTR<CoXO{†SƘӺ,]>qShomsy9#ݛho̝Sjxk%ͻFsծ;"!, Ԧd4֭a4^{u\6-l\Uh'UumשRSWhuX*T>SJmm)$dL/ծ ա;U g z;zlh+ I]Ftųf!t8r>|t~Z\>=$sf[i)~b ^n̖tEu+yU)t%HpM&Q@s.$F{ͶMu.$EgTն^7tjDڐ~u@>#[گ&y[P77&G겻]U=]Ү&Sz,?T_v=ȟ8P[ʫ&|2?(vy0"_zwtg$xu幮V/g5C~3IJN,JRqȨE-eKF#LWLDZd?!d9ͣkET/|&s+WZ~ +DLHCmoz3IR>p_% 7, |pSn.jR) p$"U>KEZ";/ҴdI0g?'_2l &koo b;(IdU,Rf [trFpBa%J[6 L>Cy棴 0y疖ekq\Y f/ykV!P.> .kl'ca!zgۑjR$|fKPymuS Q=؆X. }mxwEEʭrQ;u]ՙ%8IJO|؎L5-6ُGuo<}tw^ͳGuo<} un d-g*Z'o[Y\yG5_.*LidST00DʊR#IّC+Kͩ.4N$$IQ3ڞ瞞6OQ8ɼ]`z;\*B͊ҕL8ZiRp/౹̿C66ok[6o?wd=`ֱZۮ?.EphWP21rգyk݆rN5Ae-$RyDs83n+f=[Yq&eks5ᣉij/fۣY%L5Ĥ1vw- i!DJ[þ1}qcܕg]*(]zjmVb(*^qaUi5e6u-K*u}5EKlt8~$VmJ}JTu:j6i-%ch%ΞQQۼb{pu2۳ nJ#ܤX85:H [qМzS^*H~g?Zv>+?ݕfgŠ`́L}b\gZuצ.-bϥ.V$խ+AL^_m?|@z.oc|A~[Y"?8@O++S~`>;?+=#>gMnfRj!'>d SLCrpSNPe.jTe,?1m uCmu_s/ȭiIG1Qtq-H.fiMO<0$]M a'cTn8HE2s2S(.jG1ifjglNuM6;;bSjjEeK|5RJIRuI6y,v6k2SIZmO ̑)X-y heme @#q]o70LXgqyj>Sc)Q.X攔0M \Im\P~':!钲0IsG؆=*S/bΉR"T N6(&#ҕUTxLԖ)DFe[Z^*S+R[/*Ue:R%S&NukQ XOzrϮ:{խop7|:Nj$W Q9\sNu mrCmD |roɽ{6v`C1lC{ YT!ZۄLsZ:22ja mqU_)L ~CP&伪]o$Gn}O%J.[Ǵi"3>4zp6*_h ?`i›m_7QmQn}mf1%UZ܁6SBG2b+yu4d+[X;`kj'Qd9#CdLaŧEp?'թ"#e9֧943ًuL!JI)/Y |II+U%I&ܳDKu,y[)O%jm<2D`]+E 5hOȍƎwLq1bmƎIN匥DcRRv0Ê6\5r%ip?I@_v=ȟ8JgoTBBq)Z!hZIHZF%IQ)*# ~h?oX>,~L- )4,Z*{Z ؠ\UKJ}cWjÀ 6Gh ^.E[9;LOGӝmW tbDUխ…&E:mnĐ[HqEuvoum+n HKޚp/9ͭFj;78l(VI6SLBY јn(zjiY+6RZ6'R^\ytHu*MQIe֤DZY8"#Ԁ ~D2\GE?txnk쿂2xoXGun'uu mzRqZ qZ[ WbHė6NNLV;fŲ*/jqL)ݐܐw̱,㓶YV^WwTF1,NDSRN^Ib}6kZ:) L ,?mfėr8b {Fq&jg[>T|Z$]eG݅jʶ^ķ2z(ܣA]؞-oPZ6IRQ) &VI"DUpSfQ B[TXr-BWKv J:3c̃1j"R# uTue-Yȯ۩mvdg=p)K&C~=ĬDz5 Dše ~[Nf;۽.IӑSV9hMfлLjT pRiIRxV0?0OʠA8 ?:~':!钲0θ.uI`we:~nF ۽>={rGF7Z:2YqҢD'- wAɼ\w+W7$:1 SmDPh4c{f=>6)ԑ'Td{{]rݚ0ma )S9y*l%S3$f 2 %&Lҩ:%>&E¤)TD)ÁOEe $Ty3ܧUf8Ukm_]Kdo,Y9Zʧ$LMlM7񨸺5zD OznqL"*c*M>2ZAFizTBqcSjUSjt-OVjcSTU:3*:BcāOέ J2IRz7X?X;F"^?/ژ1v;|')R.kzbdo>ff3@~?S}n_qUjۆg$͓RLIȂ(iOa=@>|A~[Y"?8@O++S~`>?-kz}bl֬)MMv[CHMe9R1].tfu꽥'rկ.e$ m]Nܦ ńjUق0eȌVѯMg)}ɹiާF'"IqFJ20fI.1~wZlOt+ߧ]Cm=G2Z\]epfp^w]łrmiB1ET)f|{_m]}Bǃ\Tʥ=fd[2$0~&rؚj[ViV} r}G1*E-jD]yQc'^GAv<Iq{ۡtj8YUiwj=Å=u9)*T6*_h ?`i›m_7Qmo򮺦ٖ#? [.AۆnJBNѱe@I#| -I%1 6x$v+qʐN6heXq7+%BRXy_:uEGlDeIڧl{rNˋ-Jm:r)%b3NT٫"T1az- ι:7刡rXm[$~yb U>9$g"meBiOEѨ5z'XOV2{u|zf ϰߖySRiI \'25+KҤU:ۈ@{VRvShZ|ڵfVJҩќPf$ |מuhmjQHzE4~.%ܵlgjRbOfD\qCJ{ n ǿG}Y_ {r&ǹL+-73ʶm`VDQkvLHS1r$Oߎ%֖~-=k^WVTTP $a[\j "2M5]Y *=n1T/u׼p`\}V(v@yYڥcǬ8Ԫ_\%qU&KSd¤lZ%׬)ol FJCey{4F>L=~U)^-M 2QňP:wKqS*Լ jTf<>sF٘^_Un3N)-c 5$JH~5v_crm7,m:l #O܎ krmZK*CSѩ$h#r䳦:0^pfkJ߾r 0.Lнl^Qk3~~p'SӠ>4@{M;16kt/>x&/fWr%JĈ= EGğ ~V_գ/g𗺼@Tl իమZrZJW]qҩrju&G.@uWêk-Ⱦ0En=͌ 8%wLD&IVN&_F=})oճA]dT iA|\Z|hX"%! ?r\|CY -lj J꽮k~ϵ.r]5uAEGJԫi1)c[%%߇Q^-zŷԭes/O.$pnڑa1IuM"+S&ED`0up⟜1&$Ǵ$"*5ΰsoBnSIM%'Ҡ^_m?|@z.oc|A~[Y"?8@O++S~`4[sg_;:9[Zr\\6R+)hi qAŖSKDjS?$/{ͭz7J)ܦz3FK%ȨW* ˹^<4~56,uf|.쳔iPޱ*]oJԬWSyi~CMJBŹ00cCpd35.BL`eOUʞ/_)qT=V^Sۯ*z7짷_PTYzoOn(Suh@7jn|(4[S.}4i5m7lԊFD\#ˊ̒Q%fXNrvXE~ͺ)/ˊتˢVΚ| էFkY?${y>B&]6RȿqEbKIJ;V XJ tm@ Ner/wv[*?V\{vFew5kMNꟃ&,Cάʽ [u)*$aV%򫫓r<5M7cko 0Y!u0Tiz|&t:.5FRIfm>O$Ýde\9qK:ڔRLNӽo^q7-մs߶ڕyW>Hy+we1 inKxlH~'[ϗ 7#/\ru>yWҒ雍QLHmVO!Ja-g8WSxzTu%b{J.H\m&7Y"1@}Ԁ a? W [pNY˴̺Y2J=&&լ *>A4}ִHrƓ2:]J?2YVl9me5zU|EvU=ĹGLJ۹ǩR%$tFq&J/5w*caNֶZe6Y=)J-4BZ%sƊ *] +A<Ė2ecHiǑ)}ReiRTF$̌|*nkRʉIřzbc0G\O"5!z[WKB\ZS R_\&J˗ktwq8v64yW^j.Kg$XTdMIەQvÿ{uzu}_lݶԙ6w%iCmT؊W\U R.,/|mNl:m6F*< v\e"Ç8R_q(m%KZDDf`?n~"}^MܸĹ%=`[GWT}Eo!]&㸭VoSԀz  ǿG}Y_ {_M]T+yyS[JnipkǥBK̑v#I2R:MM^)y֩(0~DTm5<ڤUWfd^8u:oW{1RtV,~ژ2}WoϹν,̢-K>6ḪLJ=6NyJgo/r^w[Mޅ!uC:d=vWhGŽu>̶̵hm} 57Rmg'`66wc7Ka]^]nڕtNa[ZݖiD_!_TYzoOn̩@?See=*2{uUeOU[ƛV6Iێf]Ý1o_md; W쳭>֭R흾Y۹ =N*!! B10OW&+DYZ&\󿰲XXq BSVԛRHT,n_/:~?w'V ~VQSlE|]%XXU:3ܬF ZJSb\gӋm%p:HZ`U/Zzm:(2-˕Ӥݶ3nح'FXMC2bv7t-[*Y8RTx-o8c9ac&XF8lFHmɎ! L#QKb5RH nTGumв4e@wږ_𥳐fٶ&uz oQ).UF[UNS`mN:!Fj2  u۽gaWVKK`:TIn^۫V+Fv+TT߷rt$lL*tIe 0J?ge-t7ʅ;k)G$Yis"CN7˔08\no!IQi8 (.(,TڎXmL]qꈈSbħӄfs7#q^֛if鑸l`bMW0uYdn+X,27]io;"ކ:3m?Y4dgfM睵ܴz+w:EvtVdc%dJ\o?gc߇Ne CF/&26Cd(!kyGU[KU:cEVڧZBR)|y$D2 _]ioMuWLﶵMyM}[w[ulYS&dZu$*"2(Az1MdSˑ/)z%~0^jԮZh3=50`'~Ie;ٱ^Tۯjn/%#QIՁ@r-oK$TTENb7tW]f[+'7t$?eC}&jϫdYKhKt*ڨKt}XNG>f\OۦcXC eQZ}]+o@um">] l5U(MRI\.~V\11I2$͍ŏe'i*L2K"%bMW0uYdn+X,27]ioV.K7L{c+ZoF⽱}~G%o bRmoWԩ%(u _IʖD[mQ@}zwU|uY8i&vY9;1%>Y:NV,* ʕ΄n 0a~=KFV6*T^TWOk6Mg'es2}LIOnl.) O)줏)"Q~F_+tmg5W货6騶mQ_KFʩL+,5%Z3FKCΠ"qm*`cX\?5l|mM!')rM*#5~ ? nܷg@jA6w֩#]e,il1)ɊU#^Dْ7;&teNna= SoǼ[64:~6#Uot^-ިv0T#ӛOy22نmʧ GvՋHg秺U#}RO qzm{nҶ9g-A=L>6@?-|c<ҀrݞJt>veqDlsDu:iQU&R$ԫKqFwٻm۸7f2J"+B֍9!oRއGk62Tts5,RvB⒄%KZHBF-J2$)"3Rgtz?SUHU+W3&grQĮ'[Ն2}D%Gm U@~036ڿoۀ?wFYoQzͰ>lSi17V\3kdw"DiKVuŨhS8t2RT5Bu"HJ%ȁRTHnT>tW t)M%ƝmIqJIW:שi#\Z IEƛdUkErJ{ fǤ 3\Sib;FTwn̯؟\0tb>U>)9j)e--Z̫j-q{Ea:5@pVoy?n%a Ejv̭նLt)T6R!I'HIpLIZ=s8Ɣ&X67?kG𝤪[O 2X񤚌Pt}558|S$խOj+R*p"\eE|莖& -,{?p LX?WWGQ7q-vV/Z Mu2~8"aԤk2g~ƬڒC*| ގY~ݎu둩*3E,j^C';ܒGDnum`%\@~;M&ގqp}o2Yn}MҤ-nڵ#!WEqBJGK&=B͒I%l@ޯoparŸimDh–YeuJ̠ӡӢ˕t@ycʹ=9U$^VŃhRxV9.+ȡSZ#>5jLv 9Iv8b\e՚zevbJ~T&Y_Zժf=LᶎunTS{6U[vFJf.Fa9`KX}dѥU_ɥZXT*|?#@B[L2ڜ34o7[nsnv5=kclPVvR+2(uiWeNYV!%!@O[恆ݲ MghbS]v'1[\{۞O&꣓IPLJfٿ,DPՙwWFuz䵦b=HR u)떜M]&=v.l72ْ+)IvɱҤZ]lW\$jJJM Q\@Ѱ_⣻Ƕ L ma3Wuʟug tF\´]Wm(Ģh$hJWw;۬GۙBvff%MA?jj-R=>uF|H!v+5R&_kTi-;Uǘp{(B*;"=J|H3~v SLii,R3uub9nI 0W\4k%Lm?&eZĜNͷQ.ͅ4?%ϵz}c{TU&.}PDsbރX ܪ}FCyuy}N/~y8 ?MϟP/y ;?Oul7%p-:ޮ]]TC-f>pSJ-.cǏ;"0XYjl\92S$+m$WS/uK&+WV%T-ue%-vflv[V*e ٚͩ4#6f9;N=ܭ fFFX7D2fDt\ŋ3҇ Om8Ya<ՙ:v65N%%d ֲUN>l*ib>2|xQ!@|A~[Y"?8@C:7j8mav[Eּ"ĎDȨmc=R)=bΰ) q.xd@=;g;?B2)Qt)mH9 E.\Xn~ڔe&sMW~@>0?-h;0].Vc4=g6)LlPaBңilKt0 d dsroU~Z&˪w2챮 }nT8[qU[.hGd} ?snݦٰ6l7YUM鱚ܥh0U;rk)iEZ׫<:kf|LˊjI2@? nܷg@jhX =;QWSkQ\<흭iiӥ6tq1!36jj J  a? W [puZl\vUDܶAZMY=~ܸ))5%V [)ZdX}ƜRL0]V]cR=vv)2]WJiS(Sjoq۫OaUJR]}hmjGCˬruw_նqaSNO‰ p' ǿG}Y_ {g;}e.;O.gޒc*K/[7_QΒ=2ש2›ru\|iLG5Ἅp^]Z97ޗ{۳d6ᶪ/'xIcS\LKo46`}~I_[7uژtWCS0V'Oq- zZU~58҆.k?MoS>-ʷo㝖I һf'+]I{dPrҭ͞R-23#P[?C&ԭrw2O6]1-RuR#8%p6?[mtl(E>kluHM7rYҧX˓R둒w(6Х)l7?v5}ol[72Žp\"%jVǵ%=lbmU9U Е EL?q:ztШ=T\n:M:AS$2XP)RٕCn ҶJ#~k?>gFR&?OhŠ?K'4 5헀| G0n=B)Fl2v*H!IJϽ.zµM("yc̈́9!Ƹ/[pel~-)"jo[T)$ڄK8ΩN8eTuu;{3lYs)qn"DZSޔ\PZݎqe%6YP:*u˚fyij̉JlZɶ%23K܇$7xW)ݭ#یNڽkv'9>O^.4/6ޟ~U~P>")2bo?gc߇N\ux;fX|HB, RkS\חBśT^ ~!cGue j^Ȱ>*H7ԉpRUl)(J}YG귦Ea r]{qkNXmpT`2~W8t("9!3^ `jnK^M]k..5M>%%FyP%ג8̺YMH"Dg@wu^.,EV7H~e?/J*u)bJyϕj~rٵ)*ծަu^Ƞ*}am܁Bj[r=o\{ݑc:Qh͚ʥHI\4)]NNs4n R@7165b |͜ೱD'Q~p?GȆ ;?u qЬvv5h4f֢.;S}iZ :Z)&AS(Ch3>tun»mgv5LJ^Xkv Cб7[!ML/(G`4'K5lWQ~lk1q֮썕h֔fFPv[ZMn*h_@4=aXokd{ڭE1IՇnRڕ9f:MckJɶ .=EQF VTUZ E6FLUi6@St)-+5",TR7#Kz6-wr[~FHzfCuslsW%(¹MPC,ԡiG7dmd^Xn(ݡtYU{Ϸ JM@[u9T +ݵ{~f$)OQ봙MJ%(6eGq.6!D 9O*4L:Ndj}6OڅB5F 8vD:in-D"i߹ŧ6}v@%ʁ*42dB C2̈DĽLi 1!KBd)cn4nc?e+՗ ,,"޶bKuHTc)icM2uE%叓r-ߘ2NAyzWّozJz}r]B4Bjo<.5~{d-gM)t9a2ҔnTvfuԡ wW&\i)d.w!ZԤP%~Qy=R[):Ķ7%EL7mn$FrjW&7nFߊI:to~ߓg QV#j&~BQ1H1<_;EoKLJ%]?Z20g1>]gF-^?,Ƚ uXutBbz{KU5 Rkt:=DQu4jw%eSI-&`4NZv޼#U-mML?]~Iǧ)CXjі*ϴ%@iƜDO%,:էh{Ìկ+uL3:"b:`Yn=:Ƒƍe !RummlK<Ӊ48ӭq 2RLCF&{kT)#m^͐M,xr*7)up6+L:OpL%+YYD*N4N'dGuvỪ;NTKJ.Zkʊˆf| hD`nU~Q%ٕZY\Y3߱O95&#.sдdc4O]ZZJn%+_5ܱID'[]VR LKq.&I*IQw7=q^ .cu,Һk ϷJaRfS3rUy:+ըIVڈPf8&p3q<%IXѠ0$C[p)Fk3>o=[ʭj|2@/(vySM_zcwtg$xu幮(_c&ci7I?DMp?:'o+1?\1ΉtOWc&ci7_?&7On_b;ӂ]w/l{{wvhg i~1}wkn@_s|(v3WVsW3Շ/Nbl(y՞USrUQqZ9E*+|a1ΉtOWc&ci7^OeF-弩S]|eThǯd;Nn*Ez!-*RbImRxhI|No76 npwܜngȐ놰Hz+Ҡ5FZF?zdO|>QЧ \xdo ϣDD^Q襑u:Qpl)VQ/W1Hi22qv>i45O)Z$Y*Q=jiSuloKjS:'[K&t;MyDy"C4+TE oN٧+Ez:d\ۺKG~X^Da䰲x >(RFsFA)jP:r{ӥu|%#Q=/y> &l?V\]o^n5;l6Teffhe9'e%qj|<<* /uqr:nɱFpoI>-P/f|ur"۱d% 7RQ5Qy6mM?b@[n{j| S;GwJZ M >0DMp?:'o+1?\'<yyhq[Y)6dW~_qnci~e;nvkp&:}KJmo)n!sQQri+\fMҝ8LGCT9o ĥ\q۞1\-MF(~N]$~CW2}RQ+qabSdV[Yxovk$J8hO%l5_TZ)RaիuCѝ\Mn|UÊij:? lu)hui)I23(NZI#^wHdDjZP}&fDE|2|[}_yZRvf"Fڍy^첢R˄ִ̈̀M~FgY>I^{w]e*25=ܲ)Ѭ:N]jЉ&Fj f'ufmΧ|oS!9o9eq-|8ARS.4c 2\;qQY)$`>KNձ--c6h[tvյ(v۠R#E#CR,4h."pdfƟwg \Wvx_t7Ž/?jr|f<01?\1ΉtOW=??Mvߎx/EN?NOs;[s7W,|lǎMm]厲U_R2Ws$딉+Χq2IT(>n{]D ٤Y2.*}*uLIrߧ2.R [%}hi@n1*%qo1*%qo1*%qoȵeC-[߷ܣm54֥]M\УD1XlUQJ Z)`-:eODn?m:eODn?m:eODn?m:eODn?mqڽmiȵZn 6:v.˪$"|퉇Mzf*o{}q?c&ci7I?DMp?:'o+1?\{/v>|1~pw~rtkW#_sxqV0Ve_,sblp2q>G7XdдrvHC"25=|C:76saS> ~J"⻍*)<#_)DP0II@|Ȥ&|nyqbzOF$MMv''~L]/rBlƥ|Rc\/|70u yҮjTu5RL̋/4ob&j[ؔHnWDQ!]a1jimJ"3l$Zo{⽮@\vS[(w]ɶfєաASiQjC)NRd`7KLW]~Tr3V=>+yS+a)&oJ$.%)O׍Dnifnw/P~U+[צiDF9s.c\dk^2Kp};lwbW:wĵMeJ3C7>}ө6o.RX'&_HT-s9BLvaaC,LI h$BH"""ЀD^^q-FϿͺ)+B* vb2]A;שu Ae0ҖIJ.!e֣lqrT- 2v]KSe>ߺ}n֢g_Vo(UYiq-Zxkrdqp휋=yكjr;emg8#2V3O#fQ(2un{b Wb~0K_w/kzMtsv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},˅ջa?dOc^*6=F=w]*B+un{bya엊C񍵽&Q}:gJЊ][A؁}^?{%⯻cmoICcNuҡ".Vq? ,_Wx?[nPӡv~t},+A5}wc{ƝiwK}wGks9ܟ'*ױwgm.t{~~O1vyG^.]55Qާt~{툝n7?@.Vq? ,_WxqޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^XV-ۺC-LmMX[յo]ҵ_kSh:~ɨիjƍ}%JQm{+KZζ=sܵzmܷ(6׫iԊ%N*zBKlFn<%J#;Jl̢()JlJQDE3S31GojѠW.ص=Nn[DJ-ޠQa?R+MN2d8,2ږ%)3*?un{b Gya엊Gm7(z{X?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W]W&AUs]L]0TmBƐ>TCNΓ~ j"SjTwQRJ?b4uSζ=6sėPsmpQ'͑͡{f"#GSnS4%I.OqvL̢D3IfΒ%=>*RS!ӮzU>DI+rQ®SנƐDZy!-زu$m*:?un{b Gya엊Gm7(z{X?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^X? w~8?/dUzm7(z{?:T>W0'1/}އkzMt;Εp=색b~0K_wޓrǾCEy`\.a l@X?=W~1ܡ1CP^XeAֵ{Q'4T&\+x4tXZ*}LhS􌕊zʶu}uEҹ,˥]٫BRm]5yUj,2- q:j&雃jU- T *SHXΝ Sei е=Od3vEYFmMJz:7gqT3_;e\ecxY<{T"|(4F*QA ma<%SXYVƇSIDMFAU)MOJEAq49F|.=Lk W$emٱqi\Bvb)JܥN\w8F|.1F957Kf)@&-k ύmFӧ!ۿ|?On?FVBdvq?_L fl)ʟN}#!}2n7'oO0;gcNTp;Y q?_L{ف>vrӁ~H*_L}' `?7S>?FVBd;o8Ow`wϝw߹0/ʲ!FI+|?O~U7N]'o3m*}8 wѸpﯦ?y;m9Ss`_d/CW}}0 fl)ʟN}#!}2n7'oO0;gcNTp;Y q?_L{ف>vrӁ~H*_L}' `?7S>?FVBd;o8Ow`wϝw߹0/ʲ!FI+|?O~U7N]'o3m*}8 wѸpﯦ?y;m9Ss`_d/CW}}0 fl)ʟN}#!}2n7'oO0;gcNTp;Y q?_L{ف>vrӁ~H*_L}' `?7S>?FVBd;o8Ow`wϝw߹0/ʲ!FI+|?O~U7N]'o3m*}8 wѸpﯦ?y;m9Ss`_d/CW}}0 fl)ʟN}#!}2n7'oO0;gcNTp;Y q?_L{ف>vrӁ~H*_L}' `?7S>?FVBd;o8Ow`wϝw߹0/ʲ!FI+|?O~U7N]'o3m*}8 wѸpﯦ?y;m9Ss`_d/CW}}0 fl)ʟN}#!}2n7'oO0;gcNTp;Y q?_L{ف>vrӁ~H*_L}' `?7S>?FVBd;o8Ow`wϝw߹0/ʲ!FI+|?O~U7N]'o3m*}8 wѸpﯦ?y;m9Ss`_d/CW}}0 fl)ʟN}#!}2n7'oO0;gcNTp;Y q?_L{ف>vrӁ~H*_L}' `?7S>?FVBd;o8Ow`wϝw߹0/ʲ!FI+|?O~U7N]'o3m*}8 wѸpﯦ?y;m9Ss`_d/CW}}0 fl)ʟN}#!}2n7'oO0;gcNTp;Y q?_L{ف>vrӁ~H*_L}' `?7S>?FVBd;o8Ow`wϝw߹0/ʲ!FI+|?O~U7N]'o3m*}8 wѸpﯦ?y;m9Ss`_d/CW}}0 fl)ʟN}#!}2n7'oO0;gcNTp;Y q?_L{ف>vrӁ~H*_L}' `?7S>?FVBd;o8Ow`wϝw߹0/ʲ!FI+|?O~U7N]'o3m*}8 wѸpﯦ?y;m9Ss`_d/CW}}0 fl)ʟN}#!}2n7'oO0;gcNTp;Y q?_L{ف>vrӁ~H*_L}' `?7S>?FVBd;o8Ow`wϝw߹0/ʲ!FI+|?O~U7N]'o3m*}8 wѸpﯦ?y;m9Ss`_d/CW}}0 fl)ʟN}#!}2n7'oO0;gcNTp;Y q?_L{ف>vrӁ~H*_L}' `?7S>?FVBd;o8Ow`wϝw߹0/ʲ!FI+|?O~U7N]'o3m*}8 wѸpﯦ?y;m9Ss`_d/CW}}0 fl)ʟN}#!}2n7'oO0;gcNTp;Y q?_L{ف>vrӁ~H*_L}' `?7S>?FVBd;o8Ow`wϝw߹0/ʲ!FI+|?O~U7N]'o3m*}8 wѸpﯦ?y;m9Ss`_d/CW}}0 fl)ʟN}#!}2n7'oO0;gcNTp;Y q?_L{ف>vrӁ~H*_L}' `?7S>?FVBd;o8Ow`wϝw߹0/ʲ!FI+|?O~U7N]'o3m*}8 wѸpﯦ?y;m9Ss`_d/CW}}0 fl)ʟN}#!}2n7'oO0;gcNTp;Y q?_L{ف>vrӁ~H*_L}' `?7S>?FVBd;o8Ow`wϝw߹0/ʲ!FI+|?O~U7N]'2.2IlV-H ]ʝEc[ mhrf' DũKL Bև}"@)e(5NqFӣ!> *@E׸UV7tPROL-𚬢!F7M31xKE5.]C!_e)0=ؚR:hsmh\=z Io۳bct-)ȄS1QJp,F|.1F957Kf)@&-k ύmFӧ!τ OOGn?FVBd;g8Sw#{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]'7>S>?FVBd;g8Sw!`x@_dNTt;Y qO_L{فy;m9Ss`_d/C~>W}}2 f OOC~U7N]',7'nڮ=U3L(YSj!.w=$ډZIp,xxʿ'yV6Aˇ(&0'넿xQܿ_' /#-ct'o #SM?+IWmxNt`n}l_,0 # $ m/u5n*Pϸ*;TΉ*Ԭ34Y'd0tU>\S':פ.cm,uI{T rMg#8Tj=ܿX'_`XtKuOEuJڋT4f?%{}aⱋF)PH_֨~C$p*A,?wl?hjV_?߫GdkPdVپ{&ǟj$ZX_?X?߫Gd *@-/?;~y5BͿVoLoգc328 ^'/g57.wXn}cw\I__oNԬm@_P3LaOmU_(V_z/#-ct'o #Q6o/ ݹ}_[ |b8E򭪥aLXo&*"_7mKIԓݧn [Õ,newu'^=]0k,rtزաA{Eor/mKI֨>Z7!qmq)5pddJ$lvCOTY[-]ͣ)m7?7rcDVFu 2r[y}n٦zyklX'gWz|lapQ"M虞By/-te>b#ڱ([)2}G 5']|Cnk?v;;n~Yۥ`ZUl񝰅=&],{X"**7C0&<&Rг4m.nhXʻ{;R,^]WOFUڏ^'PK`uKLB=}̟6LRΰ$yաZq>:wGޯ|%r꧴Qj3yS! ع^Q]edIR DcA)#s{.YŒ u\ڛO֨e.-fDyh'de:BՐm!H)Z0]h51\#改vSz@oGci`3iYl' xNxju-fh75J/!ShTXĖ[f}laY dγ{s-Gwǔ-24L3l ?p.嶨w%Kux\Ć[f96N ҾODAtW71ufܛ;άUkvX]w<^Sߦ ۈ )纗nNSq[{i#r.of@zؽ<я%[ka]V.cUe9jMAs)dۑ%"E=֔LS´ui%!ԙcC{ٮ۱QOU6lqMS,Yߥ,jPЫ;snM.y&t2Q(M!q:5՟6+֕o~Uhm7Nڋ۱t~ҳ eǭZ_ߥ^jh+Ǻ*)Kq7HY2ZJ&Gyf7mVT3L(3tf*9JMFۄq̋?aY=Y%T:nfꭰd\9 cZ.y-?p޶pNfޝ UuiCҐ޶uloL?3GᎫE8|qQPr~Bʯ+bhNfޭXԘab!7JCr sN4e$KJZ=xS~ b!E۟Vѳ|M-mⅼ\l˂o )էu*'CŽ̟֝/bimu\B̴뎀zPw3^TʴKsGSbDqZa$?/!dExJKKW.p̱اiFuWXǩɲ4ܓG/(.Lj[+r iln9Ǩ&c=vV屸K5}X*}RfT.IE"y^a]2ՠ\a7OLXQ\fRJJ__ύ:|BtZ".:6En&ʹɹ2lD{NLZ}=ѮU#^|I~ IF'\n8nVjE $Ѷヲ4j%{i1`@~+vvmjI~ IF'o#Rl,v] R~FEēJəAmKug[M{9]=ݔKc,oP1=&^9×d[2'6U9 ϩƝWOds;CջAYNiu\X;cܮ+XvǸlƫV@Scɻf(j왎p#v3TTO52g"CDJJ5Bx Gdf~8 s݈foDՍjl{k|Cݮs̺rӪamljjOIUJKQ5!?%_]LwE6խklzSlDfⳜq؎ZYrPu XANeTR#ʑ 1鈲Y()OĂJKS2={==ǝNV^0K7su,)7չ\UtR>ujvoH٬v|IƒӋ6$i뗪feGs7O뚗Vs[^D}ݠhM]ZqsdRʌҩ ވ̅s$67 iQ%)=k`RlޗRzQܲn E7 1>SXmn監8 Y-{ n+ho]TmðεNeYBR̸Xeo盤R2lH $ʖM7-/b]%lSqlԝ;h}3u=ZYlg>piw*b"LCe6T+u{-!%!RG'^\7VEiٶw`enS;U%m%/^ȸR >}y`JZULWʎ]9iB^&{eoj2"_-|M(xCwߖp; ]MZWmdk9hN5ռ!Rm&PiJP$=e{7>#hMSJ@Vh+6h[ vÏpG،ԛhɴOiJRDI*5B'h~/4$SJ]:8TZCfwSgWn3X|r9̇ۺqo&[sp:ƓTv-4_ny3TNy%B'Z&v{.,s;}d Xp%sE>&a{L&j,iBq=KYʢXWVq&8H.>|sgYc[NY]N^sOE-l9596:T&N=&ZJq6QLM̮S 5ܣv:$zW9v 3_$8$oW\m'@ɲZú5>RDjR3{:6!|mc/c>d=}dmc @KT+Xg`hOZTwbAS'QiL_y=^ۭ̟a}cY 3'?)!mV4CՇ3ڔڴwb™R8'PmL]MQL"+f$9%5BHd4 ˳aE];\|}2BVt4SEŨ0W&J_ me?[|-.vdgsf*G'6b2D[ۊژdcڦX:J>:+R9>N>#<ب& rfq&?CKDhhG@yխE96Nuپ1u?:m'5΍%j&i'ZӠ&[3OG ]NήZ6rf(0Ig7mK2͎ZaTZHlÇOMfov-unvƧn ChjWp"FU^UJj,|ZLȵV&d*N9O0ƨI񴨰Ti:KH-[C\RL>`k9ai^j9PWz[6Sn-Fr*XY:M"k[-Ԫ3P[:F咖ZѸ}u`,C|ڸ/>]iT%̭GfQtܯE.JIRD5&=,[:G咖Rȧ8=q:Rt\DN5iʑЦu? ]čMgNOArVgy40I@=Y}[sw\_;@D^llP*yW"SƳpD|s%FC!;v!--[z1l 6bWF Q7q3ivdQ)r!RxdR~T(sV#qūd>ƥɒ7kObu֊;^9z ]HgVFةW/[u"<_rMqwZU+&%Q!ΦNS SD;n)f};4]E{+{vyqSie eĵ8W`צQ9zQ6B沶e*=^g)^2ɛʻۊkD{n2bۉ2Xuj$,Щ*QDW*+l\} ږ] !׃^ .n{C1˿2qUvyn7%_3i*ӷkzf` fڣGx3W9*%6MibvvX;Vk`pN֭=V9W|Mcͪ3FdsRQ!1il@Ujl)N,LnmuLUoX6zCSTn$[5y$F Rji"J#JB㾦$Хӻ|Uu[vK!ؖrEVmզA~=:*q?KG$&<.;lMd%U2iQ&dv3.hg`/s]W'o>o;ou6WY-[9KbYx \->#] 㙜PRlpmЋmnު-HNcV)w+yqfqejo?Iv\MqXU ޲QnnMl]~o/n'*V2JsT֟:uJ7(p75r5 V%pmm-TiԾ mw%_[ĪXl5uvJ\f`|F*rZ7qaNU*q)]kmmLqrKf%O!K J qlkky3. g;PX0Y ߟ"¶>X4׹m̀nؔYe-%q.\%F2O_GND>qmTpH {7KQY ^VSG6R7Pv*.ɈN)Z GʛY?#:*%xY Wj-[ Fc"yܘ$%jЌtrU-o>ׅFZzk }oX7T&m!;|zl{J Ph\a,kms[FC{#9}uK{3ho o3!mjy}yRTn4ζ69xeӫz:k-s[FKsdITpLr[IT)1}f^odRZ5ELw:)Hii3m=(1l9Heԓ~&J#: ޙ_{cFtp<uv~m ,a,uoz]K R|C;)XlsۆnmtV"_>RKwiSR\H*JqsrDS;k6JZ_n(pІRJ33Zl,s> gK;pd*x=;6y\NzUy%m"O[EĻnwJw>mvj5rQ*<o|V)ek`X?c-{-GZX}*pVO\. ٭ܷL̵Z f QN8W W~p]=h`6EboKbřJːYB\v& )Pӟe *A)pyբ&S>%8鑩-#M5"jjx3766vy^rj\uZܽfӣήyLrU$7"!mu[lgeݭ.+ë7z5^m4]&urV7lezkYb:y mGӪj6,fiEfc,ҥG2yIIp.4x 5'?䪇XmߔL]U ;,kRO#eֶ0. {ӡqcx-!v9Rέi}A1}bȯ/*4OYUl[X;բpcګ 8T!Hn^s fS̶dwiK\G x=O[Vc3hsں6o%|PspYA7%:]Q#h%( PIs-TNv\j28#mJ"Odթi1gT%턱u[>w~8V+x:zwC,bUFݷͯ: Y|;u"F1ꗼ= 놼7 N+)pǷ096߷6U\ E!8t9 x'TɯW$)QFG@:euad`i\yC!]{ܘn(>{ݘŧSBUjh)ko|,PTpJU':㻋&_6/R,A[zúqOw'Ě%.:Z4Zۥ=hO6nH%4ZEz{W/]2l\nuQ! 2qpUEė-t5ғRNI:z[R7\*w";m\ޫx'aIӄ,z4$M^E)5$N7r^6š9 Ykk/쿰7oKT-Pz凮t86|{66aUM: },gQ|Yԕq|Ciw g2;NF[ǔwb޲qh߆*,3ݠ;)uRe 7%L)A֡MX?jtV+8o c3.6G u? ['$*=󨴂7%L%ZCcU3Rn{*yNKIx"6sdo{/⺙ Y/P-Ǘ%iҹ \b ӅReGɕ-y=ۗczyoiz]/aw1Wux\6Zu/ !L8u7P2帪eF݊q44/M8%$̼C?r@=gCG~7Ѷ\7'K?mW*Pmow3s};oJ:3n4,bZrmbdI^MEGeJT!-!Y]= ~Vq'6L20Uޅ7$V\eT;vS\IS]u1u*K3_Nߺʲ^ncccb15_ի4jVêEGqMjkmK tYwxY0'XH4D=yV}kFٰ, r1]_u45JΨqToi\٣vZZ"f~A B Mա민 q׈?l$WWzZJNkBgT/Ϲy _&LҒ6"׎NPh3#ZI5D>2b:|j#x3JHY kZ&̾Z%pur@閪}K7ɶoMɒԲCO+)US|"& fjAjky׺:iU nm#d>N< Ј%ꤖ*}$F]ɞd`=%iWW^GZM=x;3gӉwr-t>cN[W6NG"ms"6fN&/۔.ܶ2}YT{^ꉠA5Z؎:L晧$fn?g=^~:LLj7w['2zuWo\-y:y%-CMiËȉl'qjJR_g]{>!Ai2c[7w)Zc]U<?- oؿ4]eaCDOR>`Z55+#e6K)Č?GVFX5&:2_횓I5=MJF6lw<,.xCUQQbܴtq~Gj-'DuT^ܨFdTs db˖݇i`:U)"j JO:U>jqy+;|ꬷ]Nql16ԒK KeZI$]9/ƨu-Fyx#rBGn3zUℸۭ9TE)J&:ZD۾0 Y5 |=aNF0v6W1oƦ@ fwznpR9E*Dej5n(4LJ{~)DN>{ ݝMWɳ{\:ſ2ʊǁBDTTţ|(I;ΛVM^n=4u]$]ghq^:[J;Y 8h H΋)N(j9KZtB :~\_V.+]//hYmUl5˽RtWr"U` -112W%nSqTnj:u޻o9][[N[^gj7VSQn$\J 51N2W%N%TFYKF5Vqk>kfvc Nvv뚺 u~бMZˋl౲>EpƅW/{ҧl.-rc2ˤPrRߙ۟m>ԭ<}b?o`vCŷf*UxԭŭqTJJSRP;j5Qz9Ƣ#Ri?q3wsV5Y5-lm.购vJ*b%ݪ\; "{TݺP]\,e [[6ɭ&.kVV5ALT u*k.63&ȣHKbD29|:HsGYI&駎̼MEWq"nn w0d"^Kj_PtJmIҗO`C5(~m{~Q=3dȳ7^G2)Qd|Uxe9X]:Ԫ'R` D5F&8S^]tᾧK;LQ呖>L+h%n3q V9k{ٵzwnq̃p;-(*ܶ۔oeT O8|zըׯ]cu6UU6FMϘn,sб(%UҠv&<5er^p̬ӗZ\l"cjuLHKEk5%:x`<ݛV߾jȓ-o aJJn-kTk^뢭[nನBu$8jLVյj$xzVަUF|ݳrٱDu6:\7SGZ\/!.ʣUf?ƖG>jT栌ʁ>,3~Sv4r:dŕc!hZIHQE]>\ȅ:L-#K.3fDYQJ";4- "RFFDd--:ˠ@M=E\\ߔ9iX5mU[]bFN)f6+DʑjM-OpfWOR$9_,s&fJlj5r#%em:3Dʑ$rM-OpfUG-`WN :vyi^2>k@^K"9kDR\9YnԭFj:֮FʐF.z.S f9˺D c'Qmu|bluJJD|k*FEJm->94njIߔ~,a}yZQ8dFߞJ)i h6#iQF#iR5K-ߔY,i]wۗѻw?ؚdܯG>FQP9G'[xrJL.VJBOT+ 7PZdS%SFn##OArڈC7xnexzc6*j<r{^nW.Ŀ.ԸUDl͗#YU{b;ԻwAlGEY{[g2Kr/KέNWR_Jn[EDЃ6\`5APLFKśS*Vֳ$]%8Rvo}obd;Ő]nD_x:)juV0mȨj4HV:QL5:&q&QVZ^w][ztBċ \T'q*4jOT% FA܈Lɉ,T]L .$HjeMʴԸH.4.>c >/v77t7O 뛸;'5?m[^uOa$=OK?$xq[u44o[;1A&f"J)NJxUOs~JBqp㾶6{:q9iUFAx>`}C~L|ݻ.|U)x"kƸviid_ݭo=Uu˓#p4i~& viݎ..mulc-z'K/r{c8k7D&k距]WKC6ON3 KTb*T9N${ %h%-:`ӍOsFSj4jE^UZ6U6KE~ FQf SmI6ۭ8Ң##!Ti EBu&e.K*STb NB}qAJdI-)Zq)[kIDFFB223#### $ehOFxW>$0V;9}gUuA ۘө.&?s:2Z *Ʃ`E:iW_bLqX9[ͥZtg$Ӫ^w:g]EOcڕ؞S3PLs[KrU-M-ҖۊBAi2J %Mz@o"I7Kه6bo+s: Мk#Y`̄h&Hb6.SF3K~D-0 4::J5)FDED DҥJyGioȑ!XayIJRF(ȈgD^(l&m5\Wx77 w k5ź=- 2:T%?) L/#7y= \?\Yw:ܦ1r7}.fȵjŇ9՗-92aE:\%?% L/" S)Om-ˇ)C>д3 yJ;K.S8oa-1*:j򺘷vuD^*$D}lɅ_n)Py/F[TXjgqJ;u[8r'{./))Z\tY..Ɲ"LBԇPRђ1#jj[d3f5#(dػOdv1Um\xfȩ֧֥@ (kq|7CrDݏZ__?TYtّ!zm |܎߉@GoT8XjH[R""HEyHV'.#[Q#% dy$SSf㝯Pj&ڕ*ʾ)4n($^RUIY>ӍE`=#Cn:OY "-]!2ҙލla/s;(9Z|7Nθ&WY;5F}|edTVۻ-]J\88&ҪZ}RT4e ߃~LӒP/}חg޶]Iq-U-۪(+tD]VO6jJƂԌ!yN!FEJI# [9 S^mFQNBu[ C&. 8NƢh aτ_lQ]Fd?K6=캢zem\v~uCrhsߠY!pv=0~vU+5%1Q$t]a$r=JJR"]-=x`>SؿқYVF.=j<?-!r?vWWah?p?w^?ͥSd@{!rW]6k| Ͻz{%'Lc5СbLTgܼdo&iInC뿈\2<+`=uX̴HXɼރ&*>JƢ74+"kxK椛{P2hZ+s,+&پ7&KR Yd[Q媤:C5cR&'Hmز"HEYcap`e)sd;y"+5]K~S* Tԉm4دŐW'ި ^)C[yݫB}[hc* *7ot?dV`??}_>K ջG}[h#cEXh=vߏ>}^ֆP>ݭI>LfqG`YVXnSϬwP럩3IvhJt?*KpEդ~eV n|<ӿqcDz= hx+9>gaykkxN<ڕje _DV2 %i˥YѥTjPVh%^al9Nu/vɋ{^M߷ͳsi5{eRM*Ls5Im+4EpȒ:kQ!ĸ LDF%^\Sջk#3&s󍝊[u[ҷfdL)Pn̷f)ݧ~L[lYz7[tdVMT)WW2Y.͙MQ⭵&KfFS8n^ʖt)2nF.uhr*Px59>y&"$J)YI+UQ7O HDbkMKY^ǹ4]olOlo;aBEO87zN,Cr|aL.U6̏L \VXi3QPI=*l֥uw[h;mfV[ɗV-X 'ji6)ʧXw) 2+,ԙ(Ԕs^6LTJzw\TtlˌlZ\.x #Sh.ır ˿+ٗEݭ[oVcUnz6ݴ\Q&crj/vڛm):'i"ߞӶ=\{1͟vp HYUKoL\FW,ijiM4*1>Ju:495jХ6H&FJZק cjeXogGqwU*Fn*_ʹCK๥UbnL:/[JTn[.uIs"ke2Ѳn/^S:f<(k( փb]5MR-Գa4Ĕ9%*rYL6+$uŭ$tWN.?'~[٠ւ+gdͺ]zKuѭ]f~ʨe1DrM..Qe>W*m@e͡סNZvH̀kNSnlkv*1^j&&r ]M..QE'hD ID7SO %4Fx<ߖM)VTҭjBG,z 3jQ֕O1$܁JfSLvEI e?7͒Ʒmwe)4bȤ@YT)2flk.֤CKVm"\2bcjHLN(1MzPԐ%)#>΄]' Tq峓 a8pn`t[Rf\Sm i.)n!-aC#ks>ݮqrPkDLoKޱ>]ivے][(5-Zj>)ڒI435̓ѡY}`xWjy4qmtYE9v~%Vat˕5rji+^ὯMne l+k]5x)WecEBsʓ1ؒji+>kQبG}.)$KQ)h.5tZ.կ15/'az*V6jrMֱzUmZͿqɫF6cTy*9[D5TԺpeոǼ9^e.&r JL%4ꥯXRjܓGSu.9Qh ̪DN>cJmDzF4Uf:b^ޭάK_;m ´W$bNm EּTT^L+"U9ߊǺWUӸ,[Wt{bdK~p+ O0LST^L+sњI\HLhFLYg H=:k0S:qoʵWk.lIdL{&3\ڵa=hwiz{P̄=Ie}ו^gZtްu }Uzבl˥ڭa=iGIhHARYu>ʐ?%)Yhz;Ap\3.7*uCy)[(ulw8C7gv?sus9/;;TUS1gbRzεƦJo:ُ=Bk9DO7S|Rr$JS|! yS쟎ሣiFuWXkl M-O@j--2)k:Z%;LSy%q9&0D뀲:жdd,kZT'ṪF9g^7m:h_tke~c9tF\NUeYrT8%$ 8EµdF@ ν޴Q0 cDŽmZXFj.9p~˹jd^ݵM\ie-[gTBh>=c9O Aڮ=mx^5%i #3-\c8^MЬ)ۖ6LT3Q! msX=J2j;)pRsח…$J3/3/d/m빺Z}3-D@͢Q&NJ[U7k-ArE)nIN6ᲽuxP:V{ЄBczm^Q(q&YrNIڽ=rE-֓nAN6h`&>aK.9}KUM#7\ON=z;47ucYW4ILo-L뮳;-wB'"ڣE4oJz3H}Rc6WR&DmYj2N-Kn;_ww2&2ڣU4o%/s"KKROfbهi [9>ף`ѲԢT9]N_[lWe2%0Jzmr#D)=6ao%4||K6OZBƗ6NWj6zEhˋzELI^5t% \Z֧;lē0a$ڜ5xV4,[}Ay2dfəv$Exk syn. 9\tRKYңꪋVylmֻQ&HY^w꼯bp2]Y]d?=1;܇~9ZsS-&CXR9El- ]M!ze-m\|FJE`2wv`2F,U۝;lo[͵p]6ɒ\C 2d5-O*zCyxY}wV,ye{zmJsjܯő<&C8i3!ɩh52qEzR橚-i"jJp|緇]5Cjn6[NƔnP-5^n ѯS`[֭) NjS*d]y+Χgnq;`)nV1\6pe]÷zZNTeդI8Q'8n]>s_lLD&& DI#RH2JK@|YuŏVjoQn&b7 ȤVR-fS`# Qq !gݗvͧRzuY춪NE*jqj6NeĒԅ RRJI2/XO[z1ZW$`O1%ѐ.޵}/_iQ j׶65SϪF9ns\l6MJ]h d\)ZxlpXKi_WSWV*(4*uN4s^mMT'tҜ'.rRhY!jim롟H@jT^nKް{m[㰬Gs[don&|쥸K +ޱjuԩERUK*Ù!;QuEuۖɸ|5MَܶV۽NLJtܝ{WfiKdt.f5.]YT 2ԛ5qG}'$3Nqjn>iBOF]z]w:?Dv-yøam޴xT˵qŏMh̅S٥~Ha]؝_nWztIF{vp[ Kw&læoč"3ƚlQ%>mWLfr Lz&nJ:\KJH /]s߯g;=! Wnz-,?mSsKcz6?rkc"ٖGcyz.['hbVzuQۖS,aºvdz4|GXƥ%L>:)|՞Tk'5O/:s7-v\cP1ZǘOIyr̷},&\rtb7m–؍cXXNPt|[V2,+&0f{a bkQ.oYO%(rtD~w-+1'>s'V!-25e*㟎}Ǭ]Ahn,^5:γ$[lt)%W.u \{A$}d["/gtPlhZ|wc-+:2+8Ve*SNj"$E*jKB(G m|3=L%ԱmLBqXvQڵiYׂzO~·25ǧ"ga-$|Nw7e%:2n[Vˉ/n!75.護"լj&8/Q%-$iU%/:KnsKe ҈ϱ.hU{6lY7C-}QNT n6 [4HWu>*%NT^CD4ʏXŶ헫+f]N60[%oŽ8}'Sc,uWS}bTZUI kK0sE"=9rzDoնkT(C3?}x<Pn!a?뱸{ Zl\?=n@j6R}?Ɔ !:fu{b[_t{7ݕ_)T VE>[Ȩ<&e|.6,@ެ۟`mO!MSW}vrKyKm5FNiLgXҩ4#r>HL2n[MO̎L'<_a[#W&/4ߞ} qQ8ÌOsV5+}^rVuICƋQjI0nv_S,?ndfd۶<﹛ڱj6)]ڮ/ -uuVD)Zdh,\i\']ΐx FJf24"ݿV诊vjU2s5f+}Z>L\zRKNTlHzu(RzEߎ'DUKFalTZvcҪЧSۊ@TeS+G:#/OKku(RKP&!d4D:ddDJL>. ヺ6urɳz yml3FVa'6Tni.\_JKIms^ߞp6fZ9T W0-?"۲fͰbW8y$ʑnVe]+KSi(yȭMjt%gJ<yő=O"| /}Wuxn̒R1v븇sm/ٗoY)Q%6Q) ZjJqʫ ?5IhXwW%_v61^AS# YaI>sp1DrCRZ7582R鑭! Ȍ-|R[f:L0׊SVymUn[]lʷmzIID$MMz$'e_g|rKnF?]4޶ەAjq$En!h6nbmKU]J'gқIDmJ%*ZM*2^0C=mKrWWԎk\(_]ܼ[[b+vloMa\ݔN?)["eT6rߘ2re-ݫE؊ݟ*2Kt|$d2K~atY7E'NSn,*8/z+_qp~-[x:ik5us^Sd]>6DZeEeNbzJ)!\Š::z:m){sj6qlʽ_VZKTϺPpSHW-.qh: I2ZfJc%#ͷ5=TנiTʉ/NVJä&0b}h&mhr9T7 CU)ߓTډoUV vHj]h]Hr9T7 B CUmt=5nj5lY;n zn{:7 Q(1!hIRMŋP\Jyr:kSvWN TZ/z[ss/M>j%4}2n[ֲ۩;W'SHc9M5ۋl)e/ qʺ DfG`?P^sv7_ZBw 2nC3F0anTnaY*\^,g.,5KRCL;eclKsN;_ZMrҗov5B:5*)JFqrB:ST-Ĵ˽[roK>Cȋ¤#UhDHF.ɑi8wYV3*qw[ 2jE>/mxLk-IǞ;%Wzܖ*GFi=oSklT*N9'ѻjհijO:ޱ| HMrȒz9)$}OR"5yð<нo*kLEJs*|7wʶ̑D%k^%oStɴ-kWW\ƽuwncMLKqz֪+q|s0:k.؀KUiIq$Gd'З+ ڷ2cqBcѨYt_~ZFh-o+S*m;4JqRרǕֹ{֛c3Ne\WCxmQn;L/ xJ'245)m|9S.MB Жmz)I%-2tŝa]dֆ:-[=ɏ3ؑ"Ol=MSnG2 Pf+Sj8V#Z"nj33䝎2pm#o&ulSmܮYfE +GCWk1>Xʪ[-~uRt[BⰭ-⹉ztGa"6-U*Eד#JHN{7⮱mw;{n X8ߺ C ,2-5ד#J&fƺsW%hR&j.A(Q:eCRoήZαm~Zŋ6ǒlhɌ"veeOZ9m^'3!ORYv:uy״{ֲ7?nUk^dfm[&&@$r~vfXOZyeZ;>kRp]aO"JsrVk48eǪ.8˲~ ʝd1;ûзurZ5 gwtelqRURv 2Զڙ*a볦>ϞrD}b<;YC݅iw]\f ǕToiYؔkqι6cPQ>1 T"5HlCiC^A)?'`xb(>%W"~b+_~0J@R5C ہV g?Oaӻgǟ>YkCU-ϾnjVZ?&3Xʃ%$pq\:.z8j;'<|\EçK^-;:\:F 5{{gqjww/l.Wmv\%)Z1Q_CSOAڮDonk0kyHJ&~m݊|誅2DUj|TM dbFdeDuk'T|2 zOw}-~mƠCk5c pQ6EٴMJ8uhJW3Z-2.RmEsR8( LORTdh-:S⊍*)1g˚DDʸbDWCQ!?MDieI"!4zG6J%:/}na:6}+ci{}C~Z.cZ6[CǕ*#ToipI(ΙWuQKI' SqZj&SȏRL~ O%3=O&ҪIucQ-YL$!L>:Lh#OT)KDЧĴd'N)O k}in}Vw&ȝl}ح|-arM\=k׮6Ũ^{"uBv5( Ň1:L\cU&OfTBCN2hKaSkC-Tנ: b<ۄ4eZдJzz.#sfZPpmIeږZuo+usup9r668)RJ:=lk Rg=vJLTJd,lEڻ3Bԃ2fi3I Bփٚ3#]MHM-4)H>ONTce]}ٶHg:5&h7].=Ij,S*TJ&gDMj4ĥԶJ+QhU+-5ID7(WIM6Ӯ|4N #.΂^ 5B>hQi|B[|G¶IqhZx:$y5<7F{Z>D0ٞnrK{];vޠ9\~d o`eZ֮#?fFsT]ye,Q:ڨ yөZϲdK]]S]A!Z!ŠhZBI8DI-{:%FEcz1WfjۮӘV65 J2KP1Ii.<҂"Rzclu:g%7\XljAn)j#= _ ACԅM7)i#GaH%jAJ2>%GpECK5Rϲx*I+T f F(~=u6U6Gke<gJ&~Y xV-Ht{ġti1:,~|q]ލv-op7 LĎS,^2S[ӰFf~1 ]!̧TI/%R% #3#Ǝێj^2K+JZ![v 23u9vˆIuT*fC7:n)Qit IK%6KRĴ.*4StD[)Be$IѢk>ɫMǫV)脸:dR4TmilhjӤTГQq侗MKYf١:„?;uM,!0˶+/UB96o9Wuv^˽eR_̙bFC«H&%d8TN&ZFkНu=4l"՛Qc-5C(.Fi, _OᔷYKMP S$F\j>37[؞f{*w]ghzʤ_ Z\빺<NC:˱ތvEnKsJm>2z^9Cn0rxqJV2m-F] Tu Sn3ݒ!ms[Z)mJWN]"f $Ð$)w "QB~!HNsmWe]Jڞ@&w7gN]YzϬWv2%o{1֤ͪJSi4FkDHҫ1$>m&=&>j= %Df"Lf$T>\[&&tVWAt戬ǢKq,2A2KKh} IZ+UAtہݟl{];9*u ݻE;#v]zmauDjfXvE[m M>LjI.J_Lt$֤FtpFZRxK{ Rt=F_)oDyJy.DI-J2$p"G|p[#7AɵqoU:ŵ e^~BtNz"ݩEvAs¥^mөeLKPI*JTQZҵGGW:!S CǕ"S!{Im6ɽХ1 )T􇖔KdMմ4n)DF~'cwZwX;m?ow^EӖkHh_$FCKBۭYkA6 & YE15A;)g17HԢmHOSn#p".5[F I'$9n r8CmiB4"L$%\i.2CV'T(ϣN!ADz.ͺ*Xn8ӬQ* Ԥ]'nOߴ ݥC]Nw9[զReieTEr3թʥr1ѥ/FxΗN%ztq9T K`ْ\a:Ý-ˠOp.4hN2ve}-LܑwV>MXۄm jgM7ULAqܴQV>ܓ9mӻcSzGCOƑM"Lz,}CM>f ;3~H7[~>)0gտVɍB64UZ_}j wl?hjﯛ~k?߫GdgPdqVO\_Qϵkoo]>?ߺ>u ~??/ν{ugʻkTש )6b ճbPu-ˇ IDJ3JGGa޳ǟVgh?k)'z_.C-QmoQ'z_.Ck|Kqz 2wB89n~WQmoQ'z_.Ck|Kqz 2wB89n~WQmoQ'z_.Ck|Kqz 2wB89n~WQmoQ'z_.Ck|Kqz 2wB89n~WQmoQ'z_.Ck|Kqz 2wB89n~W9 *j\#CQ+锸|w%Ϝ8ҝyhIFDFbn˵?yF.!v=)l@NXMD8 R$ӧm3BL ~ 2:8Jx,޷ - 2:8<d[ԅpr-)z/CfN=H\- 2:8<d[ԅpr-)z/CfN=H\- 2:8<d[ԅpr-)z/CfN=H\- 2:8<d[ԅpr-)z/CfN=H\- 2:8<d[ԅpr-)z/CfN=H\- 2:8<d[ԅpr-)z/CfN=H\- 2:8<d[ԅpr-)z/CfN=H\- 2:8<d[ԅpr-)z/CfN=H\- 2:8<d[ԅpr-)z/CfN=H\- 2:8<d[ԅpr-)z/CfN=H\- 2:8<d[ԅpr-)z/CfN=H\- 2:8<d[ԅpr-W[ rUi\1 HPjy9?%̼-WBfEbT084ӳbێԳI%&}1)7>5%D^%㐤5cdaV g?Oaӻgǟ>YkCU-ϾnjVZ?&3Xʃ%/2j>+_2?k+V/nmĢ+LqB#C;BUsyn?gP$ΓkÎ4Jۯ+\*`- _#Q~i:u3|2*ovӚ|&theŢ 4m84HQwWe&k-tIJwY>Vi[rk.1b|H5fW.~,Ɂ6]kIK6SqLVHäכ/lYBe1zx4RA]"WGfC%N$(1$)QU_&$i>ֽrfJ/"'֣?e;7YIL}fT]ZV6ߙ r kr5Rٙ(S56XF1)Is~I4Wz vcxJ@V?{EΑq|^GCHLgVf؏KԔkJmpA%QbTғ564y-F뺚Qĥ*O'(eii/!ԷŦxIվng"n _ohY BKsI}8:qKP_;ihۚZx3^y* (Wk%)'jw5U) F2[-]";  sm ?&֒m+iN"AC)ВK_vA"$:/MAIog}9C^RM*K莩O-7!'"RܐjF&9JI&?ԑ(U(5A/NOo\;\ܬڃsƴr֎)R˸C6B~SK,^WnUziTQ)IQ("$B/z>GNB/~!F])xBǧkةT2\H*.2/Wr bCWR_EN;m^kF_窟*T&YK!"-ъqW$#)*(6;Wqo)?*9~P?_BEwo~Q9ZB!.vmIN'u*QVeg3F9h7o>Pmif9 <ԕ2rQ]-24^Μz7L;w̦fupdZd"L(9p6&,RON8v#8ybq$JefG2UQ$#)n+q8q-Z ~! aSJ>n6 le"}_96nOBѐ꒩qt/% w!Vќ7%Tr)G}.,jQ%Iy)=!|Xq}M_[N6ٱkx ;Yqiř,{mnҪkVOmm7VE"Sk~gԱ˭:ËeӭҶ֓JТ쒒z\mVBqiZF$2>[KSn!HZE!DiRLC#!^=vEl\q}Qb\Vuf`DTj"MzD9 3BҤ(IQRɷhrw%Sm 0 Enw贙 טB5|R6*>MI>߈g*h%^\nبllޡtKjFʤ߷i|.(PQG@v6oտv`~s(ELbuce;g͜ݹ~`M*'3U4_+ɨ&cX(QY:dI#/SUխ.ݣu媍J۷+0-U$_1ڎ ^=T”rN2$m)S|d /Mv5z/#C[geHwx`>Cc5w+!?2`|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ 8beߴ|-yC:w,`;/G۾=w~;o@x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2'_4^6 TLnMX5* tGMvm\%($d3f + 9o3b} *DFB1j46fPUm8)Di#!)i(JO/=jpkN0oo#i?oQ=7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d9T?,oU%*rvg,ضJ!TԱ탌/ug"8AmI8"FfJIl^V ZVŮ)Vls1*6 /Uf'g!Tcdc$CV3%$1((qyjFY^W`nO 'cgH{ڌAﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;oYommpv{w 1vϴ[^VY6HgSǢ=_)+ )h'j,/[ܦ޶cw7?g,MrٕoIgݪG^)+SlN Q(! i7iQGZQŧ(ӈh[,?yu>/>7ϫs8o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2™^3)y͖=:gpF98R6*Q6bǔpJT_t͗gyXVY]陒U>}7>' G*3^'8XOdB4qWgƝ#*BXiQyyj\h]<\ϋſv_}z1=F +!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Òg-X?܆i0#aWQzKpIСwinyb&wX)Vٷ_,;Iصm/;^QϴiwkW.yѣbvw)VHy %$2.]kP7x]?}_D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ògc8b}e7{6ÿ/Tf֣V6f}tRVr&\hMTh59dX'֬kGk;P=k5d ;O1xB*T$X$F j҆ێiZȹ\< ]:5[^uOanO cgH{ڌAﹿWB~d=;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x|p*M sdg M58C\*UMbGEźqjZc-ppy~W:ΕcwڇRMJ.ƷFo6xƑp3oF䚖t6$f.<< =y-Oӈ [geHwx`>Cb}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@3p|wKaWw 3%'quV3䫘8[_hE͙,/;0}EE:j:bm?J:_hEІyZR- zI0oo#i?oQ=7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ ;/G۾cgH{ڌ;o>/>>Cas8x=w~D'@ϋſv_}ϫw+!?2|^-}<]?}_þq_ o#iz1=F7Ò?nOqW!j0ﹿWB~d[geHwx??oQ}⿢ )z+pŽIƷʼnֲ߯*bBZ-w!zei`Iݽ~Pmֿ{?`pspY c)v*/J[TV=GZzLtp,8uQ)8k*WSpIMBs%y!:|>SKՏab6XUYj4ϫKsﯛڿk)0gտVɌ2b.k? LڏLտK8>w*["e(ńeZVeKIqKyERLГb* )kYk%~Z>%FcG-~K%d/)R3ǸQ6!-qnʴ5Y[MŮdőnZ}N 3rdz. IZQ!f\'rVDftiq᫵Xrd3%$)Y&W ikLXn2K1\ț"JJ7\ J(Ns6Ց6Z(\"A/]4.+'v/3G_ku!ej:%ʯݨ0Ud5 o*ץ&q (m,5>q\Tڝ)[in5Ys]aAM8#:LDDhBmZTqɚKR쑟"Dxsi,wHHRЭUx-K3|;=޴n\Ou幻Q-Oͷ2U" " ˴$@&WI6UӥJJd( :iuշHS(=Gx%(͸&h[)I-*ZzДFbZL1(BMKQA%$ff7W%cO->93)V4뻪ϐ2Blr嵈c7Q]wm2[m/Hf=TD|[z_"Xnɑ-A3Q)&$qtOAO28}\trJO <\Z:fkReج1Ʒ} e<ɒxTzz:sW&cfXOzڬo0گKKptn(7*3mge\Ir<DXw̋ǟa5'-8~Fd'H6nZ4ӖiSozl d6ÛKJm֜JViQm[[N m!hQDT "RLcn;n!mJBhZORTDd'(([uvPT%!i4'sIQ ]A[x5wEnӾlKwEV1ū[52E$O"3:b"VTԚ]Dt##ZHMSE|fFFMdd$ާ72,YgGt}jXTl~݆ҪԬMiJ]Kw|Q`h`O+!&rZSnR֓Jf`SmHDgPIE5Sd٥Z)+"#AANj.}JB水$ҮpAQ(&]*3]A)Bi>p#DEeҡxdzvnJ r_XMu -T)U+Z%fٛ>L; 64vSo$QW2-t;ukZJR)J=T(3RgDRJJT5)FzڙuVMFjU2(JRS33wS31P-*յzz^٤Smn۷aQ mDpju&IFmјmXe JRDSIג%A(ZT7A+]53=BrSҔRPZ%+#Rz驟BMUSC%)KY)A%*-T̒G(u۲::[踱y{1? dӱ S&2>udRJZ~СITd"Ba*}3/]Lυ#zaO}x{=it8q^(1t6by?Og'5ӋaeFw鏡|]}';}a&;ZF乱7_ѳ3b|:ɇ./C~,jsvŢOJVIn̈ YyZ{^/[EdG+AZ/LJYxͺ L5|u8W(s+r=zTU;JŖ6jyW]w ljaA]AR֒-%Q?ײ#[j_RlE\}Nr!7UekkY@RU>m(klˉ+, E駊)Ϙ䣺\MjGd$is{JRV.TjJi} >{%Jky~7O"Ϧ4Ԃ2# ХW\ֈj#-[zpqjIkv'.4{Lj67YFvnS&j"r2ft6pmiT I m@&*p5}Icړ"[fUйS&L$>B2 \Dd:.UҺ2I>)6Vd8*-=t)$x+ٳG(w+[zMMSjJDOGjlgSJm&a֏8ζ /پ{&ǟj$ZX_?X?߫Gd *@-/?;~y5BͿVoLoգc328 ^'/g57.wXn}cw\I__oNԬm@_P3LaOmU_(V_z/#-ct'o #W_qc& 7V'`\Jogy40IEn_Mp q:濷d~C JoVXoUO:h?ǂvv/bEYgo#h$7]}~,ۻ", G/]YYMZUmM.BzmoU11]>IGKxne}V Ѭ`u b|r>г*(]w.ܨ-@H& C= 4)B4I3B zEM\'Z@]>qܚ,d],˦е 6ě¾)1]Bb {BKjm.PaQ(˾;˻,w=l[ܬ[Rn1]oJpZwmSS)9K8J>Bѡ- A)ZIi4!eąZDz Z@zŰߟֽ _|[6']yC@:f ;Fud %?٬֜" >/v77t7O 뛸;'5?m[^uOa$=uuwV2`>3}avpC@72-v яhh* ^w~;/bч? T&zAPI K?{@?~33333333>31S333왟f2u6NSR)!R4Qi]6+it Q[j48P4i $g ;#"qӄJ- h4˳;,apȖȏD+CuUˎ4#"[kRD}Ib˘W .^7fw>m>:˖,LK.ּUI'c\.$H鱍Í2TstNhQqk25g^ɈKؕ!pNO8ٸeBˈ>8ܩ,͙n6q-t5T\G}cM L[Sfn:d&82TF*Rx$͗!z#qj-z.̙!<ʒ{<.(A˲<u=^qŨ8oc,ۭݠw]c9NoSRXTWvMDLLy:i4:E+X,wwa.-FpLzH&u.'^ZYjFGdԏOuVN4YkZԴ=#-H]ʸgk3~/yS^c̫e[YƭFĭQݫwu2@9JؗOGY%G ЕvkjԾQ5:A3>{ˍDIޫ/4C}\T˔RdL5( 5FojIOI r!/d53tǪ> 龗'qd隋C3pS#Z.L-mu{n QP0kUL- nTmtLY:pDK(uJЕvkjԾQ1:A5}V_iuʙ1mҥISR7mOmTnW R!R6u uC$µOSND%)Wu.95hE}=`QݵzcJtJ)uIm/}JKJiEl-n2kTǛaYn|]>:D8nvs\uuLJ@UiSeXіӉb:bKp[&u>ɟI-m*/!$N9J4)u:<џ`TBLqL>#liN6Ng2 Vd7֥(nclEBCjej^,v*- S\8U8nvLkz&+ t%Q8z;M=!Za<,68)ГKiIEB+mםq8ֆB-J҂Ћ`E[8!]q n)Il" Q "xޙ#$qD̕^c+*̽2p*YMD/U+sdMOvuUĪ))a--R)41|C' ۋ&2>Mk9.1| =AibqF}|hI WO_z{WuB7encٛfjI(]ŮIT알`ٯt/UUcWIcqM\$LvK*Q|["2/NU&d䑢,v"ɖBR}'uirddl#?}'uHlV٪ w[7~LgZDJVOzTNv"cHhi hR@o~ɱڬg`6~f}v'&Y1hFƊ K{A#N퟿|g P}oջ[y"}[h* *W 5~ KV>۟XB/?Rg+} |Up ?ջ?Hyc0b=X@?y .<?ǟCDzwc?XɃ|~;0Շ#?қY @=c F?\N9E$қէ7V9_ή/`݋c@:ؿeY`F44I jSgXp: Y7nBŝfH) T7[IݕBv-Y7nRu.EZe4r%-%BT%[|vaD:j3KJLՓ#f]x"xJ%eV ߳|\vr)-Pu`b3uuRMJrB,"LGH2{vM#V7&eVw}+fw=pَܵMo+@/ d>g׭1Qݬ*EoZ%rJ%;ݳfE2FMp;~z{r=ێe8rUiWm#1M]l!j%@Ko6IvE4V|8G})G.[2d%B#H nLςpva\U>"(^͘11q./۶]ێDhZ;{*/9 \5׏Tʢf,-dz umgF?2f{*9,׊u{r^tu㸺C ]JNdy#Gpu֝wmRR4JZk2WƖ?Wf,]&?/Mukٗ4vyk*-I[VsYoכKSc"Ljpl8o% VWW1\u^;vy竚ιd7UV^ʹBҿ7kΪZW- 62*4۪ ,) $Qm[VGRiQ]uԮbL| KMgeƥuMlԩR >d2^dW"f ;x/ ׳VO7uX,z|YdԤܘ]JmQÐ\6P9÷8r;xF;wm;LMFU "ҲFnMFJɎ*lD>뎢uu -? cS(̸PDi-zc_nvKo p꛽FvCmg⺹[xcǓ3 瑬-lo#S+~&RV nN4v3n`ЕRPRĞztu\qro[cnx_/b{2ܾSo#iO\:7AP>jʡS`W*5ʜ˘wG灷 &ܭzW_TŖuӸ r.޹h{1b}OZ5+^%:jZKqɂ Z B2U"4E܍ē[ A"%t=`|km'3Ul[ghR,\c65Bm۶зX1wEJ㔊)eI'?4m۠8gKO?+FC~UdTK޺+~wmV-\=ŭ.Q 5t6i$&ߖqNed\MH5'CԌRo^N_|[6";:(?Ɔ u[w K2'Y8D}X_n$o?oV=7p"vOj~ې<ڷ=8 ԟnHz=;d}_?|f?ÑiM?Ɔ oe_!["U!'1)M>?w_qX~?$ MO/_T?X `sdځ ;~y5Rv Loգc52X l}cϵY|l~_-,/VOLoգcsЍ`sdڂF?~B_~/?'yV6A(&0'/w/=VǎaXf \َ6+9(\-v=JEoέ\5n ۠SzmBk&a^1fly*-c ˊ%oǩTbѨ-՛=m[kM1q0㇯l4Z)#=sQA%%g ݶiVaoA9'(ژygTqYC!4Z#_zDWd ѫMm_6JvpRLml^?P/&Χkd́#&zQ1]}\(Xb3oqķl⥳/E R$zƱ a|\yNŏ?Ɔ걓|waG?7<$zq @7/WMх?q{ڸWs_۲?XHLׅίz-;0@ۍSѺeg^uJ_u1^öF\'˲'ʏ2)s:;^{3g\;ձѽjxBªۣ֍SUAEm+ZLcǎjUb)Tlm*bX6PjVfr~DR ȵO{b{rƹtXֽs*xn"}:[7@ZnLmi#ۖ%nj7TuGF*oK͹nww5kPwqD؞ծfn$6ÅmZa(- unYZȩC%s)]&2^xml!UJS&W9zHK(̑mTZKdږѡ)ii5jzM ǖDܖ&S>;#֐[-Sr-͕mDvLg;AJM1pU^ioO-]R9{dL=!L8<$wYAobU=7[{3VoiE YI4~ELXgN9?˷5[<˄o5v8LvBR(1fs9h{_v''^OWUFHw)xu7k7#Ρ T5ǝT3n1snYo޽?#ݴ*WW/˾nQ. ["VlNJ:5Q nMnCqxGKfDt=Ů6.[Wlommjӹ Oc(f]Y^y:|3%FQ]󍾺cL"^Bcˎ|~h?ufչ0=O}cf3$̱2G.&TLa-Q-<:ǜmZe-&9%¥Tʈ8uk%SO+$Ff~7{b'mt-msrw#]ۅ"_bԲM "e5^̽ U]^}ũTdŌPK}lY{rliFwL;/dlêXG2gv2.C2bq)%ʿGL kn đ4-$z+d:-6#Ku)7ۅwu+t9ݝ2 uXb ̊yF߯}P{"8 ̻ks9[wz]1~HWؽER .5V3"l򍺥.LN<2mjO-R'.OI$ˤ2Xz1un*.LݕYOcXqYn-*^pfѷΧTb-YNG6Yhiv*s孑fmͻe-ySXv 6ĸ ^u1T"U66m>.הª)FF5I'$Ӎ#RrLɾxp9tٱg)To!ڧT˧Ol}Yu:hRLf>E.]:dYJ\8u"mS,JϏl}u:iRL22ZcAe~۶nD|5^Ut֝Sf/%5.RVi"ݮWj'FS0&l0wպ~n=9۾{.|6ֱjL%d{ng^6-Fח$[R*Q;7 c$L%%S9 544,oң-4@nn~V_7Cxe:l ŽFzg= jFI)+vٙ8ke˙}k3b i쬝_AwQ*u>-ؙ͸mGȕ%譲 wʐl7K.)֐Z쨔DJЌN }uo%]"^y^Ъ| Xy)mXk+&Y dҪQxNƞit{k#] ^9JӪdL+lQ""𶯼Cc CmLqYd VvEVCN%HT2-r2ރq3:SSDҷZ\R8diI-LQxǡj? |AmW/=ʎM$]=ߖr̮aL]ɕwݸdG̬?s)0F:W~SVumXJdxYbgVg$H.?oYS%՟o~r#FubM&$9#aiR s6*=Dh@('Z657y}RŪ8WvŌSY+ c?\՘"}&:)&5ۇۇ;NK(U]YfTaŇ.\g;ܸ4#w }"0l8UBb6T hρj-S7ij@m;ܦ +viԚfG32ʛm˺1fdsZZHrP~Ix9u`kD/kC6xwqbe"SN(jy$(ӛƧ 5-mdldڛQ^2䜋u7̚T˶ZIZFr|+edѭJބ6,VZ!@zpݳ7ϘwkonҰ&m*=".lEWU](YmYzR)4QJEAَ3GiT_-L-JhF$%325x箽0nKzns^귛N6pXLj0={4^0ejb C}m|U|Q]WVIک$Gꎱvo3.跇Op\ 0mw1[𕵸{rZơ8;q]'*Qb7QIArS%#LwZd\k)}*KF| Kk.-Ugj.պ66}, _|fCU_Cx.fseopnmo*Zb3;UXWmO #|#=n:d,I#f$O\»R7T˗+㻁s3Dk}T(QuڢE:lfbq 78am5ٔez)+WI:49N谮7Uǃg}d2c[sۆUr:l֩N[8/ &TD37!6yv|g׶{X lruI_˙7VikQ!>:4C3pCL曬2pГC2 \._Iptz\չڛ-7O3^!縘6l9zew/rq\?3QkZ"铘zض`rYŭ:9b-V.[:Ÿiۅ)ن[˵ erQMշ (뒩ei"d8{mF5! -IZSڋC)/s wSЮ B4팷 i*er p{ػi0nDP[u(7h5*<9Pc]^ewHJpہuû,Zmn _w}uq~[X-bq!EJ+٩LJ(sd<훈Q Eµ6uI~CԀg\m(FsoiXemР_~αw"[vU^I<\ԥٿ!uO۶Z7i{ܛڦ n?w_qX~?$ MO/_T?X `sdځ ;~y5Rv Loգc52X l}cϵY|l~_-,/VOLoգcsЍ`sdڂF?~B_~/?'yV6A(&0'/w/=VǎaXzi+hlfi>6'G2-Nبê RO܋Z>ēPZUDp*'=?!.-QM&nR*̫SoEFz& xrrY3B&8J_0zd4pЍ~OڝsnwRT,ܹ^ۭMٮ8sH)4NfG&)M\uCΜ~O/)oKkvRۺ)N}S2iݵwo7g*ڥSsktb\GK6Gq.:)%JJS AG,DItqq|_]Wۉj}y_Dtgr߄0l>ʯCNshwL}fܻ+v{q\ˍ^tg u^{ ¸z[o}#ebm6TZHp*\kt~KW#2|.69j5xIr &[$JeNiN!DIQto5ͻۻU=XwݳWl[8f"Jit7>[JRdEM'}:wIo7rpo/;ڶ#tLwoB"ƤXv* SL0q%&DP{pSfH4ZaI6OAx="[NXKP]2P۳\pvV(X"dM:KZb]񚽨ޖqYN}SMտl-̋@߳jU!@KTJ%ܣ-.Ҝ UiĉMU-Jq*Rɑ#B#\qBI% ƦuaeZշyE}Y9;o:vLHQ D ;VaL$y)q)ud?Rvcq+lKevM5wj^^IZ~Hl+ZQkrU,%ԥĥŒbQaCB ᥄0JV"q-D { >:Ș}1ul' b31vn {XXг_ZOM˒ޣӫ7^"8ĚҞis)*#}W\ x3"x{c2m.bJѻ2vkbE:.:"X* AlI):B75\fYnD[m4݌ZJ$dj>ν qWU _qF73N k }ݖkSiir[zuf\uTzS.|%Doju':/gf;s&2/^.>*Wi$SY"R)OpĚҞis)*#yR-m[SCiBQ"1̍Gײ lيvi [ɦ:zѩ^LKO> .ȸu3yj&%Wmg-lW^(r/ {oӬZՋl*ǩEG ]/1KD$q-aRfD\ &˭[iت.s6nE~(4"d[}ߓeTcRcݵeO3LD$qLuԒqUIzCmˉ $h2.%'ˣPc?k_o6mO䬿cmܛwR׀-FeXvn^"nXS1 Rȧ<9S[Y-aqo'$ݔtkNӼWKzUZlYU+a%3Q m[>lfuHmQ<$$҃2#>#.4~K9[]cv16]v,-ztx%9K&b{ZȌe* ,P׾%ubْ;*͸csX2pl-nA97%S#c;/r͢\&Y,ɜN[ʐLGoq壄qcMiZ֟A)$]>8 dOX;knf=\6B=3C"rSf\h*p|u$OƗB%W~U& z,(7#B޾+&ޅ ~¦OT=NMp+]}ً'-tY2HDjʥAw522:TJ £G=*>>. ˧^ _4b-[Y;u;=if3G0Ys^6n)/+5Wص ¨vE%.9GfFmxʶJl[U)~y˵ }"U[8.i;s-v>%F.JiK9O}NRhKI}umT%,-NgH.΀57#u{nZ!}>߷rIL,]\ۭc]g[?4I(xׄ£D;BᖗvMQbNDqoU7aSmb@fFM9 B$5|6 ]mhWAp駋Iel'~~K6MLA܏W@6RU SWyӖ}kkWf;T-.Ġ'^RVܜLiɻoig\v${nnB۹I2:qLQD&&k6LA8RBtji*Ӳz-uZn;bx 朕S/LMfר=bs;nF(RYkkgL4Z2Q'DZGybc RdFӝuaʾpک׺7aZksrVoeqEBR3 -?tÃu^ef=l !))Jw-է*[qvW38fU3[o<[>w\Fo|YAė!gsk+cku=rTg )!C%($6]CRɦ̈́sMZ9h=L˱ 뇺W0"Tk|-Jjx 9k;+ۤݗU'ZjI[=tU+G5 )3~#꨹|N0(cl\۞mgf{$bK*ؓRk,*tƥ1Pj*KSdEjFڐS Bڌq(K2נ̺t.V꡺vUVS.]SʌaPaG'=/ q.VN&K]bMF27M5mY]P":w1{N%lvK(3Zpۏ%@}-*,MITޑ) Nӧ\ 8^ 2u'-Ͽ)nЪx#a9nTM_K!dX˼0u%dl:-5-t {z a9&;$mֵ0$sm̋^A$-ˆy6ԋ"7N޻`OQ7MRDunOM`+۪?&EȻ|,1!g<״{ '_bYvPnrE UoPgW)4_ukDj鯡u碥frh*5<ߑJ̉Fdal*! ^[}N/f#k.nJbk}>.ƿtDMBsjK.M/7ňk=k>2ۆ n(k+*mjUJSɧ %-jcTdGrd|P[,2\ԤNxԮЋ`=kTź,I"pӬWMxoKd5W6m^qԣRIu9+tYݟUm -Xn=#OhvNfftլ~pY3y̛V\5+*g6\)+pRRzM)Iu #Yƍڨ%% "J32.>:s3!PkpFO ۛ]vqN<&x Xz账5Ss3d2u>%i^D&amAV* mdkhTLMKoG/,֤Yz^f"^J/%I"-2 8ETx&crqJ1c9IzDz:ηB;Y3[5mfmr562.9wYYо. {iyֹF4AaF6bk1XrYVy3lYJצ n}KuoFfW|k7`]vn`ZL`t[TABiF6Zbc1P9ԓi82I3B5:jCZK%G= ,&3p]M`+:e(OmmYuܭ\ö'ƫo졐뭫nSЩ0y]^ژFVEzrtl3KR,QQ"[S=TWLˡv@sOCCq`njJ?1oR1Be(S"Iqn-J- SЋ ]Vv+l[~[DF .dוØUj?Q:l+:ЮZMVM2PErӞ@F44ug 'mKhy[06@sͩ[y:ѴVTMOG]JʃUhim̱V}DW]mju-υ4)$FdFeE2JugF,vXӲK~+8\1ekQ2[&WY* jJ'lE~H`ł'z؝{jjdclde6aڕVIhPj.vnTbs?U&91]&x㩳h0FAH:u E'0N7OoXr7˪'\_;Mсƀuˬ7W\5mewq[@QҪ8 eVP(Q'Ӫ0%I'Dym<˨SnJ̆mڗMkT5z=_1]ZT}6M{Q"NT`mس`͊ymF vHȌR25Ank767x;7f:7g۾i9%M˙lSڃd d4$TZ_l-%kםu_UMv|5xyk6hk8{v$5Vf>fLDEJկ +rQ&ƩRNEKj2]QNrRM-%HB5"R]@j%W(8ev}q\RIsUˏStҳFU:8.s'lT<]mn* ݹjUV*(xʏUhv)qLLW.=IJ2NyRb/ qm-6J8D―:Z?cZBwuUXȴk/j9FR[ RZnLKhghDȸ2 4{O=3~>`Pl~RdZuŕ^d 2)VEV 7%Er39Lqc1-4vКs SN=HwO3o*۵fW.Zc ۖnj8,FksrlPtFbfӢ&3+w>g,Շ3=ׅd|[Xb޴3!g\fC4.*,;pDSiSRt O)RqRPӖoq,BOzh`3WUouXVD56HJadCnc5S[C[rc_o'Hf{k46Z﬌[h`ek*E~ĵ>EݍFbߨ;91㚝>h vVMlSh' 9R^44zU&]Te%tہ+HYAFIfIR5=^ܟW}^=M}WN ]^^6d iYuʕ[[<*'ƅFeGL*MgWzp+ļ1&,2IV Imjl; 0,JJJ#HNo^J_|[6";:( ͻ }lf3u;c5[(;]+E.!iņX8ֽpw6\rkkRenwKdixآYq7?gM\08Mg\s\w:"d֗N9K[LLITBI$!F)M ڏB3PT\B9}wu)ٛֻZ(ݢxnb;Jdw#S$3QG*`FsZ0#N^#,o i.#Sl*M/s_׍w#{W]qr..-<@nw۵lڎ2 ;YiZv+b;S, jW, *TQj{UYZԥ;ݶjū6ެCX m XvHKb[YjWq\fɥ~_4Ԕ?QMJ:З q6HI6y"5kz ">rF*d^x8{!༽+W=ێ}=],sZݷ6QThf11Bq۟٦DOfpV9d #p5fK1v }6zD-ܙJSjhSpmӋ֫m>c.jR.#Aq% %%i222#]RY΋)9kAOb͛L*Y4=^ .oT8b9Qny]$ёZH A|1H "'p\k[vS]#:.[6S1ݗ+05~ƃ]j" }[\qEy.K_w!hc,QyY.̯WPS%24C};vkJEY#%ΧͥqygxEﶋ*Yn83)Uq]Н7VhRfHt8K5T.TԉLʹ\[E:ۅ@˷\tqnagQQ!InzҥKq:n#tPIbE-qNZISnzѪHTWՑZ+v]Yݵ9b,\pVq9ZݮbɩMCh+TFu-lVoo[ݦs5VŶUuYzXnlzF"6ТdhʈG2isKI4:_ [II$.߱A6֍j`m˳v%s>-G}5j,GDnȃQqT%FqزReŴ,e8 ^K[ e{rUU嚬ۘG|mh"SiL)2,ilP˩4B~"ۄetIЌA3f.Ұpy8*e }v䫴%Jܳ)N=֒Q4W,ϟn0N#82*f[Qb)KgRk5so {A$fZiW-8ׁ)h^/ @`Xeݸ'tYݹXnnpCh۩Q!$M |X2kIn{}ZӗKޫwmRmqt^HJ %Dzhd: mJCRHZM*IJ-Q@X"+fЭX9r5qF(U~UJ bݧJReNwQVߙ;1|ױU&@h\1v*LXNSOcuuq*B{Zu&N$fDzxX+cLmj>ݽn1pr۩w@Ǚ7kqRUaF[o.{ܥ17l~pvG ?-*W[}򪑠#eG[nquijiZ҅fii2"BVէ_߶?/:o'۰h`@:0oWpq;Sk8Nf6.N8wb塍G0|bۧsLMf\ZZD8+[{(6:)\|w~m[iDnlšŮU덴n--u-D3W3>lfs[^Mϝ&߽!n)jo@QLSld:AvٍNK36|K7NFUYS* ~ݤnݺʝ (GLbL6lFC7\MaODDCλJyNp5-I))RM$EuT,-Kaڳ/56%BѺi77+G'Pj0j-zuEMU]ȼW[ʖt":N/ۊ}sҿpq7 LFk#Q4l$NRo=nv2pۮ1L{B˸mwU|?v+CD WZ5Ne&:3qVˎ+cWv4կrj5 1{qY\[AwpXj-GLGTb2q*K#n qO9гV۷%My^]tވYZImO ĻZ\-*i*+6BE9cs4wp_⊖mMn/ZY2r÷;漑j^[,9JrEjרȬ[4I9irM+exa2ZpFQ$QjӲvz:z|țL{VK6 C44+YKjUWRبZK۝՛յW͗3Aڭpn~|f=7=Dr7+dW;fTgSs[KtyCZ4G}G̐_$ioHW <];cw5n%ݕYl_;иw r㼍6ٗea]:ӧD΍og]FޙWJwk3_sGEρ ˸6pZWCm˳q%2Ұ{BէůMAN*]Y*c0m*kϸBhqqJI44IB#2"5RgFǪ.Ch2uz<2{ENS9tJ.$TۍHZL!uRQT4jTʵ"teR9#M`Hr,3#:TI-)%!i22ԅ,̌$ed~oUۏ2ɾnx1p/h۝va\7l]H+pN@,څZXf=On]9HR#Tb:fEӮ~o7n{Rm:oWH*vd0{^+RD2-/i ! TVKI,f_IRLݐ(p0%H'Y1jU7---<}~KfݖM)]Ѷ3]C z{uw Pn[6}Thiܘ䲦S^S{d&3wC1 r!SprJmG7gRˇ'-KRI]i9.Yjݝ˫%frCP+!S) MHlIdp)Q{%㑀Y;]Dz~v#q"XlUmY*5vn;n9B*-AeB]ff:9dsXeDz^Cbr֞竓1y%Tr,HTf49ljX7샐:=oG7̐G-)q2iQ]&N Lfw[59Ko]!n.61FIfr^kLe[>&Un[dvInRRfz2mr3s ue݋2-2[X]'(7M7 zޛ>d) J](w$R6-&ۄyBϋ)33ײW7uKw8al֥dbKZwmѭk!V2eR=y1nj{URoꄉrJvټwin`{&0Vk^)05vٿ/HS5w_w%rR9Qo-̔$*^LK(6eҴ4RGĵOd]Lyov&G[u36nĐ0F|ݣ+TIIZ&X *ڰ!\J%G63$׉:w|Hofъ +Oi[x,*iwD}®EzFVMur37Cha.2e!戒F$J2Ifs"yWp^{lsYW ],CdXl5#Qa5&"U&!23ߏ+/[nQ~䋷-mv[3XLƬV;7m*֕'&&U!23b3UUn'c3qp8ǧI.-tנ!L* ^w~;/bч? T&zAPI K?{@?~."*+ImL\JO2MQ6o#CQDGֱͺGuZR|<)psQfNQ륍=Dpl?Rrl;;zLzƞf|;7 NW̓yՕfG;G43pl?RrlS2>h޾=t7 a`wez@Q륍=Dwo\Ԝp󿧫+̏w],i&gýz~|;=Y^d|}zcOQ3>n'+<3#Kzpp޸69_6OVW4_uXLϛ{Iw;zLzƞf|;7 NW̓yՕfG;G43pl?RrlS2>h޾=t7 a`wez@Q륍=Dwo\Ԝp󿧫+̏w],i&gýz~|;=Y^d|}zcOQ3>n'+<3#Kzpp޸69_6OVW4_uXLϛ{Iw;zLzƞf|;7 NW̓yՕfG;G43pl?RrlS2>h޾=t7 a`wez@Q륍=Dwo\Ԝp󿧫+̏w],i&gýz~|;=Y^d|}zcOQ3>n'+<3#Kzpp޸69_6OVW4_uXLϛ{Iw;zLzƞf|;7 NW̓yՕfG;G43pl?RrlS2>h{*%ӇniZ%C5:ꘒ2'Gn(IZ]?r408z\Qi4+2'Gn(FEGpwOz*z 4n[_%.\"ߝڦ=)ҏO7[:} "A&nIqIc's#2R1NjJt<1gdZz\R@lYQFbd) K)EF)m<˭$*#Ԍg2̘CGq0.۬ڔۭ8#JfFG Je1jDwC>Èuq$iHqdiQ@#( J-Rn^.TfH &Z:5z\-TJHVvlbȇDF乲 LhQQ_W%d3*smJzU-ȍR21O$<DJFd9^Rm+>aP^QjYrk㞜AO˓ē.Q髋-ݚ?m4{::vK,<.?F]$-{(\?o۴Rbm䇪?u&}CĢ2%p޸69_6=~,S>j&{7Zp@ a`6kgPN^j;7 NW̓ٯӥrGC9{u 4p޸69_6fN5M֯/z~|;:Y$|;7Zp@ a`6kgPN^j;7 NW̓ٯӥrGC9{u 4p޸69_6fN5M֯/z~|;:Y$|;7Zp@ a`6kgPN^j;7 NW̓ٯӥrGC9{u 4p޸69_6fN5M֯/z~|;:Y$|;7Zp@ a`6kgPN^j;7 NW̓ٯӥrGC9{u 4tD"Ƶw={BA>#3IɂBM M u]78.s-Sqiͣa0KDZJM ]=&C9sX,zT]#~*Tzh]2fyJKw.XKR*mU#E5姤yJ.4 .PDVljK0(ֵE ԛ#LT]<\%OA,&:=# МIRZVKnOx 0Qt8pé=3GF]$d}#^##/eb=zKP^BKgF ͘Yaj2J3"JKU)FDDfdBJRG&Tmeq-2iTJfD-T 94r*LBvD%AxR&"-MFdDFg Rȗ-Yv]20JBQpUfGI+[i2ay(qF5[o'$J"QN@cT 5t) 2bQ?M$iEv-T$FiRSggR>jRe Pw]ZTVlϧu.- 2£1Iݿ)mϧ [Z¥eIIBִIOfZz~|sl9#棞M֯/z~|;:Y$|;7Zp@ a`6kgPN^j;7 NW̓ٯӥrGC9{u 4p޸69_6fN5M֯/z~|;:Y$|;7Zp@ a`6kgPN^j;7 NW̓ٯӥrGC9{u 4p޸69_6fN5M֯/z~|;:Y$|;7Zp@ a`6kgPN^j;7 NW̓ٯӥrGC9{u 4p޸69_6fN5M֯/z~|;:Y$|;7Zp@*w>}i2RY~؜.-YqnAK7 xYo-:Zz-2=xq!]40TEhim$YRBU$ј,"QZ]c.oRMu:[^zIKfzEd[q ɖ1JY6rMJd}=r Wz̉(3J*mU9ibHUl8B T.z̉(3(*"L9CjuiRO}#1A5B)J]aZm4'^ȕN%p4Ɏ]eZmiQ  8RJQ%)#R"JREFztJ$FIJHԥ(ȉ$E $jQR3RȈS33""*Y}v26.JzJiU%SnUZTBHϖʑ]- U2hv buqMxM ,IF2BCR1ˮTW93+.J^5ӧ^dvp޸69_6:Y$|vN^j;7 NW̓ٯӥrGC9{u 4p޸69_6fN5M֯/z~|;:Y$|;7Zp@ a`6kgPN^j;7 NW̓ٯӥrGC9{u 4p޸69_6fN5M֯/z~|;:Y$|;7Zp@ a`6kgPN^j;7 NW̓ٯӥrGC9{u 4p޸69_6fN5M֯/z~|;:Y$|;7Zp@ a`6kgPN^j;7 NW̓ٯӥrGC9{u 4p޸69_6fN5M֯/~p7Ah )u|z+0'.TLsք96jk-597nli>絨u5+)MUb]+~THAIvs;nt[P]J3%ҧRꖉ "5!ۿ(mU.(tԨRSIz,ETZ)&Ty.ٺW-ssb-FۄDmȉ!$FYDy THI3IBnZ5MnCVfۄDh~3"5ƔqJ-IEFJILv6oտv`~s(ELwco:?ҁ>c{oGr|#`'i,xueSί>mt*sb) KJf$HiZoΝژ[D§:Vj*,!.TMfLE!)iQ]lDI Z-5 xi=}˪2?2>Jmr{n{d~G(Uo)4ou *YKns-[~_"rM\Kѵ[i:T-Y՘4Ivkѻ-\A6V]Ÿ]I0J׫䫖@&DlR6u_ ~2nηm\ۨeeg\̵LS+hF'ЉF~Tu6T pn/RC:L%Rd)R?ԛ4 w ct'o #Opgic"gVre&ҲBe7!}d"Rl:gdiw r#Rދ4n|3X꼭ڸIƜJ4ơnMfURlj-hd9u0KR4_iEL9Io0>[A JKo[^`Waz.C?jd9k峏.Klk6n=ZyNSٯESRG1J&R6^뿼(8";ppv;kby{l;輬ZeǶWs-z -V6j7eaCŐ[j\b дKO9I&\ad#>21ZgKkXO^˘~SMMז*O1F&-a5k2TzRi>3fuع%;p`{+mz۸o9Iofɸ$\"u;z`f1G-j jtX3Oy&gqs y_)/re' &j#OTt=h926󶫻C,UN /KNŘzXl˾JsoZ\pMNv)BO!l YHMnc+SYob{mxmRwjc GS֩}qToYfN*R֥90z*mǒhl%GgSZPFfHRE,j3Q`[k{u6Ef/j&ѷ_rI܍o;&]JZq5 n2#T\z/I aICjw7\ewZ4)Nﻮ1vUcF 9ẅ9fK*QJn4tԘe DhDU|.(R)>#wwa ,=]n<\qM~ϴ.Lٷ6W N]]ۋMi*YHJ7Wcn 7m]3}avpC FvxO )xwWsLܞݻ{y͙ç,ԶbJ{7W?}w7yvyqG{Wq9?xt垺)=)<K.-5Vm2f~-l};rXn_uDkNx6lRT5>횬 )"MN96fk#f Ņ6qxLkVJ{,Rt$ ^fSש2hZye3FJQƦ$k2KЋLRQhe ۮ麜3w4IƷAqYZNLϘF3jrcfީ̄s=:{k^˧7Ar1z.%˘߬$l-ycgXWKw͕[۲Zk\.K*G6K0MMOIh6ԗuem١i'GR#=L7lAZV17jZ:gdawyH܍@S1kqc-j5%ےͳCj y+-9p;VcmWOlvY싍1n[(27c{N5ou>,w~߶"QfۢJLSNՉ )1h!!gqIo9(oKM4/r:wZ*%Io^upV/)x2mX>F3ѷ:V*jr%XL4&]o@iieFz%ф/Zѿ0Ie[q²1rJSW. JΙm/%JH2S жTK5GgAZ( z1uz(xj\Jnm/vE \܉cWm{ڢٙrX]&/KNܥ1R9M(Zg8ؖ#,!w=頛Wp%hG`7ץh7>WYr by~votVmPlwVr9hKU6]>k-G9oouSӺNw-埖sX[7ȰxZ\jkW-9JKq")Ӭ%N<.B$)`JVAVE d~/ƝOƃtܿz1̙Ӽqw܋N=<\n{qۏg괃ce_fµ/~ל<@ժn*YB\nl-t2Ɉji6Zt)ЕʌKn(G:iF6n̫K [(kA&Voj^UDMչ{wYyoFQ'TRosc1۫(d6pS%ѪWX)Fd:QELսypeLfO#U8))'QNV|4I@ 2q#S}c*bX:&`l)*5Jr7='j{Uf]BUb2Nm݋:w}c:PPhl}+FO7 6Ooo݋~ܴQ5UeTK-R+$0yMv Iq"u|8ȝյiפקV\*}n/ĹO%;nT{5p~ylm}՛zE1R\8חW>쌛4{W/vFv}QE÷ߙek.(Ɨ ʒMrRy.p7 -mt`˵x#r6β98$P} 2.jFٙl2.vt QqA^θ1HFս,"p[w&BOTIJ]e]NeAhR$kv,vzȶzl^VmO~^kԧu6BR/2u#-P +B%G(kijmĩ!FE쑐 Y# JoVXoUO:h?ǂvv/bEYgo#i,dsݮ/B7n7s;ړCC=N\cy8X!7=6܎wu{ׯjW;+zpkۚkMtׅDzk鮃DzoUwM6Zu*gˣqvZn(8ޓɯ" K.},^enf])w;O7#^lot9-׃2N.sf;_TǙ -Y2(oِ9P` 4&K}Ldҹ͒}AH _7{ٳA& <߸O*b,/n^ rKw^HƶAȝFa.Qk1 8N=j'I/|ᜡlKg~Im;3"cz?:\U!Qp5WI)%ǖˍ=47ڒmN62]ӺJjxN~gTut[2?q,{I6mb^io.ܠ^RÍ&xWpTLvfm7֩향'mZqe WFS{Jօc] +r pTh.ǎ!uꁜuDsh00Q B,r$dE8O6l &e2`U$5^_f>qe ~P׵jqLma}enK=zIw],nf[^rMݹS&ZjzWe[:嵭nJt}Ygf+=xE,of f2-߸۲o[$gy5ZkyJml3r aH}|+GV *Z\I`kKJv%jc}lzl7O4nߖ{w?",\Fzm锪*B+t06w*=elƩjLkl*|332i_6us"ʬ\yKTϟ|(R#3RqdDLoR( hDzģo_,㬉nammƁb!Ur`[@&Pcۚse%)NK}K5yS {' P10fhVB/JCT,dCU4%ѩۘsd)NK}K5E-8)mXJ8" >%+ gG~Z+yn~w{ wa73CuaJNJY *ȹ dJ-ː![X ԥPz'Qٓ6չz o-lfFNݷV܎6цYgl? :m(% ߣn*Uثyq&2W-(9 SD$-ֹnIIki#{@Rέ2Ximu;Osw.E٫kǕZMo=+}UnnTt)dHڭ ٓ7dYnUM8DyA;xUtgU* k0dSߺi۽ݳ>Ok9sG^.@g+4OVw#‡oߺzE?P4^'_Ƿy?_;N>Ov~vk :MhǸk:- pd=ߛ\&ZZ^mJ+k 8]4N3zђYp1mj*ɸv/l5 Eҳ7|q&ڗlÉl՝xQ]Vni)t"]Fa6*\$!oM$I5NJ[(V c2ᒳf+ܳ#Ⱦl}ڔ;wL2-UΕWv쥦)I-ɮuۤl>k'ݹ<9ڹ{m/,Lq& ^giRadUI)$J7ow<,g/]a8v9Qx\ee[K7WpwFɳc+*FMΎ{ęui(;on{gw/T1~2n7nK9ٷ~jYB5=DiR2L9oBx$fp+uyT$!1Tj"8 CrBtJɶi$h*^ɀ W1-q:s.[byK9 ݣ*9EBn[DU\f)p'ԝW6Dž clcZ}vb[g:T+k~jv|z*sO[MffEp'9QCilMϏ9+5tqGJM8zIFuqבDF87tXKm=*.ܡ;W-Fj7/$bT(Sn֬*$rP';뱣bc<'1lӝ^XvLfKУڹ%Rsš1Y)9GC=8\2a`y)$>L[kмN ]mucݷnR?kv&vWNoܗdU2cV.p7{sT.{zDwY)eB1ǏkVKܾMX[tOt;a>2;7uR{pX;BpnJr1eJf⹬!SlҒRT̗$[\Ah5!pOӪOua|57rϋwkmbE#r6=eŹQg[>*r슒SRɗI\[#׫Ypg'\u{ܶBbjF pn^jF4hy.*z쪊KRɗ v]Q>b"Dm$)}H6ѳ!.(̌ {\-c3?s{NEŌkfΛx3z\mX0neDTZշ$y(YקZ!.qܦ%O ÍkxzKw=ytluW%feETɄL1u&7{f'92DROfY)ƖlIvHMM@XzE 8[HJPn,[&BCESpן}1G5\qV׷7YֽrQk5_!](U> p,-4$Z-* 9ɪ4u-f==XS۝MBئ<9fHE]&-vҬFr5aZ~U>vMZ2w?Aߕ.EƷlh S*ZEE\=nԫr=]Z63 ڔSHK(qļg q L@az6ۺ06~6Wޝ:Nq^pjءݳ]6v%7טvW"T.M!su:t h8rnETUfɳ s}d|lYm=Uޙke{*MŕPPoJ:>[=bd`!ʫ[>ɔrn:mp3"h_{{K]Ұ6b ~XktܩP׾F+a_qVDkٻjJA~,6CoCj6aN^ K}ua펝*fw[v5V2{ۻ)R֥*  gԄƈL TNqOj}7R ԸI%@aw`ߵOٕG{W[\Vjĵ nkEyIG~?vJS"S# a>ݳn.v*;п7iX5"*wj]V=tLrZkTwT)(-Ǧ:HL)\>JY?)\ lʑ/%- . =]B?l{zڶnAt.Y9O/:b*}n~UI{hVm]:GZK5mu:W(;GG{Cm2͔>I9?-:^jMj Kۆ[5n)D:Ym5s%ĉO Vo&n;yI3s˄u%]Y@Muྫྷ&wjnIn+Yr* fzïrq%uɔYqHCz["Ui1G˻N fge)6=ӄzޭ3lo5e{7dvExѥEzv#Ҝi DD^3OyKr<_)zi]?d}m'yے]edӗm>olZYsxrʹ>My. rBPLL&^L-= DI}yқu-\q:sI lJ$67%mf=2][3BVn7zi7]R7Y]^ϫVd>M&JNjP*נݥgHl\'mtll[6=_9b-F^ckFZvM#YtL*}ʺ}Lemɲ#.Ĉꢨ=>C%s&#>w%$᯳çONMkl_rVxnu;jK)u/d*May+,Tj7sڄzRs#Jv*ľ| %=c+Xڭۺk_7TTWmK-XFac9l*;n\iN[ZR'0!2\cRH&$SۤgJO@{u? ]ČGէ_'5?m[^uOa$=i\kؖmmw޷ҵ-kdFr\u(zJRڝRcL42#Zȵ!pZV}V͏g&\mpQK^NA;PW F5"Hڔ2S-$ֲ̈-GdKRP5)j$%Rz30+d=' yX5 Ճ1F׮[ tI(ܘ;Xʖejr`*Plbi*SfNFw gb(wFśf;'Qd"Ōrlj&]Zث7& +FmZcIٓ}c\)MJeSDo i>2A0 'm>jnwgkjWȖFi4}?@D@*\[ԩf!ȱ0FJ[m[g+48^;T^fAlyJ][-5&߷KKiڕ:;K~Q}`9ڌKħ8q դzԈ]z6:Սݑ?g#=J&>ekosLLjb^nN25C~6;ǒ%[DVK3ܾ#8#vEn+ T6G yڒ,'eQ(d*{%癐ӭ,!mdģZ8l_c e;,dX/[6ݍ Mv5Fndf)} Nm֣AVfK2(*+Q2}ŕ[/|]mvθڒ웆/ ]W:fϿU/Ǘf4*}i6)aF} n;sm|FҖGӣk3IG⑀{̖&wb30f{.^4r :ϳqHM_/_%ɷKhlͨu\S52&6Way~v썼a]EWʴqsFę)Ul||K.XUDfeAZE3RC,iJcH$LC d>ѺMdFЂBO>hW_qc& 7V'`\Jogcn6ɷ3enu6Qqu NtY)[4w,Wl .{"M⫶fEk-R,n6w#fnU>LӮ2Sw=A%[]j51(4rJ!9|6K6IpФkQL 62Ϲ엵<l߹~fn9.oH:rbUѺ܆J3p'ō=*}H[.l-OWrk/o;yrwLÄ3~XW|m#◮x5֛7}VG;ȎS|X󒧔sHr3H[n:ָ5J4ҭ4Դ2~yv,GK [xRN2@uTv9jm鋲~cɹqSԃb\Jcl-Kۯg,ַ7ua{wQ,Iφ́tP`^TuV6㌲^^9}I2mKMm7+sR!SHZJTZI[n:Deғ"ɾz76D[;ȶ˲m>ln.ݥ^ǭnHƗM.[u3t2qܮw1T6u6~\m wwqz]_{YUI⿒Ķ{~D h1)9[k ȩ6hm.jZ)Ī$ę3W$r)M$I$]:v@Znv4 |u~Sg ˣЮ~DKgq+wS"NQry=aZطoV.7{z*}{o]6ySijdS괊sbr!CA a_l) R* lDZvzt ǬͭI׷\kq$j.I0,wxQṇEeѩ5u2ݾ4`8=ɬfmHY®﮷InSej;NPۻmɴjT[PS-jxsFnH7 8 s -BNzi2 _/W NWM\X?ex[]偰mad̓iw}qBmyU˴(5H r1te3pಞ:]m»6Ů .$d]3LnnPuJNSb}=PUTE}`l07l$8mp%<fiIZjzo.uxG7ʫDMџ(\b9jƯbJ}SlN0Uf6QStzLsmS/ALɜؒ)_+ԫuX TOƫ@͝LdXZɮbJı5M)P2ߥ̙͋"Ѩَm;5O6W~<]bY͗bF‘RSX?*Kg&ljѼ,Eq`;nQڔ}cזlɝΥ½yq&2-*bβ#xő+SVZ ͲMM)Ǎy<Ƶ6K&Г4#s ȺO_wZ#Ǎl^'WT:G-Çs1݅yɴr:cͻ`^]QNV6:jpꭴrK[#̣|2Ц)3Y˴=֩b^7MM%JT6:Tib;MoD=L8O鼄63Bz}ou_~sv;fy"aD;4Gg]wezDY)&al*m,ʾA ]Vݗf@Ē62IY"-S6z\sS-71{dShj#ueIǜhv)<Ấ:IBz>Uj:N[g+5*zVdNSHr\F|:|o-מujqjQTVUj:XΗTUOU*S9.uF:[ʛ:lV885(Q3333>30㿿? of^'g\CD ñLy[V ˢáP+ ^J{tNۢD?I.4fSq)#1uXUő rĴAs]hJ$jrlӞp R[hg͗3IN8)ť ԣ"-TFI"&zm]Z57:'}5[o*Po[waֱE2U}YyqpTi ulqlK y8R7Ǻ/Trf·g/(`{`k-p٫T)ȕlN<!-̒ɥĭ SLejB'2Դ0˷=l5&eWf;xU\kwPޣVe72ݖ*x^r뤵nA+06$KL9SV ^_9b弱mpCKloߖ6o4:nd9=̬wUF\iMЯ+$)K%p]RC-8FqX A#'9Im\$%t} %-`8pll[Y:Ϻ{M7Պueݿ-7A=%mqS [.۽TjY AN"mu+W[ѴMd&|d|j٪UfPMOrYn\d–GK&.O)im-[BUQ´`,k/gywoʛnbrl y3& xwe PhV܌zVA}nS#[*TR/2;x7iv-pj~3/a<;Vpߐn9ʥߵklz(iuZ&rm)yVێ¥<NNuJaM&rT'Gbn*u>h4 ML*X}Z-g(ӛ߷)ʭ2%.1%h5J>-fֲ43H[f/|^r92QȮ[6UPD"R \5SCZK6n ' ][ym->0Ķ+A+u8ηEojk26v9ٲ- x׷UkcZMQiVhtq50mӲ́I۫^us0mZI5pųwWwElcUQ.Tħ.$‡Lm5ݦ]fc)KSIYCd S"#R$E Z[ޱ0]X&LԫBwI1gcǹjdkS/9w+Y`d7:: FAvupNуsḰp6=vCp6𙚬\p"q+~ )Z$^l P%}L6IJ7ql6"F#!`>%W"~b+_~0J@R5C ہV g?Oaӻgǟ>YkCU-ϾnjVZ?&3Xʃ%% R֤IkQRRВjf}”%JR)IR-MJ3Ј RRRJQ%)"i[tANGͱRrAaMU.le4qF햜&FAɏX}5rk(2-놾uqe䊬7 \̖ݵ_$=ckvi2ӱj+\iYƋz3-4eC8mGp d=&D:u:3QbGlFi)OfjQ(l*LSR"S)&„q㲂d(TgffffzRh1锘1iQe 0 Km'UIeFz "]KVЪԹ<}F33!ee~;[N$tHixRiXQj4)PԘQh:[kIsjSpO-5&[C!i)1*TGO~VRj-R!UQ|JםxjƓZ$GmޮOMaJ)Ϲ"tuPs8q-2\"LD~IOǝˆ5 Nߙ&Ÿ1&ZWB!ϒ$JWᑺe1jDy 6e]A8̺٩4JJfFG i֟iqy:-.4N$ۍ4-̌Rӭo2e!֝iiq[q$8fi2223##+U¢S*5NAQ!DfLĆHsR 6gtH"Rj&!SH-#2j4Vе5p= ļѩfTfLÁ23&iO< S>gt VԬWNiצj6䯒B-!]\M9Y%$7B2q:6 ERNTS5ǡqm'4I6A)'y:A7l+}A9&eKrI3N5$8_idJC4 "4j)-.ɤVa1PKG' JҢ2[N%!i2ZDddbVSk6g@RzZTFKmZi2RTZxuZ»'as,UoV)'"}ڹr2\I96|1hHʕrKŵnΈ3Xi&~e G}e.]!D|%Tz%l3eT-JoY:SdoJЗ&d|%咏D@6f@kӞ/\SiFfp+1oTf'˗JBTZy@ME,w͓$*-:@lmhi!B[mҔ6hI%BD! """-{BhKmBI(BD IR".!P6R!)BP$)JR"JREt;!>v4ZCkeﶇyhqZpۍ2RLCe 86!M 2mb$ƠR܊O*mi+IF_IsPxJ>"4@(hߵ8}:֎֡w*J#YZZOE#}Re; EER>-Hz3trjD5R90T* ٤¡i锪{)f,8m .-fzVqŚԣ5t=2NIb>Dx„$*Q\WZfJ333BJQ FҢ3 Fɶ#q^IkQ3Q lViYcC&J"$q[I!2m5jNFkQN*?a<)ZQI"=n㤧hnJ723ZBp*"׎HKJJoJ4tR\tE-RdZtjmB^N}2`TƟ BĖ$Gy$Ji= ^͋R ȇ>3">I/F^aԒDGD}#/B,nc.3Ԓy \"2#"[k#"0hLv6oտv`~s(ELwco:?ҁ>c{oGr|#`'i,xbù;i>sӇX=="ek ѽM]}[+s{ͿT)mԹ::{N^D`ͺ#\KsYpe'EqI]z.]uOr|,kϿ[׽/~;mVo]WmG7m'$Uouk$\~J}Z MAybC\|.6Rr%Iqć$<Zn)I= R?nzpF]){{v׃䶶Oһwt rx} eN3}%.nzֻMnWߩCaLߦQ>޲}[_}tV Q}ڻ-Z u }]J;}I:ɹS̏" !\r,wx)1ȋU%)VhWU?X=ՇM[rMHUY25sNrw=t{M:PpX  .*ñXq܎<*.5AuӐSdƨ}8OSB#6>!k>JoYN,:/pߊ|95*.RLƩ\* v4yR@$DH.FuSƳ͍UxFݱumz+KSZ&Tn5“P\iv4yR $T%L.\:@mj; RW构D۬՘zpF:n-]έavg;uTu6>nzBPmF -d˝K`=^T;pg2vU ^Meۺos@)rT]KʼnB˟_mi5v: 1*8慤wU--RA'ț^!u8WfLAεtͅ_6 mA/yjyJ$ Bk߶ +T)rH6㻧۠}\Ab\չ֏{wr.skԛbFzpn+U>lV+T)RI6wJTE&R\y $pIJ'InV-=A'JmܫYIvϹ>6՛j6%{CF&IR(Ԉ;LG}ڙF)ߍ[Ӯ>nuc(^UDj˗sq ^IZF.E\(".vCɊ"S Q%: Ra- -{YW`q|1]vV9ʵ$ub# =+vCL4cyRDYː11duM6iq | ReȴXavVB|&s6{ͤg#|;SvD2}}'lگT|CN/_ͣm8o*W~<wq*TnޢݨuK"._7b&Mo!mEy|2ԕqZy|~H 'V&da[Qn٬یd8$MQ,srP}NܰH$jݐթ}+ձfy,QecF7jbx5G1=ɹ26pU+zƦ4 vBg\Em&8Zqz% 9J %!ǓB.L?o9Nh`pDsnh]Ӷܳm2B^(Ԫ.ܧȉ>'m|m*nyf7h\nyW[uwlKZHav΋Pe8c.8+)%ZNIjJQ`=p'TFmﳽz..&i`7v ܭ.\i[o?J*}'b-M^Ջ&ʘvLzv"7{)٘ʣ۷=0%\J_p-%%?kxw!:>3vܮ+"E1NO_ܟgjKo\KԧΓqM)]\F},A:di&n'2եN%sEQ릺3|Y&˸*6́.\q,QJͷ>^ y/RjSyxr޾F2?`ꅹr`˲5<+X[]P-FfH+dLƞB=g %PLTʉV)B]kyhG-u?h3/F,t̬pGXjC.ޱ"ڽ2=M:] =ޢÛ 3 /GtMfLX\rNQ@zU[C;Ed7k3jwnLׄc(I_9/+eC‡[Wx4$ĭu"2W>0v9fЭSYz$ /wp8OOh9e(:\t#*z c?$aJ:ͣn"@,; % /bF-Y#EiW--2iN#"R ҥ8ɯ"|uboG\Șñ\^lQ,۫qh]~sL f#0:Tu( wթ|orc3 cʼ]vME‰uuT9$f[mKo%A/De6!! pI ~:T5hM&B {Nfԯ1w[tYvYw*$*xX \7n?Je:Ɍ<èF>֯1q۴n.sZխuYUo{_+ש9[R*sa0n̺@~;y*4E!iRBR3  `,pdrth;XW~5#<$}$S:ܶBJ ~rR6X)GN(͉w;N}R쁑'ꔄmԥŠu8r(Et޵xmԤŭ_]^tUUoHQNh׵vM{/!eɮNT)[IʅQ$PkSP%%%BZ( T2Y-n;zˤN0LJ\ 2uf '^xaՎ/;R&^9Szo#æʤELjs6&]+e!v}2'Bdc?qk$&m>)SRT#uANMa)yjAMNf&[ eX[݅*˥u0ޙ.sϊ:\Ke9Ƿ/ЪVdQrBRug'\v.mxMokt:̹x88W.-1N,n\}w;n1 B=.A*\QulQ̒H):I!VFn'^?툕˲_VVJ-*DĹ|fxe6(ڈ!7LKRHRZL4H.叞]%UNpvaO^x-7~LYˤ?KaȢ -gR&8luo{7쬬k| pI_q7V$q=vd%K>#z )gR%zHCHy2[iه1KKm)F$2Qzcu:}=_Y+JΕY]VXس؊j܏UbA~m<i3}S*^xre6ΗdS2*CߍRKވ1EX,Ztl1q&;*aZvBpubNuƠ0m9U؂Y;^ͨdsd߷MŔ۞bJbDZa 7i rI4$:.A/ е8(D] 6r ƹA3퇋2BUavS1q)6uno*(*SVm5q}2J=^P91= r*E]t }R6Rkwj[Ժ}JX3eʥKۜCkGI2IJHϣIjluIUlG"rK%e]:2KH6Ѫ5TzJrrTd;CwtUr!ݺȴlS9*LOmطn*'{B֍K\=T*V)1KJz5Frxy.NP'$PD]^~mpV% ɲ52N$ XwۊHk/ o 2jXGyd_]킫*4㋑힧0~r2.(əs ˂I.J]"45Fbm!哅{ӎ,Dҥ2Q6q-ӎJQJp"Ij_ק@.wn&mmXoʴܾidθz6XC*Ʒr+ShkqɕicE6T;g1ݛn8µA]j`% m6 m8g25oW",G22'!KGl–THTfCkR"Ndkܖ=qW kzkVv ]rݹ-MrYmt"u)qRDdd<훊ʹn6U-ҮUۮAL[|UnXmT&$0RNH)*BIQI2ҤF^! =o^/xloJΊHzkhekqg~غ˸ڽ~T{ov׀}L`aٕJGJQWۆ(TA/+ghWtݫ;W>XUn76۵S.m@)*;:y2ST\%Utӏ$8fKu:٬ҥC*a$I 3Ԕ̉+ q啯U{,]e|#qߴMtAi`=k9Rv,TklܑQ`:%cC^fd}uw+&kXv-)ݑ!eY/\4h.JaNgµ-)Z P Q1XMQ\wYd\O[s.gQ[v_u,f=_rSVs<iJj*1&tSB8ҟ5A YQ-^lg2  _5Y+ty[z{_5׶hv^{$/6#Jz($̢DfcDmܛkkfJ}swv{Tr>ͻgevj5tu[#So{۸ )ӣԓ}2*$?poK9^37kSW(rM/ RKeOEu @TڽUj !TCG~+v}T`S0]Ufؾp꛾qko vfzfG(N}AJTڵTj!ԥD[2|my6Z8ӏRl5@ Mn;h>mRE:TW|㼳/)*l.]smzXFV&S%X#q@>ӥYg;=LȔO^V4Xi2%mt̶jf U4_i2[ho _A$#6֕k$q-O!B\Vóo#|E oN /N p$$x\//Z'lHw 5~j$R-&^\J^07Wv^ uŏ葇2^!D킋]9X B9ЋZ˵"C\g\VZ@F}v~/˹.M~?Ӹi52\m5jlga[ps%yf˿=QEkWUn$ǜRժffHeJ[OׯuhR=OIQ?Pپ*ٓ*5kyٸU wMoZ3qDFWueZ4((p{)0'd(oߨg VLjPZ5:vLiۥpGVqe48HpwZRaNine75L8?еWds=)į̟\vDͱS"rV7SfmY L5yqur5UYĹ%. _4f|2]j.m3ƫwEJ>]i5+J{3*7]VU)sYT%yKΫJu'K{U#Qg}&[ n?n':K -;.%pR)+.AZR&M4p܎K n7 Reqc{HDT(~Mr ʓ1m˄!,I_B۫BWѧ$]8 namީR5SeC. vd&\Wac) TW#KA:ڑ &Zj;O*ߪ{5, NqJ~Yfb(.ŐqWܳbR ԈI48DP9 `x.&͢zY;S. Lz]zŒxXV4GkJױmLo9F8yer_FY|VdkXN8.'k W,)SEa&BZ.9yZZSfok.N ]n ;Q3;ämmNiqr@N5r?AfDlm6ͪSd\m&᫄E 5"s:VRd\~ǧziL;BjeYq9. oi5KNJD&x3dџd.-3շcn*ַjSkZrmyuf{@.j=;^Dy͵58]nι[q5kllU nҹuV{BRg:E?\Ly1G\JS}R_7Z%yu%З \d^H_o2e:t=W2:eIW.[K/\t۴zV*/S-=:1ݔ&̑kfG7'Wj|MW"EJ;L\GsxS-61%-2yw栌5bJ2JFdJweXLW*FÛ^X&Tͨ5 Uk}xɹ]mٷVsgK+!kQJSWlVj6ƙ\Yr4Ϩ\UnYֵ&v\5III \㦵Fc$֗C F i54&>; 1NO6U<^@˙+1;Us(=}|%Cd=R9#߹^{ᾮ%< J*5JJD^_ tv12V6;vp`njs% 9bV/j%L|lŝ6Y6 g®aa_Ij]mԑ Y,= n^ֻrVEVޫ7+')v蹕.˿; o;)>E17.$dthn>庲6A S7 ;%I0Av.{ W}@-BO))I̎uPSJj_-xw/M%2dZ ul Xmg'a}g\a7k[8k*ѲmP~vm7i\E6NDǣŐկg&{lY+m7\)4|m]߱udUd:NDǤE} W]Z*_7485;Җ'ꡒB2""Ww{]ؑo=\nȡTq-DWPrd{3Ԛ=+1]ZaW)*M:jTfJj&i,!u^;Yky:C}ڄ2%빊٥)yvqJT9JRi;VR2SQ$TvcHGo.jݙJ |KqNI%32﫞w bMʷz˶}5'c#=ge\ߣk[3J9litx#0nǫڀ/_FgXw{f&F%,2hUMz̪jZ)f6S0]:\_v_d]e|vf} J^\j|¢ߏƔ#iƨSۖrKLu9זgUcj&KC>=H#pZ=;d}_?|f?ÑiM?Ɔ ?o!ޱ]le8r;"UTk^fLݧN 뗛8Ņ ҹ-:Hǧ{}fq; խ\kfĭeݫO w8ȇҹ-!F:HF\t~A0ᤉ(7\-:WA㝰n[1_W.{xyO&YcK^խ܉īwh6Nw2S jGlk 1Ǜhv]e6r~H{^>ǘo{c/ mjU/se2vv.!I^FBQZiq6KZӧA%)5〪;4$mb|eS%=ڍQ~_umJ:g"jdWKjiJi*}n^73]N!U׮T3ϨP*/R+nmVſ2VYmKHmMIZM%j6G2[9h4%/&FZ~wյgX 7XyO؟V!X4/pfHvMƼ-QhTl/kK4;AۆtfPyutM3UxNWaؔ9^̓J5_CbxLVaTWJHjKCN(IFpH$Jwd$"&KYu#5鮠4"u^Y6qz/b"m2YI/I]̦vԠ$6:cGuhl̵ 3|6w_}PlK!yn~M{"͝LmU\v}4 %)9j;Cf(Up5̉)5èY!Y3?bB(ŗDzͧq>ߺ۴(U۰\ل5mE=5Spۥ)s.a~LJ՜[/|O}tiPtɔjڋ_"zK7,Jm|㫅'@az;ǐӌ>ËeByQƝmdkIdFFZ2w]aa[/2۬ڍ4k$ZL"220Uۏ2nx1p  7+ZjG7mR4JSBWTd#3 e]^J"9_ޮmdudl~~Z/܇rj1%Yf4;"Nf\6(%X(ubr\X\o+4Oz6U;+g63&_9udb*)<}l5zŃ&ԩm<a*GCU]>7Z䓜%馦i"е/:6An.$RqDVڮ̈[OZޘ_&bީ_%ߨ[D8TsqcFELޮM]YݿmWp׍v)-CpHץJSKg:oVmʣ ճCېGSϭoԖdqk3>ɤUuh{j{oJ[ڦP線4\e\EdFBH: mI7CM_ޏYUme-kͮg}X7oxmj[ȫ}bٕj-jM4I7CHar xqJֶX`,Fump K."2. ֶ:6M&y𨛻UUZ9 PLtHڭsV.ȆK%ldNth0کSڗ̶䶥OϹ5CnSi 1CıshGk^̛ln*A5bU{lݷgTScAFԨMy)-)gIkF^)ϑӯL-Hrf׺lBt bLum㌍lysIpof.s]VfѬ2-ʫk'=MdjrFٺڭ--{d,]d$f{ ~[X4E zIݭ6Ilz<4M%CH"mE mWR)N%:D>.-OB0-v{mzΤĬ_\ԝUp5mfҿZ%bW%i3*+jRUR3ֿj/=ZXk֗ڦ GMڟ5d]V@2'jT߶SQ *pPaN2a.:JJ pJ)QZrTdZw3-SIvhB/ [gz[붼.6 ƹs c΋t79vB[fnQ[%0Nv6Z6]wnw6&>+;د-d\cu1Q+-ض8xQy9ܡ]mmDkz\VGj1R22ڸ;Yb۫B\ŗ |M$I?< @Mߒ ?P`Hlq/}sAY RjשTZԐm 'iݳϟW_7}[~׈R`ϫ~eAXktT,umHT[/\lXFkEKdJI SK$e`WH(/*=s%עZ,HFt?$Д6\mdZJ*"2 mUJ:wKJ0ȻiN_hC>OKAvH *]͍r*+5!9\fk|$$ ]1p?LsYU*ߖʷe M:X^;ewiنfip;mԡDFI7N4]iQt:lq׭*}ˊiwnZƴd%DFID#Ii3#ul^Z]sP-Z ҲDg!daO^IgC 3G# ƌ5$2 ZA[mEe3"m-Gl0>YB[i "/pC'Qf3 # H&m%(BHqE3EJ{1>ȔX8R՘I_e!--5k.Tl4̷jTuIU"?)KiKMz&H,2B-iЖ]`J1('-5=qjk6-ʼNM32)jGE|Uܠ=aSu'⬌aEq1v$Trj\UVW5A#"QLUjzv$)>'[ʥ6; 3TT] |Di1i#QREiSjӛO lRiRU"%J"">" uHnd[P*4:ңPAOj"Q?!DZEBR)DJ2JR3RgtHFIIf}DEff9"32"#33"""ϠL:XԚ~TPT:tjXIiQU*3]f>O}Vi RI#1Q5c̪2d'{R>wВ>f&PgyA?eif?鑷_la+"$DcY2&-$Rj"3KDcIHa Dfyj"IiNZ.}I>̚4QdKIkbv͹7Om[R@;.Xb :̉w ǣKLjnJ[ijA$̥gPSJZjJZjdE씩jJZj$"J==3ZR).zjzjf(7MD2۴5{ϢPi*iO.|ԁ9l4p QiQ_!ȲQ}\GfD.&ԤA`Dñ^[υhJOB=8jIcղxlZx ȏjIcqwv8VFQIط{M\JB"W{ܺi-&A&%G. C5 K(mWE2"<ѦN2Sn1ީ2W ̋1]7X7SJԝKz:Ī)wMYh8R5.x4ڵ'`ӝFu=3"]C/ᐵ&9RQk ZݻE:^GȻPƖLfRtȏ]vQUjެVJ]EɰXÖҷ C5QU^ޡUк=r\&d-=dFd~0 IMR>A#rm+mqkJ+NDJ^IO$CӲZ o[MAprήWɥ:piqJ/$N1)Bg5w]Kr.K:zܺkEFFe2Zl8rYDs[SKaV^*if JزaJi/EYYjXښyY$bdi$JaYjX}4j/+mFG ۬ jJuOf\5 2RjRqRQ薘]%]E:4~msdftq3-)(Ithxy:KS[uտQ5N}z% I$th 2`,}CM>f ;3~H7[~>)0gտVɍB64UZ_}j wl?hjﯛ~k?߫GdgPdqV"7#"27FGFFԌR1#u2ԍ#!ݲh##ZH^&S.r4ûB cK.5Pz4YR&;Jд( -̚g~d2s)g?Xm;_B1+ZoF⽱o2i@Ew2|#;NЬ|?7#q^RMBFKh̴%FI4(m)~I| B.AgC.Q:)%ޢR#%Cie%2񌉣Ju-|R=|Q:SN7ۚ/gd| 2ߛJ. -O*#ks^- hy(ۋ"2dƒ$Ԓ3J]+tE֗RPi3幡L̋R2"C-:lt%ԧbJVmɷ fdZ}Oc%fZ7F1h1KȶeU,uʉJ|jJGNb%b2Li MJ(Ӗ4H.4yHL>$C-q%.%DJLڱȗ%2e7RHu$j R%DGa$Ki1hq$keDGWn#m)%շ 6tWH~ra,|bjx!TVX FH&_g[ e7?BGw6/X+ZoF⽱|S)1܋gQi r$S{ܧY&mw& vRןrTiT<o_WevHΊLL}U Ɖ]Bb%Ə) ĔHes.$ĨZU 6BwO"F|N6fpv:BwO"N'j3Ih~zӲʸPEL=;xg(*M5n$2B\*ҒD)1֍SUj?N))uOQ  2 C-i\'aDdFMR{Tgav3ţ+CӰ2#J~*T#!{vx|h{UY5Li-W [b=nR2U.HK泮jleAyfӎhqPXa/6 םY!ZJ>m4!qD!%G"iǜCM!KqP`{*張p>3&b(8{vu0m -vTN\Q - ێ++ѬxqC_&DfTd'ȚT32O> m%DfL6Lg#-zEddLq}R5jԫLi2)Ԩ3`Mr!5j[HQRetA~,F#8%ahDq!(3Qc]pGn+uĬA6J"BLJtNj,X 4qĬA Djut~ᾝk nn3rY{;bN׍S"U-zN뺩ӕKjkP3ڊmȚoնi=mㄶB\mdL:dJBҢ#-zK(Fv [CŒR(NJ}$(tVvPRJCJЭpˉ*#Id>znHÝP{x #ږ2X.V]ǔR]>]ɓNwԶZ +QdzG&]2HɵAFFI= d2Si4> 6#(OC#FDrO$,"2BuuT2v9?~N-saLdęMOfLYQȋfDi HZJfFFF5b|&"$*2TDC)RTDd7FFGdd#G"T##y22Ԍi###22X"7#"27[##-HDdd}FC BSm=Vz *"J"ST=v\ :|G|l^iiqJIϽţyL/̆\e7?BGͧ| V>f?bMW0jSi!۝% IB)BD%"!hCum)B-I%)I8$$DII`cBjR%)I8$$DDD^ :+"ueU}_7϶s]\\erVmP%[:]UqR<ZFfyVڥS~Vۆ]dFR> J㰢:YnFekQ\-T g ;+) 5--jB!uuηLCbqj_\;[}ɶJX*-Զ/z] MFkDvJyk25-Fk؇2Bd}^kɾDGIA+^ˆC0УIӌY ٻJ<\EװaWG]d5ZC| 4LDA{{}n=ݮfn9)UTo1/_vIEqs(r$="4>^223#### $e fddfFFFGvHN22?~PDD>ӠNSaԘ"Ii/FK*[2#HeiZV##21W4ժkO6Z\%mzꕡDiQd*4!ڜ&BmoOB22P!Ta%)>)*##!\}bުdБfͧ| V>f֛if鑸la+6HD)jM*&,%IK2RL###.%Siɍ!I *KTQX##&dddޤdbu=1)0aIaJ3$ddڌm\qﲿoW ow;ѫTjH)5j\2";[O4!i4 V?g1* ."t(^HIɎm &•}25Iޕ;R#}44z%֕hJ$t|P4 \n1y So2ۆD5Z<_#z\YD[Fݦ0F+@7dQDEKe^b4$UVnMANhV_Qe֊OhimŒ5KmIl]HeE5llօ h5$Ȕ%dJ8ۍ(5H%3)Z I2Jd LW zKgkɽ6ozllBT9eF}⼴-'d0gގpî2xmFvtԆ$y댸Z-Ri?n]q EO$?f3,qvouլ,lfTۖoZ#r\u92Clc"‰L~CMhixmGRj&HDpKVŦfSЍ˺%+_%#ˁ'I-K̻IpR]r*7˺Ƕnv6"#_s6ޅ =|)4lXFB~ƢK< :էѭmKpu)`DZ \֋ IFfK-HiM54hu4I%$̌.Ȯ[Ui63CK3&df̌Vh 4Qm[4f?0bMW0wM32S|σ$si8BuYdn+[].=,&d~"4N5+N'qBӬRz)(%3/~NXN\ͱnk2?nqRܶh%Mg+Fj_"$轱יhQaF;m5[C1i5VI2 T)HC(Mi+BJBj-IIQ(܉bBJVi*BJJk"2RLow:1tc]-ɸ*֥kW鶤4ݹrP'idJJQ;F&_ o~1{NЬ|~D?֛if鑸l`-̚g~d̦H3Ӿp+3bMW0jХD 0i5Cz3.^5(8.? &EJ4oLؕ~KJ"QƬOM5JQ}&CovF=q[h% fnEQ"*" }"~K${ЈHn2I. )IloE|ϙhfI2m.u"N##>R\>q:F2̒eą`K]: W9K})7tLe$ˉ "FGR/\9~bىw-ԜRk&lvT:T$7R'Ṽ̧*#},2\kE$#3%4䚚}:ٚXYfFZGdEYi-o6mfPfM(+#I@i6m١48ѥj2&^Py%̫0G_&' b{W.%_.tڴZug(Q.GJ_a!dqhd>!M>Бf2si8BX,27ţyL/̃3 awca]ioKGOz=: #xf$vGW T$>1G"[ÈӉpv[ZuOiA(I1H*SDӉpv%J ELߓ9l[û\u-2qwjwvѻ/ZWEH:/lGsEipXʋH~9>Z2&YI)Ztq,ȒZ~!jbƦSLvρ$\o:e6NTfzxb˦ܩJLvυ$\ne6NTfzxc `3TEw-i]>Ő-YC*V TgQ--}ķ`CHV*\:+2%.ܣ[JZӮ*D%zhgĴ[Ի$I{iАDfYKϥ.C=TZ#RDC"Dᤉqzh^J]qG3Dd|d׻­[XƓ=<': TJZ\\y4I!)%:-\q:'qд8J/M*|\m.Z2\&2*r2"Z2Ek#!WoXNɶn2kld+cl+ώLʳWe*ɟJ2~Id+bpCHTehn]jJZeKKFf<5i2>.NF2cgqjQ/jKZӡ$jѡN3%m䡳Q,ԗZĞzQԣ-^ mw; q?Lpd,@*4itFuʛGm⊝TlHKIR"7#"27FGFFԌR1"7[#-HAIR2Ͳh##ZH^S.r4ûB cK.5Pz4YR&;Jд( -̚g~d2s)g?Xm;_B1+ZoF⽱o2i@Ew2|#;NЬ|?7#q^RMBFKh̴%FI4(m)~I| B.AgC.Q:)%ޢR#%Cie%2񌉣Ju-|R=|Q:SN7ۚ/gd